DNA-based loop fluorescence signal amplification network and detection method and application thereof

Abstract

The invention relates to a loop fluorescence signal amplification network based on DNA and a detection method and application thereof, and belongs to the technical field of biological detection. Aiming at the problems of low sensitivity, high background noise and high false positive rate caused by dependence on PCR (Polymerase Chain Reaction) amplification in low-abundance pathogen detection of the existing nucleic acid detection method, the invention designs a modular DNA network comprising an amplifier unit A and a batcher unit B. A cascade strand displacement reaction is triggered through PTGSs, and a fluorescence signal is released under the action of Zn < 2 + > by utilizing an RNA structural domain. Wherein the amplifier unit forms a recursive circular reaction through competitive combination, and signal exponential amplification is realized; the batcher unit accurately quantifies the fluorescence intensity through the synergistic effect of structural domain double complexing and Zn < 2 + > cutting. The network has high specificity and background inhibition capability, and can detect pathogenic microorganism genes such as staphylococcus aureus, aeruginosa and the like at low concentration.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and relates to a DNA-based loop fluorescence signal amplification network and a detection method and application thereof. Background Art

[0002] Nucleic acid-based identification methods are an emerging disease diagnostic technology that can specifically identify pathogens by analyzing their genetic characteristics. Compared with traditional culture-based detection methods, nucleic acid-based diagnostic technologies are cost-effective, have shorter turnaround times, and can be operated in a cleaner environment. However, when the abundance of pathogen-specific genetic material in tissue samples is too low, the stability and accuracy of existing nucleic acid-based detection methods will be severely affected. In addition, the general enhancement of input signals through PCR technology will cause a lot of interference, including background noise, false positive signals, and PCR bias, which greatly limits the application of PCR technology. Therefore, the development of a new signal amplification strategy to shorten the detection time of pathogen genetic material and improve pathogen-specific signal gain is of great clinical significance.

[0003] DNA, the carrier of biological genetic information, is composed of four bases: adenine, thymine, guanine, and cytosine. They form a double helix structure through the principle of complementary base pairing. DNA strand displacement refers to the reaction process in which a single strand of DNA displaces part of the previously bound strand within a complex. As the length of the complementary strand varies, the binding force that forms the double helix structure also varies. The strand displacement reaction cleverly exploits this characteristic, allowing DNA molecules in the hybrid system to gradually transition to a state of increasing entropy and stable free energy, thereby displacing the longer complementary strand with the shorter one. The key technology behind the strand displacement reaction lies in the ingenious design of the small pivot point, which typically consists of a sequence of 4-6 bases. The reaction rate can be controlled by adjusting the number of bases, increasing exponentially with increasing base numbers. In the DNA strand displacement reaction, single-stranded DNA is used as the input and output signal, preparing the way for the cascade between two adjacent biochemical logic gates.

[0004] Orthopedic implants are widely used in clinical practice to treat a variety of skeletal conditions, including fractures, bone defects, and degenerative bone diseases. However, implant use is inevitably associated with a significant risk of post-implantation infection due to the random infection of pathogenic microorganisms. Clinical studies have found that peri-implant microbial bone infection (PMBI) is one of the most common complications of implant surgery and can lead to serious consequences such as sepsis and implant loosening. Furthermore, the therapeutic window for PMBI is very narrow, as attached pathogens gradually form biofilms on the implant surface and become drug-resistant, greatly complicating the effective elimination of invading microorganisms. Therefore, timely and accurate identification of the pathogen is of great clinical significance and may facilitate early intervention and appropriate treatment for PMBI. However, current gold-standard pathogen diagnosis techniques, such as tissue section staining and microbial culture, are time-consuming (at least 7 days) and often require invasive sampling of infected bone tissue. Therefore, new diagnostic strategies are urgently needed to reduce diagnostic delays, improve diagnostic accuracy, and enhance patient compliance. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a DNA-based loop fluorescence signal amplification network, the second purpose is to provide a detection method for the DNA-based loop fluorescence signal amplification network, and the third purpose is to provide an application of the DNA-based loop fluorescence signal amplification network in the detection of microbial genes.

