KASP marker combination for longan dna fingerprint library construction, kasp marker primer and application thereof

By developing KASP marker combinations and primers, a DNA fingerprint library for longan was constructed, which solved the problem of insufficient identification of longan germplasm resources and achieved efficient and accurate germplasm differentiation.

CN120683287BActive Publication Date: 2026-04-21SOUTH SUBTROPICAL CROP RES INST CHINA ACAD OF TROPICAL AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SOUTH SUBTROPICAL CROP RES INST CHINA ACAD OF TROPICAL AGRI SCI
Filing Date
2025-05-15
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing technologies have not yet applied high-throughput SNP detection technology to construct DNA fingerprint profiles in longan, resulting in insufficient identification of longan germplasm resources and a lack of effective molecular identification methods.

Method used

We developed KASP marker combinations and primers, performed genotyping based on differences in fluorescence signals, constructed a longan DNA fingerprint library, and used 24 KASP marker combinations to accurately distinguish longan germplasm resources.

Benefits of technology

This study enabled efficient and precise molecular identification of longan germplasm resources, and constructed a DNA fingerprint library with good polymorphism, which can effectively distinguish different longan germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120683287B_ABST
    Figure CN120683287B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of gene detection technology, specifically relating to a KASP marker combination, KASP marker primers, and their applications for constructing a DNA fingerprint library for longan. The 24 KASP markers provided by this invention exhibit good polymorphism and genotyping effects. A DNA fingerprint library constructed based on this set of KASP markers can more accurately and efficiently distinguish longan germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a KASP marker combination, KASP marker primers and their applications for constructing a DNA fingerprint library of longan. Background Technology

[0002] DNA fingerprinting, due to its rich polymorphism, high specificity, and stability, has been widely used in forensic medicine, paleontology, and germplasm resource science of plants and animals. In the identification of fruit tree germplasm resources, significant progress has been made in the construction of DNA fingerprint profiles for apples, grapes, pears, citrus, peaches, and waxberries. Due to their good stability, consistency, and specificity, these fingerprints have become important evidence in DUS testing and a primary basis for the protection of new variety rights. However, research on DNA fingerprinting for longan is still in its early stages compared to other fruit trees; related research is not in-depth enough, and no DNA fingerprint profiles that have reached practical application have been reported to date.

[0003] SNPs (Single Nucleotide Polymorphisms) refer to variations in a single nucleotide (A, T, C, or G) at a specific location in the genome, including substitutions, insertions, or deletions of a single base. These variations are very common in the genome, exhibiting high density and high polymorphism, making them ideal markers for constructing DNA fingerprints. However, SNPs identified based on sequencing data often have a large number of false positives, usually requiring experimental verification. Semagn et al. (2014) developed a high-throughput SNP detection technique based on kompetitive allele-specific PCR (KASP), which can genotype based on differences in fluorescence signals. KASP technology is a major technique for experimental SNP detection due to its high throughput, simple operation, rapid detection, and accuracy, and has been widely used in germplasm resource identification, kinship identification, molecular marker-assisted breeding, and genetic map construction. However, no related applications have been reported in longan. Summary of the Invention

[0004] Based on this, the present invention constructs a DNA fingerprint of longan by developing a combination of KASP molecular markers, thereby enabling molecular identification of longan germplasm resources.

[0005] To achieve the above objectives, the present invention can adopt the following technical solutions:

[0006] This invention provides, in one aspect, a KASP marker combination for constructing a longan DNA fingerprint library, wherein the positions and genotypes of each KASP marker are as follows:

[0007]

[0008]

[0009] Another aspect of the present invention provides a KASP marker primer for constructing a DNA fingerprint library of longan, which is used to amplify and detect the KASP marker in the present invention.

