SNP (Single Nucleotide Polymorphism) molecular marker associated with pig backfat thickness character and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker associated with a pig backfat thickness character and application. The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO: 1; one SNP molecular marker site A / G is arranged at the 254bp position of the sequence of the SNP molecular marker. Genetic typing is carried out by utilizing a gene chip technology, whole genome association analysis is carried out in combination with the character of correcting the 100 kg backfat thickness of a large white pig, one SNP molecular marker remarkably related to the character is screened out, and a new marker resource is provided for molecular breeding of the growth character of the breeding pig.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and in particular to a SNP molecular marker associated with pig backfat thickness traits and an application thereof. Background Art

[0002] In the pig industry, backfat thickness, carcass lean meat percentage, and carcass fat percentage are core economic traits that influence pork quality and breeding efficiency. Backfat thickness (BFT), an important indicator of a pig's fat deposition capacity, can lead to reduced feed utilization efficiency and poorer meat appearance, making it difficult to meet consumer preferences for lean pork. Studies have also shown a significant negative correlation between backfat thickness and carcass lean meat percentage. Therefore, in modern pig breeding, precise control of backfat thickness not only helps optimize carcass composition but also plays a crucial role in improving overall pig production performance and breeding efficiency.

[0003] Traditional breeding methods, such as phenotypic selection, have limitations such as low efficiency and long production cycles when improving complex quantitative traits such as backfat thickness. With the continuous advancement of molecular breeding technologies, marker-assisted selection (MAS) and genome-wide selection (GS) have become important tools in modern breeding. The introduction of GWAS (Genome-Wide Association Study) technology has enabled researchers to identify genetic markers significantly associated with complex traits at the population level. According to the pig QTL database, a total of 3,402 quantitative trait loci (QTLs) associated with fatness and 265 QTLs associated with lean meat percentage have been discovered. These studies provide a theoretical foundation for further exploration of the genetic basis of backfat traits and for molecular marker selection. In recent years, several key genes have been identified that are closely associated with backfat thickness. For example, the CCND2 gene has been shown to significantly regulate backfat thickness in multiple pig breeds, and variation in its regulatory region directly affects fat deposition. In addition, studies have pointed out that genes such as SHANK2, TSPAN11, MC4R, IGF2 and HMGCR are also involved in the regulation of fat metabolism and are highly correlated with back fat thickness.

[0004] Although research has made many advances in analyzing the genetic basis of pig backfat thickness, there is still a lack of stable and effective molecular marker resources for controlling backfat thickness in Large White pigs under the condition of correcting 100 kg body weight, which to some extent restricts the precision breeding process of this trait. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings of existing technologies and provides a single-nucleotide polymorphism (SNP) molecular marker associated with pig backfat thickness and its application. This invention utilizes gene chip technology for genotyping and conducts genome-wide association analysis of the 100 kg corrected backfat thickness trait in Large White pigs. A single SNP molecular marker significantly associated with this trait was identified, providing a new marker resource for molecular breeding of growth traits in breeding pigs.

[0006] To achieve the above purpose, the technical solution designed by the present invention is as follows: The present invention provides a SNP molecular marker associated with pig backfat thickness trait, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, and R in the sequence is A or G; There is a SNP molecular marker site A / G at 254 bp of the SNP molecular marker sequence.

[0007] Furthermore, the backfat thickness of pigs whose genotype of the SNP molecular marker site is GG genotype is lower than the backfat thickness of pigs whose genotype is AA / AG genotype.

[0008] The present invention also provides a primer pair for obtaining the SNP molecular marker, the nucleotide sequence of the primer pair is as follows: Forward primer: GGCGATCACGACGTAACTCA; Reverse primer: TGACTGGCCTCAAAAGGGTC.

[0009] The present invention also provides a method for detecting a SNP molecular marker associated with the pig backfat thickness trait, wherein the method uses the primer pair for amplification and sequencing comparison to complete the detection.