[0006] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a DNA-based loop fluorescence signal amplification network, which includes five single-stranded DNAs: PTGSs, substrate A, chain L, alternative B, and substrate B; The two ends of the RNA domain of chain L are connected to the fluorescent group Cy5 and the quenching group BHQ2 respectively. In the selective conformation, the RNA domain has Zn 2+ Cutting responsiveness, The chain L forms a double-stranded structure with substrate A, and the PTGSs competitively forms a double-stranded structure with substrate A to release chain L; The substrate B forms a double-stranded structure with the alternative B, and the chain L competitively forms a double-stranded structure with the substrate B to release the alternative B; The alternative B competes with substrate A to form a double-stranded structure to release PTGSs; The PTGSs are target gene sequences derived from pathogens; Preferably, the molar ratio of substrate A:chain L is 1:(0-1.5); The molar ratio of substrate A:chain L:PTGSs is 1:(0-1.5):(0-1.5); The molar ratio of substrate B:alternative B is 1:(0-1.2); The molar ratio of substrate A:chain L:PTGSs:alternative B is 1:(0-1.5):(0-1.5):(0-1.8); Furthermore, the detection method of the DNA-based loop fluorescence signal amplification network has the following detection steps: (1) Add substrate A and chain L molecules to assemble into the beacon molecule UA1; (2) Mixing PTGSs with UA1 to form the PTGSs / substrate A / chain L ternary complex UA2; (3) Substrate B and alternative B are added to assemble the beacon molecule UB1, and then added to the mixture of step (2); (4) Zn 2+ Add the mixture into step (3), and then use a fluorescence spectrophotometer to perform fluorescence quantitative detection; Preferably, the Zn 2+ The molar concentration is 10-100 μM; Furthermore, the application of the DNA-based loop fluorescence signal amplification network in detecting microbial genes; Preferably, the microorganism is Staphylococcus aureus; The nucleic acid sequence of substrate A is shown in SEQ ID NO: 1; The sequence of chain L is CTACGACTCACTAT / rA / GGTAGAGAATATACGCCTACGACTCAC / iCy5dT / AT / rA / GG / iBHQ2dT / AGAGAATATACGC; The nucleic acid sequence of the PTGSs is shown in SEQ ID NO: 2; The nucleic acid sequence of substrate B is shown in SEQ ID NO: 3; The nucleic acid sequence of alternative B is shown in SEQ ID NO: 4; Preferably, the microorganism is Pseudomonas aeruginosa; The nucleic acid sequence of substrate A is shown in SEQ ID NO: 5; The sequence of chain L is CTACGACTCACTAT / rA / GGTAGAGCAATCGGTCCTACGACTCAC / iCy5dT / AT / rA / GG / iBHQ2dT / AGAGCAATCGGTC; The nucleic acid sequence of the PTGSs is shown in SEQ ID NO: 6; The nucleic acid sequence of substrate B is shown in SEQ ID NO: 7; The nucleic acid sequence of alternative B is shown in SEQ ID NO: 8; Application of DNA-based loop fluorescence signal amplification network in detection of implant pathogenic microorganism bone infection.

[0007] The beneficial effects of the present invention are: The DNA-based loop fluorescence signal amplification network can efficiently convert the limited pathogen genetic information in various samples into measurable fluorescent signals, further enhancing the signal output. It has the characteristics of low background noise and few false positive reactions, thereby achieving efficient and accurate quantitative identification of common pathogenic microorganisms.

[0008] The DLFSN, consisting of an amplifier unit A and a quantifier unit B, is constructed from highly modular DNA and is suitable for detecting all known types of relevant pathogenic microorganisms. Due to the inherently high analyte selectivity and specificity of the functional DNA components, the DLFSN efficiently extracts limited pathogen genetic information from a sample and converts it into an amplifiable fluorescent signal without significantly increasing background noise. Quantitative detection using a fluorescence spectrophotometer provides a visual display of the microbial composition at the implant site. Furthermore, the DLFSN exhibits excellent overall applicability to common tissue samples, whether solution-based or solid-based, eliminating the need for extensive sampling, cumbersome sample pretreatment, or sophisticated data analysis and output equipment. Furthermore, the reactions of the amplifier unit A and quantifier unit B can be performed autonomously in a solution environment, resulting in extremely low turnaround times. This significantly reduces overall analysis time while minimizing potential environmental interference. These characteristics make the DLFSN particularly suitable for the rapid detection of common and relevant pathogenic microorganisms in various clinical scenarios.