[0010] Preferably, the primer sequences for amplifying KASP marker 1 to KASP marker 24 in the above-mentioned KASP marker primers are as follows:

[0011]

[0012]

[0013]

[0014] Preferably, the 5' ends of the forward primers 1 and 2, which amplify KASP markers 1 to 24, are independently connected to different adapter sequences that match the fluorescently labeled probes, in order to distinguish different genotypes.

[0015] More preferably, the forward primer 1 detects genotype 1 in the allele, and the forward primer 1 is connected to the adapter matched by the fluorescently labeled probe FAM, the sequence of which is: gaaggtgaccaagttcatgct; the forward primer 2 detects genotype 2 in the allele, and the forward primer 2 is connected to the adapter matched by the fluorescently labeled probe HEX, the sequence of which is: gaaggtcggagtcaacggatt.

[0016] In another aspect, the present invention provides a detection product comprising the KASP-labeled primers described herein.

[0017] Preferably, the above-mentioned testing products include test kits or test reagents.

[0018] In another aspect, the present invention provides a longan DNA fingerprint library, which is composed of the KASP marker combination of the present invention.

[0019] Preferably, the longan DNA fingerprint database information is as follows: Figures 7a to 7g As shown.

[0020] Another aspect of the present invention provides an application of the KASP marker primers of the present invention, the detection products of the present invention, or the longan DNA fingerprint library of the present invention, the application of which includes the identification and differentiation of longan germplasm.

[0021] The beneficial effects of this invention include: the 24 KASP marker combinations provided by this invention have good polymorphism and typing effect, and the DNA fingerprint library constructed based on this set of KASP markers can distinguish longan germplasm more accurately and efficiently. Attached Figure Description

[0022] Figure 1 To simplify the quality and coverage of genome sequencing data from 209 longan samples;

[0023] Figure 2 The numerical distribution of 59,658 SNPs from 209 longan materials within a 100 kbp range on 15 chromosomes;

[0024] Figure 3 The distribution characteristics of SNPs are shown in Figure 1; (a) shows the distribution region of SNPs; (b) shows the effect of exon SNPs on encoded amino acids; and (c) shows the distribution of SNP genotypes and Ts / Tv values ​​of 209 longan germplasms.

[0025] Figure 4 Genotyping results of 79 longan germplasm accessions using KASP markers; where red dots represent samples with genotype 0 / 0, blue dots represent samples with genotype 1 / 1, green dots represent samples with genotype 0 / 1, gray crosses represent samples with missing genotypes * / *, and black squares represent negative controls.

[0026] Figure 5 KASP marker sites for pairwise differences between longan germplasm;

[0027] Figure 6 DNA fingerprinting of 79 longan germplasm accessions constructed based on 24 KASP markers;

[0028] Figure 7 shows the fingerprint codes of various DNA fingerprint patterns. Detailed Implementation

[0029] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0030] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0031] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0032] In the following examples, the 209 longan germplasm accessions used for simplified genome sequencing mainly came from the National Tropical Fruit Tree Germplasm Resource Center. Some wild resources were collected in the wild, and some local varieties and hybrid germplasm were introduced from the National Longan and Loquat Germplasm Resource Center, the Guangdong Longan Germplasm Resource Center, and research institutes such as South China Agricultural University (Table 1).

[0033] 209 longan germplasm accessions used for simplified genome sequencing and phenotypic analysis

[0034]

[0035]

[0036]

[0037]

[0038] In the following examples, the 79 longan germplasm accessions used for KASP marker validation were sourced from the National Tropical Fruit Tree Germplasm Resource Center (Table 2).

[0039] Table 279 Longan germplasm samples were validated using KASP markers.

[0040]

[0041]

[0042] In the following examples, the CTAB plant genomic DNA rapid extraction kit was from Beijing Adley Biotechnology Co., Ltd., catalog number DN1402; the SNP typing kit was from Wuhan Jingtai Biotechnology Co., Ltd., 2×PAMR8 Pro PCRMix; the UV spectrophotometer was from ThermoFisher Scientific, ND-ONE; and the real-time quantitative PCR was from QuantStudio3, Thermo Fisher Scientific.