[0010] The present invention also provides an application of the SNP molecular marker in identifying the pig backfat thickness trait and screening pig breeds with low backfat thickness.

[0011] The present invention also provides an application of the primer pair in identifying pig backfat thickness traits, screening pig breeds with low backfat thickness, and pig backfat thickness genetic breeding.

[0012] The present invention also provides a kit for detecting the SNP molecular marker, which includes the primer pair.

[0013] The present invention also provides a method for identifying the pig backfat thickness trait using the kit, comprising the following steps: Detecting the SNP molecular marker site of the SNP molecular marker on pig chromosome 7, and determining the pig backfat thickness trait based on the SNP molecular marker site; At the SNP molecular marker site, the back fat thickness of pigs with GG genotype is lower than that of pigs with AA / AG genotype.

[0014] Furthermore, the detection method comprises the following steps: (1) Extract DNA from the pig to be tested; (2) performing PCR amplification on the extracted DNA using the primer pair forward primer and reverse primer in the kit; (3) Sequencing and analyzing the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the genotype is obtained. When the SNP molecular marker site is the GG genotype, the pig's back fat thickness is low; Alternatively, when the SNP molecular marker site is AA / AG genotype, the pig has high back fat thickness.

[0015] The present invention also provides an application of the kit in identifying pig backfat thickness traits, screening pig breeds with low backfat thickness, and pig backfat thickness genetic breeding.

[0016] Beneficial effects of the present invention: To this end, this study conducted a genome-wide association study (GWAS) based on genotype data from a large white pig population using a high-density SNP gene chip. The study ultimately identified a single nucleotide polymorphism (SNP) located on chromosome 7 within the functional gene ABCD4 region that was significantly associated with corrected 100 kg backfat thickness. This SNP marker provides important theoretical support and technical means for subsequent molecular marker-assisted selection (MAS) and genetic improvement of backfat thickness.

[0017] Compared to traditional phenotypic selection methods, the present invention uses molecular markers to more efficiently and accurately screen for superior individuals with moderate backfat thickness. Breeding pigs with an appropriate backfat thickness when corrected to 100 kg body weight not only better meet breeding goals, but also help achieve a reasonable balance between lean meat percentage and fat deposition, thereby optimizing meat quality and commercial value. The present invention has important application prospects in breeding pig practice, not only helping to improve the economic benefits of pig farming enterprises, but also helping to promote the development of molecular breeding of pigs in my country and accelerate the selection and promotion of superior breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Manhattan plot for GWAS analysis; Figure 2 QQ plot for GWAS analysis. DETAILED DESCRIPTION

[0019] The present invention is further described in detail below with reference to specific embodiments so that those skilled in the art can understand.

[0020] Example 1 Genotyping detection and data processing 1. DNA extraction (1) Ear tissues from 10,891 Large White pigs were collected and crushed in a glass homogenizer. An equal volume of cell lysis buffer consisting of 100 mmol / L Tris-saturated phenol, 500 mmol / L disodium ethylenediaminetetraacetic acid (EDTA), 20 mmol / L sodium chloride (NaCL), 10% sodium dodecyl sulfate (SDS), and 20 μg / mL pancreatic RNase was added. 10 ng / mL proteinase K was then added, mixed, and placed in a 65°C constant temperature water bath for 30 min. (2) Slowly shake the centrifuge tube containing the above solution for 15 minutes, centrifuge it at 12,000 rpm for 5 minutes, and collect the supernatant into another centrifuge tube; (3) Add an equal volume of a phenol-chloroform-isoamyl alcohol mixed solution (the volume ratio of phenol, chloroform, and isoamyl alcohol is 25:24:1), shake and mix, centrifuge at 12,000 rpm for 5 min, and collect the supernatant into another centrifuge tube; (4) Add an equal volume of a phenol-chloroform-isoamyl alcohol mixed solution (the volume ratio of phenol, chloroform, and isoamyl alcohol is 25:24:1), shake and mix, centrifuge at 12,000 rpm for 10 min, and collect the supernatant into another centrifuge tube; (5) Add 2 volumes of pre-cooled anhydrous ethanol, let it stand until the ethanol evaporates, pick out the DNA precipitate and dissolve the DNA in ultrapure water; (6) DNA quality was tested using a DNA concentration meter and agarose gel electrophoresis, and DNA from all Large White pigs was obtained.