[0009] Other advantages, objects, and features of the present invention will be described in part in the following description and, in part, will be apparent to those skilled in the art upon examination of the following description or may be learned from practice of the present invention. The objects and other advantages of the present invention may be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below with reference to the accompanying drawings, in which: Figure 1 This is a flow chart of the model of DNA-based loop fluorescence signal amplification network (DLFSN); Figure 2 Schematic diagram of DLFSN for quantitative detection of pathogenic microorganisms in PBMI environment; Figure 3 Functional analysis of the recognition of genetic inputs in Staphylococcus aureus mediated by amplifier unit A. (A) Schematic diagram of input conversion and loop-based signal amplification mediated by amplifier unit A; (B) Gel electrophoresis analysis to determine the optimal ratio of the beacon complex UA1; (C) Gel electrophoresis analysis of the conversion of UA1 to UA4; (E) Gel electrophoresis analysis of the conversion of UA4 to UA6; (F) Quantitative fluorescence analysis of the beacon complex UA1; (G) Fluorescence quantitative analysis of the conversion of UA1 to UA4; (H) Fluorescence quantitative analysis of the conversion of UA4 to UA6; Figure 4 Functional analysis of the recognition of genetic inputs in Pseudomonas aeruginosa mediated by amplifier unit A. (A) Schematic diagram of input conversion and loop-based signal amplification mediated by amplifier unit A; (B) Gel electrophoresis analysis to determine the optimal ratio of the beacon complex UA1; (C) Gel electrophoresis analysis of the conversion of UA1 to UA4; (E) Gel electrophoresis analysis of the conversion of UA4 to UA6; (F) Quantitative fluorescence analysis of the beacon complex UA1; (G) Fluorescence quantitative analysis of the conversion of UA1 to UA4; (H) Fluorescence quantitative analysis of the conversion of UA4 to UA6; Figure 5 Functional analysis of the fluorescence detection of Staphylococcus aureus mediated by the quantifier unit B. (A) Schematic diagram of the generation of the fluorescence signal associated with Staphylococcus aureus mediated by the quantifier unit B; (B) gel electrophoresis analysis to determine the optimal ratio of the beacon complex UB1; (CD) gel electrophoresis analysis of the conversion of UB1 to UB2; (E) quantitative fluorescence analysis of the beacon complex UB1; (F) quantitative fluorescence analysis of the conversion of UB1 to UB2; (GI) Zn 2+ Quantitative fluorescence analysis of the relationship between concentration and UB3 fluorescence intensity; Figure 6Functional analysis of fluorescence detection of Pseudomonas aeruginosa mediated by quantifier unit B. (A) Schematic diagram of the generation of Pseudomonas aeruginosa-related fluorescence signals mediated by quantifier unit B; (B) gel electrophoresis analysis to determine the optimal ratio of beacon complex UB1; (CD) gel electrophoresis analysis of the conversion of UB1 to UB2; (E) quantitative fluorescence analysis of beacon complex UB1; (F) quantitative fluorescence analysis of the conversion of UB1 to UB2; (GI) Zn 2+ Quantitative fluorescence analysis of the relationship between concentration and UB3 fluorescence intensity; Figure 7 In vivo performance analysis of DLFSN in detecting the microbial composition of the PBMI site in SD male rats. (A) Visual analysis of sutured wounds in the Ti and Ti + bacteria groups; (B) Fluorescence quantitative analysis of Staphylococcus aureus invasion of the PBMI site using DLFSN; (C) Fluorescence quantitative analysis of Pseudomonas aeruginosa invasion of the PBMI site using DLFSN; (D-E) Histograms showing the detection results of DLFSN for Staphylococcus aureus or Pseudomonas aeruginosa, with I representing the Ti group and II representing the Ti + bacteria group; (F) Giemsa staining results of bone tissue in the Ti and Ti + bacteria groups; (G) H&E staining results of bone tissue in the Ti and Ti + bacteria groups; (H-J) ELISA detection results of pro-inflammatory cytokines in bone tissue, with I representing the Ti group and II representing the Ti + bacteria group. Figure 8The performance evaluation of DLFSN on PBMI samples from clinical patients is shown in Figure 1. (A) is a schematic diagram of PBMI sample diagnosis based on metagenomic high-throughput sequencing; (B) is the species accumulation curve of A1-A10; (C) is the sample species abundance and species evenness obtained by the Rank-Abundance curve; (D) is the species level dilution curve of A1-A10; (EG) is the A1-A10 obtained by principal coordinate analysis. Association degree, the distance between sample points represents the similarity of microbial communities, and the shorter the distance, the higher the similarity; (HI) is the difference between A1-A10 samples obtained by NMDS analysis; (J) is the similarity and difference relationship between microbial species, genes or functions in A1-A10 analyzed by UPGMA-Tree; (KL) is the species-specific distribution based on metagenomic high-throughput sequencing; (M) is the percentage of gene copy number of Staphylococcus aureus or Pseudomonas aeruginosa in A1-A10 analyzed by metagenomic high-throughput sequencing; (N) is the gene content of Staphylococcus aureus or Pseudomonas aeruginosa in A1-A10 detected by metagenomic high-throughput sequencing; (O) is the abundance of Staphylococcus aureus or Pseudomonas aeruginosa in A1-A10 detected by DLFSN. DETAILED DESCRIPTION

[0011] The following describes the embodiments of the present invention by means of specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments are only schematic illustrations of the basic concept of the present invention, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0012] Among them, the accompanying drawings are only for illustrative purposes and represent only schematic diagrams rather than actual pictures, and should not be understood as limiting the present invention. In order to better illustrate the embodiments of the present invention, some parts of the accompanying drawings may be omitted, enlarged or reduced, and do not represent the dimensions of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions may be omitted in the accompanying drawings.