[0043] I. Sample Collection

[0044] Collect complete leaves from newly grown and matured longan germplasm trees in the current year, and then flash-freeze them in liquid nitrogen at -80℃ for preservation.

[0045] II. DNA Extraction

[0046] For each experimental material, approximately 3.5g of healthy young leaves free from pests and diseases were selected, frozen in liquid nitrogen, and genomic DNA was extracted from each material using the CTAB Plant Genomic DNA Rapid Extraction Kit (extraction method as per kit instructions). After extraction, the concentration of each DNA sample was measured using a UV spectrophotometer. The DNA concentration of qualified samples was diluted to 100ng / ul and stored at 4℃ for later use. The DNA quality was assessed using 1% agarose gel electrophoresis.

[0047] III. Simplified Genome Sequencing

[0048] After the DNA extracted from 209 longan materials passed the concentration and quality checks, it was sent to Beijing Novogene Technology Co., Ltd. for simplified genome sequencing using the HiSeq 2500 platform. The sequencing data was cleaned using Fastp software to remove adapter sequences and low-quality bases, obtaining clean reads for each sequencing material.

[0049] Total DNA was extracted from 209 longan samples. After quality testing, the concentration and integrity met the requirements for library construction and sequencing. Sequencing yielded 167 Gb of raw data, which, after quality filtering, resulted in 161 Gb of clean reads. The average read length per sample was 772 Mb, with an average effective read rate of 96.67%. The Q20 range was 93.03%–97.53%, with an average Q20 of 96.12%. The Q30 range was 85.03%–94.01%, with an average Q30 of 91.16%, indicating that the sequencing data was accurate and had a low base error rate. Figure 1 Clean reads were mapped to the longan reference genome with an average mapping rate of 90.19% and an average coverage of 68.08%, meeting the requirements for variation analysis.

[0050] IV. SNP Site Identification and Filtering

[0051] Using samtools software, clean reads from each sequencing material were matched to the longan reference genome. The matched Bam files were analyzed for variants using GATK, and biallelic SNPs located on chromosomes were extracted. SNPs with QD < 2, MQ < 40, FS > 60, SOR > 5, MQRankSum < -8.0, and ReadPosRankSum < -4.0 were filtered out. Linkage disequilibrium analysis was performed using plink2, and low allele frequencies (maf < 0.05), low genotype frequencies (geno < 0.5), and linked sites (indep-pairwise 50100.1) were filtered out.

[0052] Variation analysis identified 12,463,156 chromosomal variation sites, including 11,250,245 SNP sites, of which 11,094,725 were biallelic SNP sites. After removing low-quality sites, 8,826,918 SNP sites remained. After filtering out sites with low allele frequency (maf < 0.05) and low genotype frequency (geno < 0.5), 1,178,832 SNP sites remained. Linkage disequilibrium analysis further filtered out potentially linked sites, resulting in 59,658 biallelic SNP sites annotated on the chromosomes (Table 3). These SNP sites are evenly distributed across the chromosomes, with an overall distribution density of 133 bp / Mbp, and the distribution density varies little across each chromosome. Figure 2 ).

[0053] Table 3. Identification and Filtering of SNPs

[0054]

[0055]