[0021] 2. Genotyping (1) Based on the DNA extracted above, genotyping was performed using a pig 80k functional site gene chip (liquid phase chip), which contains more than 180,000 SNP molecular marker sites; (2) 240 samples were randomly selected from the above DNA for whole-genome resequencing data. Fastp v0.23.2 software was used for quality control processing, bwa v0.7.18 software was used for alignment, and finally GATK v4.5 software was used for genotyping of the sequencing data.

[0022] 3. Genotype filling Beagle v5.4 software was used to fill in the chip data with the whole genome resequencing data of the above-mentioned 240 Large White pigs as the reference group, and SNP molecular marker sites with a filling accuracy higher than 0.8 were screened for subsequent analysis.

[0023] Example 2 Genome-wide association analysis between SNP molecular markers and the 100 kg corrected backfat thickness trait in Large White pigs 1. Phenotype definition Correction of 100 kg backfat thickness: The vertical distance from the back skin to the longissimus dorsi muscle membrane 5 cm away from the 3rd to 4th ribs of the pig on the back midline is the actual value at the end of the measurement and is calculated according to the correction formula.

[0024] Refer to NY_T 822-2019 Pig Production Performance Measurement Procedure (industry standard) for filtering phenotypic data: retain individuals with a 100 kg corrected backfat thickness phenotypic value greater than 5 mm at the end of the measurement.

[0025] 2. SNP molecular marker quality control According to the SNP molecular marker sites with a filling accuracy higher than 0.8 screened out after genotype filling in Example 1, the filled SNP molecular marker sites were quality controlled using PLINK v1.9 software, and the SNP molecular marker sites with SNPs missing genotype ratio <10%, individual missing genotype ratio <10%, and SNPs minimum allele frequency (MAF) >5% were retained. Finally, 8818 samples and 14010437 SNP molecular marker sites were used for genome-wide association analysis.

[0026] 3. Genome-wide association analysis of the 100 kg corrected backfat thickness trait in Large White pigs The experimental pig population used for the genome-wide association analysis in this example was 8,818 Large White sows. Based on the corrected 100 kg backfat thickness data recorded for the experimental pig population, a genome-wide association analysis was performed between SNP molecular markers and the corrected 100 kg backfat thickness trait in Large White pigs using a mixed linear model approach and the MLM analysis module in the rMVP software package. The specific model is shown below: Y=Xβ+Sa+Zu+e; Where, Y: phenotype vector; X: fixed effect design matrix (including sex and measurement season); β: fixed effect parameter vector; S: marker effect matrix (including SNP genotype data); a: marker effect parameter vector (corresponding to the effect of each SNP in the SNP genotype matrix S); Z: random effects design matrix (including kinship matrix); u: random effect parameter vector, u∼N(0,Kσu2), where N is the normal distribution, K is the kinship matrix, and σu2 is the variance of the random effect; e: Error vector, N~(0,Iσe2), where I is the identity matrix and σe2 is the variance of the residual.

[0027] The rMVP software package automatically generated Manhattan plots and QQ plots based on the data, and the Bonferroni method was used to determine the association significance threshold, with the threshold being 0.05 / the number of effective SNPs.

[0028] The results are as follows Figure 1 As shown, a total of 323 SNPs exceeded the set significance threshold. A clear peak of significance appeared on chromosome 7, while other chromosomes showed mainly scattered signals. Based on this, the present invention focused on the most significant point (leader SNP) on chromosome 7 as the target for subsequent analysis.