[0013] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if there are terms such as "upper", "lower", "left", "right", "front", "back", etc. indicating directions or positional relationships, they are based on the directions or positional relationships shown in the drawings. They are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific direction, be constructed and operate in a specific direction. Therefore, the terms describing the positional relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0014] Example 1 The specific process of a DNA-based loop fluorescence signal amplification network (DLFSN) is as follows: like Figure 2 As shown in the figure, the DLFSN system consists of two main components, namely the amplifier unit A and the quantifier unit B. Among them, the amplifier unit A includes four main single-stranded DNAs, namely the target gene sequence (PTGSs) used to identify the source of pathogens, substrate A, chain L and alternative B. The above sequences are tailored to individual pathogen types to achieve highly specific fluorescence signal conversion and amplification. The 5-6 RNA domain of chain L is connected to the fluorescent group Cy5 and the quencher group BHQ2 at both ends, and the RNA domain has Zn in the selective conformation. 2+ Cutting responsiveness, by Zn 2+ The fluorescence signal can be restored. It is worth noting that there are three pairs of complementary domains in the amplifier unit A, namely 6-8 / 6*-8*, 8-10 / 8*-10* and 2-7 / 2*-7*. On the other hand, the quantifier unit B is composed of three single-stranded DNAs (chain L, substrate B and alternative B), and the corresponding complementary domains are 3-8 / 3*-8*, 4-5 / 4*-5*, and 6-8 / 6*-8*. Importantly, the simultaneous complexation of the 4-5 / 4*-5* and 6-8 / 6*-8* domains between chain L and substrate B prompts the 5-6 domain of chain L to form an active site, allowing highly specific Zn 2+Mediated single-stranded DNA cleavage, thereby releasing Cy5 fluorescence. For DLFSN-mediated PTGSs detection, PTGSs in the sample are first treated by amplifier unit A and bound to UA1 through complexation of the 8-10 / 8*-10* domain to form the PTGSs / substrate A / chain L ternary complex UA2. Subsequently, the 7-8 domain of PTGSs competes with chain L for binding to the 7*-8* domain of UA2, thereby forming UA3. Chain L is then released from UA3, converting UA3 into UA4, and the released chain L binds to UB1 through dual complexation of 4-5 / 4*-5* and 6-8 / 6*-8* to form UB2, which is then converted to UA4 by Zn 2+ It mediates the cleavage of the 5-6 domain of chain L, further converting it to UB3. Simultaneously, alternative B released during the UB1→UB2 conversion binds to UA4 via the 2-7 / 2*-7* domain to form the PTGSs / substrate A / alternative B ternary complex UA5, which then forms UA6 and releases PTGSs. The released PTGSs are then introduced into the next cycle for infinite signal amplification.

[0015] Example 2 The synthesis and characterization of amplifier unit A are as follows: 1. Determine the optimal ratio of beacon complex UA1 by gel electrophoresis analysis. The specific method is as follows: Mix 1 μL of substrate A with different proportions of chain L, add them to centrifuge tubes, dilute to 10 μL with PBS, heat in an oil bath at 95°C for 10-15 min, centrifuge, cool to room temperature, and then perform 20% polyacrylamide gel electrophoresis.

[0016] 2. Gel electrophoresis analysis of the conversion from UA1 to UA4 is as follows: The optimal ratio of substrate A and chain L was mixed and added to a centrifuge tube, heated in an oil bath at 95°C for 10-15 min, and centrifuged instantly. Then, different ratios of PTGSs were immediately added to each centrifuge tube, diluted to 10 μL with PBS, cooled to room temperature, and then subjected to 20% polyacrylamide gel electrophoresis.

[0017] 3. Feasibility analysis of amplifier unit A. The specific method is as follows: Dilute each DNA sequence to a 10 μM concentration. Then, add substrate A, chain L, PTGSs, alternative B, substrate A + chain L, substrate A + chain L + PTGSs, and substrate A + chain L + PTGSs + alternative B to seven 1.5 mL centrifuge tubes, respectively. After adding substrate A and chain L, heat at 95°C for 10-15 minutes, centrifuge briefly, and immediately add alternative B. Perform electrophoresis on a 20% polyacrylamide gel.

[0018] 4. Fluorescence quantitative analysis of the conversion between complexes. The specific method is as follows: Take a certain amount of streptavidin-coated magnetic beads, wash them twice with buffer I, then divide the beads into several equal portions. Add a fixed concentration of substrate A-3'biotin solution prepared in buffer I (final concentration 10 μM, 500 μL), and incubate on a rotator at room temperature for 4 hours. After the incubation period, wash the beads twice with buffer I. Then, add 500 μL of chain L solution prepared in buffer I at different concentrations. Mix thoroughly, and incubate on a rotator at room temperature for 2 hours. Then, slowly aspirate the beads using a magnet, and measure the fluorescence intensity of the supernatant at 673 nm using a fluorescence spectrophotometer. Similarly, verify the binding and substitution between other sequences.

