Molecular marker related to cherry leaf spot resistance and application thereof

Abstract

The invention relates to a molecular marker related to cherry leaf spot resistance and application thereof. According to the application, BSA-seq is utilized to locate one QTL locus related to the resistance of the cherry leaf spot disease, and qCLSR3a comes from Chinese cherry'opposite cherry '. The KASP marker CLSR3a. 01 which is closely linked with disease resistance is developed by utilizing the SNP (Single Nucleotide Polymorphism) in the qCLSR3a. In a disease-resistant segregation population, the relative scab diameter of an individual with the CLSR3a. 01-G / G genotype is averagely reduced by 21.8% compared with that of an individual with the CLSR3a. 01-T / T genotype. The KASP marker CLSR3a. 01 disclosed by the invention can be used for screening or identifying the hybrid generation for resisting the cherry leaf spot disease.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, in particular to a molecular marker related to resistance to cherry leaf spot disease. Background Art

[0002] Sweet cherry (Prunus avium, 2n = 2x = 16) is a nutritious, delicious fruit with high economic value. Cherry leaf spot (Cherry Leaf Spot) can cause premature leaf drop, weakened trees, and reduced yield and quality, significantly impacting the economies of producing regions (Chethana, K. W. T. (2019) Molecular characterization and pathogenicity of fungal taxa associated with cherry leaf spot disease. Mycosphere, 10, 490-530, Zhang, J.-q., Wang, D., Wei, T., Lai, X., Tang, G., Wang, L.-h., et al. (2024) First Report of Epicoccum nigrum Causing Brown Leaf Spot of Sweet Cherry (Prunus avium) in China. Plant Disease, 108.). Between 2018 and 2020, researchers conducted field surveys in 20 sweet cherry orchards across four major growing regions in China (Beijing, Sichuan, Shandong, and Liaoning), collecting samples with symptoms of cherry leaf spot for identification. The results showed that Colletotrichum is a widespread pathogen of cherry leaf spot, with C. gloeosporioides being the most pathogenic (Zhou, Y., Zhang, W., Li, Y., Ji, S., Li, X., Hyde, KD, et al. (2023) Identification and Characterization of Colletotrichum Species Associated with Cherry Leaf Spot Disease in China. Plant Disease, 107, 500-513.).

[0003] Existing sweet cherry varieties do not show disease resistance in the field. Breeding disease-resistant varieties through genetic improvement is considered one of the most ecologically beneficial solutions (Deng, Y., Ning, Y., Yang, D.-L., Zhai, K., Wang, G.-L. and He, Z. (2020) Molecular Basis of Disease Resistance and Perspectives on Breeding Strategies for Resistance Improvement in Crops. Molecular Plant, 13, 1402-1419., Lin, F., Chhapekar, SS, Vieira, CC, Da Silva, MP, Rojas, A., Lee, D., et al. (2022) Breeding for disease resistance in soybean: a global perspective. Theoretical and Applied Genetics, 135, 3773-3872., Li, Q., Wang, B., Yu, J. and Dou, D. (2021) Pathogen-informed breeding for crop disease Resistance. Journal of Integrative Plant Biology, 63, 305-311.). The Chinese cherry variety 'Duiying' (Prunus pseudocerasus, 2n=4x=32), unique to Beijing, grows in the mountainous areas of Beijing. Field surveys have shown that 'Duiying' is a natural source of resistance to cherry leaf spot. Transferring disease-resistance genes from 'Duiying' into sweet cherry varieties through distant hybridization and breeding resistant sweet cherry varieties to cherry leaf spot is one of the important approaches to addressing the damage caused by cherry leaf spot. Molecular marker-assisted breeding technology can effectively overcome the technical bottleneck of inefficient traditional phenotypic selection.By precisely locating molecular markers closely linked to disease-resistance traits, researchers can achieve early screening of resistant plants at the seedling stage, shortening the 6-8 generation cycle required for conventional breeding to 3-4 generations, and significantly improving the efficiency of genetic gain (Ni, WJ, Mubeen, S., Leng, XM, He, C. and Yang, Z. (2023) Molecular-Assisted Breeding of Cadmium Pollution-Safe Cultivars. J Agric Food Chem., Hasan, N., Choudhary, S., Naaz, N., Sharma, N. and Laskar, RA (2021) Recent advances in molecular marker-assisted selection and applications in plant breeding programmes. Journal of Genetic Engineering and Biotechnology, 19.). Summary of the Invention

[0004] The present application provides a molecular marker associated with resistance to cherry leaf spot disease, which is G / G in disease-resistant materials and T / T in disease-susceptible materials, and is located at the 6514805bp position of Chr3a in the cherry genome.