[0056] In addition, the obtained SNP sites were annotated and statistically analyzed using snpEff software in conjunction with genome annotation information. Specifically, 59,658 SNP sites were annotated using SnpEff software in conjunction with reference genome gene annotation information. The results showed that 40.93% of SNPs were located in intergenic regions, with 22.73% and 23.99% located near genes (upstream and downstream 5 kb, respectively), 6.95% located on introns, and 5.17% located on exons. Figure 3a). Of these variant sites on the exons, 59.47% were missense mutations leading to amino acid substitutions, 38.55% were silent mutations not leading to amino acid changes, and 1.98% were nonsense mutations leading to frameshift variations. Figure 3 (b) The ratio of missense mutations to silent mutations was 1.54. Among 209 longan resources, the proportion of homozygous genotypes consistent with the reference gene ranged from 35.65% to 67.38%, with an average of 49.23%; the proportion of homozygous genotypes consistent with the minor allele ranged from 4.69% to 33.82%, with an average of 21.67%; and the proportion of heterozygous genotypes ranged from 4.70% to 19.92%, with an average of 11.72%. Figure 3 c) indicates that the selected SNP polymorphism is relatively good. There are six SNP mutation types: A / G, C / T, A / C, A / T, C / G, and G / T. Mutations where purine (A / G) is replaced by purine, or pyrimidine (C / T) is replaced by pyrimidine, are called transitions (Ts). Mutations where purine is replaced by pyrimidine (A / C and A / T), or pyrimidine is replaced by purine (C / G and G / T), are called transversions. Ts / Tv is an important indicator for evaluating the quality of SNP detection. In the 209 longan sequencing population, the Ts / Tv ranged from 2.23 to 3.02, with an average of 2.76. Figure 3 c) The value is slightly higher than the SNPTs / Tv value identified based on resequencing data, but it is within the normal range, indicating that the false positive rate of the identified SNP sites is low.

[0057] V. KASP Tag Development

[0058] SNP sites with polymorphism greater than 40% and no other variations within 100 bp upstream and downstream of the site were screened. Sequences containing the site (up to 100 bp upstream and downstream) were extracted as template sequences. Primers were designed in batches using Primer3, with the following conditions: GC content 40%–60%, primer length 20–30 bp, and TM value 58–62℃. A set of KASP primers was designed for each site, including two forward competing primers and one reverse universal primer. The 3' end of one forward primer must be a reference gene site, and the 3' end of the other forward primer must be an allele site, with a product length of 100–120 bp. Fluorescent probe matching adapters, gaaggtgaccaagttcatgc and gaaggtcggagtcaacggatt, were added to the 5' ends of the two forward primers, respectively. 124 sets of primers meeting the criteria were randomly sampled and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0059] From 209 natural longan populations, 79 representative varieties were selected as validation materials for the KASP marker. Genomic DNA was extracted using the method described above, and the DNA concentration of each sample was measured using a micro-spectrophotometer and diluted to 100 μmol / L. The reaction system for allele amplification was as follows: 0.72 μL DNA template, 0.06 μL FAM primer (hereinafter referred to as FAM primer) (10 μmol / L), 0.06 μL HEX primer (hereinafter referred to as HEX primer) (10 μmol / L), 0.16 μL reverse primer (COM) (10 μmol / L), 2 μL 2×PAMR8Pro PCR, and 4 μL of ultrapure water. Before spotting, the primers and ultrapure water were premixed according to the reaction system ratio to reduce the number of spottings. One negative control (NTC) with ultrapure water as the DNA template was designed for each primer group. Spotting was performed using a micropipette.

[0060] After the 384-well PCR plates were sealed, they were placed in an ABI QuantStudio 6Flex real-time PCR instrument for amplification. The program was as follows: 95℃ pre-denaturation for 15 min; 94℃ denaturation for 10 s, annealing and extension at 61–55℃ for 1 min, 10 cycles, decreasing the temperature by 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing at 55℃ for 1 min, 28 cycles. Fluorescence detection was performed after the PCR reaction was completed.

[0061] Genotyping was performed using the QuantStudio software included with the real-time PCR instrument. Markers showing only one genotype or exceeding 20% ​​of samples that could not be genotyped were removed. Data were clustered in red, green, and blue: red (homozygous reference genotype) was labeled 1, blue (homozygous allele genotype) was labeled 2, green (heterozygous genotype) was labeled 3, and missing bases or unclassifiable sites were labeled 0. Genotypes of each material were statistically analyzed, and markers that could effectively genotype all materials were selected as candidate core markers.