[0019] The above experimental results are as follows Figure 3-4 As shown, the loop-based amplification of pathogen-associated fluorescence signals is described in detail. Figure 3 A and Figure 4A. Specifically, substrate A complexes with chain L at its 6-8 / 6*-8* domains to form the beacon complex UA1. Upon addition of the sample solution, PTGSs compete for binding to substrate A via their 7-8 / 7*-8* domains and release chain L, forming complex UA4 (UA1→UA4), thereby converting the pathogen-derived genetic input (PTGSs) into a measurable fluorescent signal (chain L). Subsequently, alternative B competes for binding to substrate A via its 7-9 / 7*-9* domains to form the final product complex UA6 (UA4→UA6), simultaneously releasing PTGSs to complete the reaction loop. Therefore, the limited PTGSs in the sample solution can be recovered indefinitely until the beacon complex UA1 is completely depleted. Notably, the reaction loop in amplifier unit A is driven by the principle of entropy increase based on changes in base hybridization length, allowing for automated execution with low turnaround time and high molecular precision.

[0020] Considering the clinical relevance and representativeness of Staphylococcus aureus and Pseudomonas aeruginosa in the pathogenesis and treatment of PMBI, we used polyacrylamide gel electrophoresis to detect the ability of amplifier unit A to convert genetic material related to Staphylococcus aureus and Pseudomonas aeruginosa into quantifiable fluorescent signals to verify the technical feasibility of the DNA-based loop fluorescence signal amplification strategy. Among them, we used the nuc gene of Staphylococcus aureus and the ecfX gene of Pseudomonas aeruginosa as examples, and simultaneously determined and synthesized the corresponding substrate A, chain L and alternative B (Table 1-Table 2). We first detected the binding affinity and specificity between substrate A and chain L by mixing a certain amount of substrate A with chain L in graded doses. As Figure 3 B and Figure 4 As shown in Figure B, when the ratio of substrate A to chain L reached 1:1.5, substrate A almost completely bound to chain L, indicating that this is the optimal ratio for forming the beacon complex UA1. Subsequently, we added the sample solution containing PTGSs to the UA1 solution and immediately found that the PTGSs content was significantly positively correlated with the dissociation of UA1. When the substrate A:chain L:PTGSs ratio reached 1:1:5:1.5, the UA1 concentration dropped to an almost negligible level, indicating that UA1 was completely converted to UA4 ( Figure 3 C and Figure 4 C), the above observations were also quantitatively verified by polyacrylamide gel electrophoresis at graded doses ( Figure 3 D and Figure 4D). Subsequently, we added alternative B to the UA4 solution to induce the formation of a large amount of the complex UA6. We found that when the ratio of substrate A:chain L:PTGSs:alternative B was 1:1:5:1.5:1.8, the UA6 production efficiency reached its maximum, and most of the added PTGSs returned to the free state. These observations collectively support that PTGSs can be effectively converted into fluorescent signals through an automated reaction loop ( Figure 3 E and Figure 4 E).

[0021] Table 1. DLFSN sequences used for detection of Staphylococcus aureus.

[0022]

[0023] Table 2. DLFSN sequences used for detection of Pseudomonas aeruginosa.

[0024]

[0025] Based on the above data, we further used streptavidin-coated magnetic beads and biotin-modified DNA sequences to perform fluorescence quantitative analysis to detect the fluorescence signal amplification potential of amplifier unit A. Figure 3 F and Figure 4 As shown in Figure F, a certain amount of substrate A-3' biotin was attached to streptavidin-coated magnetic beads to form MB-substrate A. Chain L, modified with Cy5 at its 3' end, was then added to the above solution. The results show that when the substrate A:chain L ratio reached approximately 1:1.5, the fluorescence intensity of the supernatant remained low, almost comparable to that of the control group without fluorescent chain. When the substrate A:chain L ratio was increased to 1:2, the fluorescence intensity in the supernatant increased sharply. This is due to the increase in the free chain L-3' Cy5 content, once again indicating that 1:1.5 is the optimal ratio for forming the beacon molecule UA1.

[0026] In addition, after we added PTGSs to the above MB-UA1-Cy5 (MB-substrate A: chain L-3' Cy5 = 1:1.5), the fluorescence intensity of the supernatant gradually increased and reached a plateau when the substrate A: chain L: PTGSs ratio became 1:1:5:1.5, indicating that UA1 was completely converted to UA4 at this time ( Figure 3 G and Figure 4G). Finally, a certain amount of alternative B was added to MB-UA4-Cy5 (MB-substrate A: chain L: PTGSs-3' Cy5 = 1:1.5:1.5) to release most of the captured PTGSs-3' Cy5 in MB-UA4, generating MB-UA6. These experimental results are consistent with Figure 3 E and Figure 4 E, which once again confirmed that the amplifier unit A can convert the input PTGSs into quantifiable fluorescent signals through the automatic reaction loop, which is beneficial for subsequent clinical diagnosis ( Figure 3 H and Figure 4 H).