[0029] The results are as follows Figure 2 As shown in the figure, by comparing the quantiles of the probability distribution of the actual -log(P) value and the expected -log(P) value, the two probability distributions are compared to further judge the reliability of the GWAS results. 10 The P-values ​​are consistent with expectations, with significant deviations only at high quantiles, suggesting a true association signal. The overall graph shows no systematic upward trend, indicating that the GWAS analysis results are reliable.

[0030] Table 1 Candidate SNPs for correcting 100 kg backfat thickness trait in Large White pigs identified based on GWAS As can be seen from Table 1, the SNP molecular marker site most significantly associated with the 100 kg backfat trait of Large White was screened out in this example, which is chromosome 7 and position 97574641.

[0031] Table 2 Genotype frequencies and genotype-corrected 100 kg backfat thickness phenotype means of candidate SNP loci in Large White pigs Note: All genotype frequencies are rounded to two decimal places, and the values ​​in brackets are the mean ± standard deviation of the backfat thickness of pigs with the corresponding genotype adjusted for 100 kg.

[0032] The number of individuals with different genotypes at this SNP marker site and the corresponding genotype-phenotype means were further counted. The results are shown in Table 2. For the 7:97574641 site, the genotype GG was associated with a thinner 100 kg corrected backfat thickness in Large White pigs compared to individuals with other genotypes.

[0033] Example 3 Single marker analysis of SNP molecular markers associated with pig backfat thickness Mixed linear model (MLM) was used in SAS software to analyze the association between SNP molecular marker loci associated with pig backfat thickness trait and the 100 kg backfat thickness trait of large white pigs.

[0034] The specific model is as follows: in, represents the corrected 100 kg backfat thickness phenotypic value of the i-th individual; is the population mean; is the effect of the i-th genotype (fixed effect); is the seasonal effect (fixed effect); is the gender effect (fixed effect); is a random residual effect.

[0035] The results of the significant difference analysis of the 100 kg corrected backfat thickness trait using the significant T test are shown in Tables 3 and 4.

[0036] Table 3 Single marker association analysis level of SNP molecular markers Table 4 Polymorphism of 7:97574641 fragment Tables 3 and 4 show that the SNP marker locus (7:97574641) is significantly associated with the corrected 100 kg backfat thickness trait. This SNP exists in three genotypes: AA, AG, and GG. Mixed linear model analysis revealed that genotype significantly influenced the corrected 100 kg backfat thickness (T-test, P < 0.05). Specifically, the least squares means (LSMs) among the three genotypes were significantly different, indicating that genetic variation at this SNP marker locus significantly regulates backfat thickness. Combined with Table 2, at locus 7:97574641, the GG genotype resulted in thinner 100 kg backfat thickness in Large White pigs compared to individuals with other genotypes.

[0037] Example 4 Obtaining a SNP molecular marker associated with pig backfat thickness 1. Based on the pig Sscrofa11.1 reference genome in the Ensembl database, extract the nucleotide sequences upstream and downstream of the SNP molecular marker site, and design the primer pair forward primer and reverse primer. The nucleotide sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3: Forward primer: GGCGATCACGACGTAACTCA; Reverse primer: TGACTGGCCTCAAAAGGGTC.

[0038] 2. PCR amplification was performed on the genomic DNA of Large White pigs using the above primer pairs to obtain a SNP molecular marker associated with the pig backfat thickness trait. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1. The SNP molecular marker site is located at position 254 of the sequence, R is A / G, corresponding to position 97574641 of chromosome 7 of the pig genome, the corresponding gene is ABCD4, and the polymorphic site is A or G.

[0039] Example 5 This example provides a method for detecting a SNP molecular marker associated with the pig backfat thickness trait, using the primer pair forward primer and reverse primer in Example 4 for amplification, and completing the detection by sequencing and comparison.