[0062] Of the 59,658 SNP loci screened, 19,765 had no other variations within 100 bp upstream and downstream of the locus. After polymorphism filtering, 16,628 remained. 4,129 loci met the design criteria for KASP marker primers. 124 sets of primers with uniform distribution and high amplification efficiency were randomly selected to detect these gene loci in 79 representative longan germplasms. 114 sets (92%) of primers were able to detect the target loci. Among these, 24 sets of primers (Table 4) amplified samples with fewer missing genotypes, and samples with different genotypes were well separated. Figure 4The results indicate that these KASP markers have good genotyping effects. The PIC values ​​of these 24 sites in the test samples ranged from 0.66 to 0.80, showing good polymorphism (Table 5), and they can be used as candidate core markers for DNA fingerprinting construction.

[0063] Table 424 sets of successfully detected KASP-labeled primers

[0064]

[0065]

[0066]

[0067]

[0068] Table 5 KASP Tagging Information

[0069]

[0070]

[0071] VI. Construction of Longan Fingerprint Map

[0072] Candidate core markers with good genotyping results and PIC values ​​greater than 0.35 (Table 5 above) were used as candidate markers for cluster analysis of 79 longan materials. If varieties with completely identical marker genotypes existed, candidate markers were added until all germplasm could be distinguished. The genotype data of each germplasm were then used to generate QR codes in batches using qrencode to obtain the DNA fingerprint profiles of the 79 longan materials.

[0073] To establish an accurate and rapid molecular identification method for longan germplasm resources, KASP markers (Table 5 above), which showed good genotyping results, were selected to statistically analyze the genotypes of each material. The results showed that there were ≥2 different loci among the materials. Figure 5 The 24 KASP markers can distinguish all materials and can be used for the identification of longan germplasm. Figure 6 ).

[0074] In addition, to construct the DNA fingerprint map of each germplasm, the genotypes of 24 markers in each germplasm were labeled: 0 / 0 genotype was labeled as 1, 1 / 1 genotype as 1, 0 / 1 genotype as 3, and missing genotypes as 0. These labeled genotypes were converted into a 24-bit identification number, which served as the fingerprint code for the DNA fingerprint map of each germplasm. This identification number was further used to generate barcodes and QR codes for sample management and germplasm information (see...). Figures 7a to 7g ).

[0075] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A KASP marker primer for constructing a DNA fingerprint library of longan, wherein the KASP marker primer is used to amplify and detect KASP marker combinations, and the positions and genotypes of each KASP marker are as follows: The primer sequences for amplifying KASP markers 1 to 24 are shown below:

2. The KASP-labeled primer according to claim 1, characterized in that, The primer sequences for amplifying KASP markers 1 to 24 are independently linked to different adapter sequences that match the fluorescently labeled probes at the 5' ends of forward primers 1 and 2, respectively, to distinguish different genotypes.

3. The KASP-labeled primer according to claim 2, characterized in that, Forward primer 1 detects genotype 1 in alleles. Forward primer 1 is connected to the 5' end of a fluorescently labeled probe FAM-matched adapter, with the sequence: gaaggtgaccaagttcatgct. Forward primer 2 detects genotype 2 in alleles. Forward primer 2 is connected to the 5' end of a fluorescently labeled probe HEX-matched adapter, with the sequence: gaaggtcggagtcaacggatt.

4. A testing product, characterized in that, Includes the KASP-tagged primers as described in any one of claims 1 to 3.

5. The testing product according to claim 4, characterized in that, The testing products include test kits or test reagents.

6. The application of the KASP marker primer as described in any one of claims 1 to 3 or the detection product as described in claim 4 or 5, the application including the identification and differentiation of longan germplasm.

Citation Information

Patent Citations

  • Longan SNP molecular marker and application thereof in genetic map construction and single fruit weight trait positioning

    CN112481407A

  • Longan fruit size character related SNP site, gene, protein, SNP site mining method and application

    CN118653003A