[0027] Example 3 The synthesis and characterization of the quantifier unit B are as follows: 1. Determine the optimal ratio of the beacon complex UB1 by gel electrophoresis analysis. The specific method is as follows: Mix 1 μL of substrate B with different ratios of alternative B and add them to centrifuge tubes respectively. Dilute to 10 μL with PBS, heat at 95°C for 10-15 min, centrifuge briefly, cool to room temperature, and then perform 20% polyacrylamide gel electrophoresis.

[0028] 2. Gel electrophoresis analysis of the conversion from UB1 to UB2 is as follows: Mix substrate B and alternative B at the optimal ratio and add them to a centrifuge tube. Heat at 95°C for 10-15 min and centrifuge immediately. Then, add chain L at different ratios to each centrifuge tube, dilute to 10 μL with PBS, and perform 20% polyacrylamide gel electrophoresis after cooling to room temperature.

[0029] 3. Fluorescence quantitative analysis of the conversion between complexes. The specific method is as follows: Take a certain amount of streptavidin-coated magnetic beads, wash them twice with buffer I, then divide the beads into several equal portions. Add a fixed concentration of substrate B-3'biotin solution prepared in buffer I (final concentration 10 μM, 500 μL), and incubate on a rotator at room temperature for 4 hours. After the incubation period, wash the beads twice with buffer I. Then, add 500 μL of various concentrations of alternative B solution prepared in buffer I, mix thoroughly, and incubate on a rotator at room temperature for 2 hours. Then, slowly aspirate the beads using a magnet, and measure the fluorescence intensity of the supernatant at 673 nm using a fluorescence spectrophotometer. Similarly, verify the binding and substitution between other sequences.

[0030] 4. Verification of Zn by Gel Electrophoresis and Fluorescence Spectrophotometry 2+ The specific method for cutting responsiveness to UB2 is as follows: A certain amount of substrate B and the same concentration of chain L were mixed, heated at 95°C for 10-15 min, centrifuged, and cooled to room temperature. Subsequently, 10 μL of ZnCl2 solution with concentrations of 0, 10, 30, 60, 80, and 100 μM were added, respectively. The mixture was incubated at 37°C for 30 min, and a 20% polyacrylamide gel was prepared for electrophoresis. The images were obtained using the molecular imaging system Versa doc MP 4000 system (Bio-Rad), and the fluorescence spectrophotometer was used for detection.

[0031] The above experimental results are as follows Figure 5-6 Loop-based quantification of pathogen-associated fluorescent signals is shown in Figure 4 A and Figure 5 A. Specifically, we first mixed substrate B and alternative B to form the beacon molecule UB1. Since substrate B is completely complementary to chain L, through competitive binding, alternative B in UB1 can be replaced by chain L to form the complex UB2 (UB1→UB2). 2+ The mediated biocatalytic activity cleaves the 5-6 domain on chain L, thereby eliminating the proximity quenching effect and restoring its fluorescence emission ability for quantitative detection. It is also worth noting that the formation of UB2 will also release alternative B from the beacon molecule UB1 and re-join it to the reaction loop of amplifier unit A (UA4→UA6), thereby promoting subsequent PTGSs signal amplification. Similar to the functional analysis of amplifier unit A mentioned above, we used the nuc gene of Staphylococcus aureus and the ecfX gene of Pseudomonas aeruginosa as examples to simultaneously determine and synthesize the corresponding substrate B, chain L and alternative B (Table 1-Table 2). Gel electrophoresis results showed that when the ratio of substrate B:alternative B was 1:1.2, the optimal conditions for the formation of beacon molecule UB1 were reached ( Figure 4 B and Figure 5 B). Subsequently, we added chain L to the UB1 solution at graded concentrations. The results showed that when the ratio of substrate B:alternative B:chain L reached 1:1.2:1, UB1 achieved complete conversion of UB2 ( Figure 4 C and Figure 5C). In addition, gel electrophoresis analysis also confirmed the conversion of UB1 to UB2 guided by chain L. When the chain L concentration ranged from 0 to 1 μM, the abundance of UB1 decreased significantly, while the level of UB2 increased significantly as the chain L concentration increased ( Figure 4 D and Figure 5 D). We further quantitatively verified the above visual trends by fluorescence analysis ( Figure 4 EF and Figure 5 EF). The above-mentioned data confirm that the introduction of chain L can effectively convert the beacon molecule UB1 into Zn 2+ In order to further study the reaction state of UB2 and Zn 2 + The relationship between Zn 2+ The solution was added to UB2 solution in graded doses. The results showed that 100 μM Zn 2+ Treatment of the UB2 complex can achieve complete conversion from UB2 (fluorescence silent state) to UB3 (fluorescence activated state) ( Figure 4 GH and Figure 5 GI).