[0040] Example 6 This embodiment provides a kit for detecting a SNP molecular marker associated with the pig backfat thickness trait. The kit includes the primer pair forward primer and reverse primer in Example 4.

[0041] Example 7 This embodiment provides a method for identifying the pig backfat thickness trait using the kit in Example 6, comprising the following steps: Detecting the SNP molecular marker site on pig chromosome 7, and judging the pig backfat thickness trait based on the SNP molecular marker site; The backfat thickness of pigs with GG genotype at the SNP molecular marker site was lower than that of pigs with AA / AG genotype.

[0042] The detection method comprises the following steps: (1) Extract DNA from the pig to be tested; (2) PCR amplification of the extracted DNA using the primer pair forward primer and reverse primer; (3) Sequencing and analyzing the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the genotype is obtained. When the SNP molecular marker site is the GG genotype, the pig's back fat thickness is low; Alternatively, when the SNP molecular marker site is AA / AG genotype, the pig has high back fat thickness.

[0043] The method for identifying the pig backfat thickness trait of this embodiment can accurately obtain the genotype of the SNP molecular marker site on pig chromosome 7 with high accuracy. Breeding pigs with appropriate backfat thickness when corrected to 100 kg body weight are not only more in line with breeding goals, but also help achieve a reasonable balance between lean meat percentage and fat deposition, thereby optimizing meat quality and commercial value. The present invention has important application prospects in the practice of breeding pigs, not only helping to improve the economic benefits of pig farming enterprises, but also helping to promote the development of molecular breeding levels of pigs in my country and accelerate the selection and promotion of superior breeds.

[0044] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without inventiveness, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with pig backfat thickness, characterized by: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO: 1, where R in the sequence is A or G; There is a SNP molecular marker site A / G at 254 bp of the SNP molecular marker sequence.

2. The SNP molecular marker according to claim 1, wherein: The backfat thickness of pigs whose genotype of the SNP molecular marker site is GG genotype is lower than the backfat thickness of pigs whose genotype is AA / AG genotype.

3. A primer pair for obtaining the SNP molecular marker according to claim 1, characterized in that: The nucleotide sequences of the primer pairs are as follows: Forward primer: GGCGATCACGACGTAACTCA; Reverse primer: TGACTGGCCTCAAAAGGGTC.

4. A method for detecting a SNP molecular marker associated with pig backfat thickness, characterized by: The method uses the primer pair described in claim 3 for amplification and sequencing comparison to complete the detection.

5. Use of the SNP molecular marker according to claim 1 in identifying the pig backfat thickness trait and screening pig breeds with low backfat thickness.

6. Use of the primer pair according to claim 3 in identifying the pig backfat thickness trait, screening pig breeds with low backfat thickness, and pig backfat thickness genetic breeding.

7. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The kit comprises the primer pair according to claim 3.

8. A method for identifying pig backfat thickness using the kit according to claim 7, characterized in that: The following steps are involved: Detecting the SNP molecular marker site of the SNP molecular marker according to claim 1 on pig chromosome 7, and determining the pig backfat thickness trait based on the SNP molecular marker site; At the SNP molecular marker site, the back fat thickness of pigs with GG genotype is lower than that of pigs with AA / AG genotype.

9. The method according to claim 8, characterized in that: The detection method comprises the following steps: (1) Extract DNA from the pig to be tested; (2) performing PCR amplification on the extracted DNA using the primer pair forward primer and reverse primer in the kit according to claim 7; (3) Sequencing and analyzing the PCR amplification products to obtain sequencing results; (4) Based on the sequencing results, the genotype is obtained. When the SNP molecular marker site is the GG genotype, the pig's back fat thickness is low; Alternatively, when the SNP molecular marker site is AA / AG genotype, the pig has high back fat thickness.

10. Use of the kit according to claim 7 in identifying the pig backfat thickness trait, screening pig breeds with low backfat thickness, and genetic breeding of pig backfat thickness.

Images