[0032] Example 4 In vivo analysis of the DLFSN's detection performance on the microbial composition of the PBMI site in SD male rats. The specific method is as follows: Ten male Sprague-Dawley rats were randomly divided into a Ti group and a Ti + bacteria group. Before titanium implant implantation, the rats were anesthetized with isoflurane. After anesthesia, the surgical area was shaved and disinfected with iodine. A 1-2 cm long incision was made adjacent to the knee joint, and the muscle tissue was directly separated. A 1.2 mm diameter titanium pin, mounted on an electric drill, was drilled perpendicular to the long axis of the femur in the center of the femur. A 1.2 mm diameter, 10 mm long rod-shaped implant was implanted. After wound disinfection, the wound was sutured in place. The implantation procedure was performed under sterile conditions, and all rats were able to move normally after surgery. Ten days after surgery, the skin and wound healing of the femoral surfaces were observed. The femurs were removed under sterile conditions and placed in centrifuge tubes. One portion was used for DLFSN detection, and the other portion was used for bone tissue staining. For bone tissue staining, the femurs were fixed with 4% paraformaldehyde, decalcified, dehydrated in a series of steps, washed with xylene, and then embedded in paraffin and sectioned. HE staining and Giemsa staining were used to evaluate the bacterial distribution and inflammatory infiltration around the implants.

[0033] The above experimental results are as follows Figure 7 As shown, DLFSN performed pathogen detection on SD rats carrying PBMI, for details, see Figure 7A. Specifically, for the Ti group, we treated the titanium implants with hydrofluoric acid and sulfuric acid and implanted them into the rat femur under sterile conditions. For the Ti + bacteria group, we first treated the titanium implants with hydrofluoric acid and sulfuric acid, then immersed them in a bacterial culture medium containing Staphylococcus aureus and Pseudomonas aeruginosa to induce PBMI, and finally implanted them into the rat femur. Ten days after implantation, we performed bone tissue section staining or DLFSN detection on the rat femur. Giemsa staining results showed that the bacterial content in the Ti + bacteria group was significantly higher than that in the Ti group, indicating that Staphylococcus aureus and Pseudomonas aeruginosa successfully colonized the implant site ( Figure 7 F). Meanwhile, H&E staining of bone tissue samples in the Ti + bacteria group showed obvious inflammatory features, including enhanced infiltration of pro-inflammatory immune cells and severe bone loss, while the bone tissue in the Ti group remained relatively intact with low levels of immune cell infiltration, indicating that the Ti + bacteria group successfully induced PBMI ( Figure 7 G). In addition, we collected bone tissue supernatants from these two groups for ELISA assays, and the results showed that the levels of pro-inflammatory cytokines in the Ti + bacteria group were significantly higher than those in the Ti group, with IL-1β, IL-6, and TNF-α levels being 3.2 times, 2.4 times, and 3.2 times higher than those in the Ti group, respectively ( Figure 7 HJ). We further collected exudate from the implantation site and performed DLFSN testing, which showed that the levels of Staphylococcus aureus and Pseudomonas aeruginosa in the Ti + bacteria group were 13.4 times and 13.1 times higher than those in the Ti group, respectively, which was consistent with the analysis results of bone tissue staining ( Figure 7 Importantly, DLFSN-based genetic testing requires only exudate from the infection site, yielding results within 48 hours. In contrast, staining bone tissue sections is a tedious and complex process, requiring invasive sampling of the infected site and taking over four days to complete. These data demonstrate that DLFSN can overcome various interfering factors in complex biological environments and accurately measure pathogen levels in a short period of time.

[0034] Example 5 The detection performance of DLFSN on PBMI samples from clinical patients was evaluated as follows: Ten PBMI samples from clinical patients were placed in LB liquid culture medium and cultured at 37°C and 200 rpm for one day to enrich pathogenic microorganisms. Microbial DNA was then extracted and stored at -20°C. Part of the DNA was used for DLFSN detection, and the other part was used for subsequent metagenomic high-throughput sequencing analysis.

[0035] The above experimental results are as follows Figure 8 As shown in Figure 2, DLFSN performed pathogen detection on PBMI samples from clinical patients. Specifically, we collected samples from the implant site of 10 patients. Importantly, we were unaware of the patients' postoperative infection status. The tissue samples we collected mainly included exudates and peri-implant soft tissues, of which the latter was soaked. The exudates or soaks of all 10 samples were used for metagenomic high-throughput sequencing and DLFSN detection. Considering that metagenomic high-throughput sequencing is the current gold standard for clinical pathogen detection, we first performed metagenomic sequencing on the above 10 samples and established a library for each sample, represented by A1-A10 ( Figure 8 A). The diversity analysis of the above samples showed that the microbial diversity and uniformity in A3-A5 were much lower than those in other samples ( Figure 8 BD). At the same time, the bacterial community distribution of A3-A5 also showed significant differences compared with other samples ( Figure 8 EJ). The different microbial compositions of A3-A5 were consistent with the PBMI status of the corresponding patients, indicating that PBMI caused significant changes in the microbial composition of the implant site. However, the patients corresponding to A1-A2 and A6-A10 did not show PBMI symptoms, and the microbial composition of their implant sites remained at a healthy level, with no significant increase in the population of common pathogenic microorganisms ( Figure 8 KL). Notably, metagenomic sequencing analysis showed that Staphylococcus aureus was the predominant pathogen in A4, whereas infections in A3 and A5 were primarily caused by Staphylococcus epidermidis, with lower colonization levels of both Staphylococcus aureus and Pseudomonas aeruginosa ( Figure 8 KN). We further used DLFSN to detect Staphylococcus aureus and Pseudomonas aeruginosa in these patient-derived samples. The results showed that the colonization level of Staphylococcus aureus in A4 was very high, at 474.48 CFU / mL, which was 16.5 times and 14.0 times that of A3 and A5, respectively. The levels of Pseudomonas aeruginosa in A3, A4, and A5 were 5.03 CFU / mL, 5.61 CFU / mL, and 6.88 CFU / mL, respectively ( Figure 8 Overall, the quantitative detection results of Staphylococcus aureus and Pseudomonas aeruginosa by DLFSN were highly consistent with those of metagenomic sequencing analysis in terms of accuracy, but the total detection time was much shorter, only approximately 48 hours, compared to approximately 28 days for metagenomic sequencing. These observations collectively support the use of DLFSN as an effective tool for the rapid diagnosis of common pathogens in patients with PBMI.

[0036] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solutions, which should all be included in the scope of the claims of the present invention.

Claims

1. A DNA-based loop fluorescence signal amplification network, characterized by: The DNA-based loop fluorescence signal amplification network includes five single-stranded DNAs: PTGSs, substrate A, chain L, alternative B, and substrate B; The two ends of the RNA domain of chain L are connected to the fluorescent group Cy5 and the quenching group BHQ2 respectively. In the selective conformation, the RNA domain has Zn 2+ Cutting responsiveness, The chain L forms a double-stranded structure with substrate A, and the PTGSs competitively forms a double-stranded structure with substrate A to release chain L; The substrate B forms a double-stranded structure with the alternative B, and the chain L competitively forms a double-stranded structure with the substrate B to release the alternative B; The alternative B competes with substrate A to form a double-stranded structure to release PTGSs; The PTGSs are target gene sequences derived from pathogens.

2. The DNA-based loop fluorescence signal amplification network according to claim 1, characterized in that: The molar ratio of substrate A:chain L is 1:(0-1.5); The molar ratio of substrate A:chain L:PTGSs is 1:(0-1.5):(0-1.5); The molar ratio of substrate B:alternative B is 1:(0-1.2); The molar ratio of substrate A:chain L:PTGSs:alternative B is 1:(0-1.5):(0-1.5):(0-1.8).

3. The detection method of the DNA-based loop fluorescence signal amplification network according to claim 1 or 2, characterized in that: The detection steps are as follows: (1) Add substrate A and chain L molecules to assemble into the beacon molecule UA1; (2) PTGSs were mixed with UA1 to form the PTGSs / substrate A / chain L ternary complex UA2; (3) Substrate B and alternative B are added to assemble the beacon molecule UB1, which is then added to the mixture of step (2); (4) Zn 2+ The mixture is added to the mixed solution of step (3), and then fluorescence quantitative detection is performed using a fluorescence spectrophotometer.

4. The detection method of the DNA-based loop fluorescence signal amplification network according to claim 3, characterized in that: The Zn 2+ The molar concentration is 10-100 μM.

5. Use of the DNA-based loop fluorescence signal amplification network according to claim 1 or 2 in detecting microbial genes.

6. The use of the DNA-based loop fluorescence signal amplification network in detecting microbial genes according to claim 5, characterized in that: The microorganism is Staphylococcus aureus; The nucleic acid sequence of substrate A is shown in SEQ ID NO: 1; The sequence of chain L is CTACGACTCACTAT / rA / GGTAGAGAATATACGCCTACGACTCAC / iCy5dT / AT / rA / GG / iBHQ2dT / AGAGAATATACGC; The nucleic acid sequence of the PTGSs is shown in SEQ ID NO: 2; The nucleic acid sequence of substrate B is shown in SEQ ID NO: 3; The nucleic acid sequence of alternative B is shown in SEQ ID NO:

4.

7. The use of the DNA-based loop fluorescence signal amplification network in detecting microbial genes according to claim 5, characterized in that: The microorganism is Pseudomonas aeruginosa; The nucleic acid sequence of substrate A is shown in SEQ ID NO: 5; The sequence of chain L is CTACGACTCACTAT / rA / GGTAGAGCAATCGGTCCTACGACTCAC / iCy5dT / AT / rA / GG / iBHQ2dT / AGAGCAATCGGTC; The nucleic acid sequence of the PTGSs is shown in SEQ ID NO: 6; The nucleic acid sequence of substrate B is shown in SEQ ID NO: 7; The nucleic acid sequence of alternative B is shown in SEQ ID NO:

8.

8. Application of DNA-based loop fluorescence signal amplification network in the detection of implant pathogenic microorganism bone infection.

Images