[0005] The present invention also designs three specific KASP primers and can identify the genotype of the molecular marker in cherry through amplification.

[0006] The present invention also provides applications of the molecular marker.

[0007] Primers for amplifying molecular markers associated with cherry leaf spot resistance were designed with specific primers for PCR amplification targeting the 6514805 bp position centered on Chr3a of the cherry genome and the 50-150 bp fragments before and after.

[0008] The target is a fragment centered at the 6514805 bp position of Chr3a in the Cherry Blossom Genome and 100 bp before and after.

[0009] The primers are three specific KASP primers, and their sequences are as follows:

[0010] F1: TTCCCCAAGTATTATAAATGGTTG,

[0011] F2: TTCCCCAAGTATTATAAATGGTTT,

[0012] R:AAGGGTATTAGAAGACGTCCATTAC,

[0013] Different fluorescent labels were added to the 5' ends of F1 and F2.

[0014] Preferably, the three specific KASP primers are:

[0015] F1: GAAGGTCGGAGTCAACGGATTTTCCCCAAGTATTATAAATGGTTG,

[0016] F2: GAAGGTGACCAAGTTCATGCTTTCCCCAAGTATTATAAATGGTTT,

[0017] R:AAGGGTATTAGAAGACGTCCATTAC.

[0018] A molecular marker associated with resistance to cherry leaf spot disease, characterized in that: there is a SNP site located at the 6514805bp position of Chr3a in the cherry genome, and the SNP site is G / G in disease-resistant materials and T / T in disease-susceptible materials.

[0019] The molecular markers were amplified by PCR using KASP primers using the cherry genome as a template to obtain the genotype of the SNP site. The KASP primer sequences are as follows:

[0020] F1: GAAGGTCGGAGTCAACGGATTTTCCCCAAGTATTATAAATGGTTG,

[0021] F2: GAAGGTGACCAAGTTCATGCTTTCCCCAAGTATTATAAATGGTTT,

[0022] R:AAGGGTATTAGAAGACGTCCATTAC.

[0023] The molecular marker is used in the screening or identification of hybrid offspring resistant to cherry leaf spot disease.

[0024] The application uses KASP primers to obtain the genotype of the SNP site through PCR amplification using the cherry genome as a template. The marker is G / G in the disease-resistant material and T / T in the disease-susceptible material. The KASP primer sequence is as follows:

[0025] F1: GAAGGTCGGAGTCAACGGATTTTCCCCAAGTATTATAAATGGTTG,

[0026] F2: GAAGGTGACCAAGTTCATGCTTTCCCCAAGTATTATAAATGGTTT,

[0027] R:AAGGGTATTAGAAGACGTCCATTAC.

[0028] This application first used multiple generations of backcrossing between Chinese cherry 'Duiying' and sweet cherry to construct a cherry leaf spot resistance segregation population, and based on the results of indoor inoculation identification, screened out disease-resistant and disease-susceptible mixed pools. Secondly, BSA-seq was used to locate a QTL locus related to cherry leaf spot resistance, qCLSR3a, from Chinese cherry 'Duiying'. Finally, SNPs in qCLSR3a were used to develop a KASP marker CLSR3a.01 that is tightly linked to disease resistance. Among the three disease-resistant segregation populations, the relative lesion diameter (RDS) of individuals with the CLSR3a.01-G / G genotype was 21.8% lower on average than that of individuals with the CLSR3a.01-T / T genotype.

[0029] Experiments show that the application of the KASP marker developed in this application is consistent with the results obtained from actual gene sequencing analysis, and can be used to identify and screen hybrid offspring resistant to cherry leaf spot disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the genotyping diagram of the KASP marker of CLSR3a.01 in the disease-resistant segregating population. DETAILED DESCRIPTION

[0031] The present invention is further described in detail below with reference to the embodiments.

[0032] The biological materials mentioned below are all stored in the applicant's laboratory and can be distributed to the public.

[0033] Instruments and kits used for KASP labeling detection

[0034]

[0035] LGC: Laboratory of the Government Chemist

[0036] 1. Materials and Methods

[0037] 1.1 Construction of disease-resistant segregant populations

[0038] A hybrid using 'Duiying' as the male parent and 'Van' as the female parent yielded the disease-resistant progeny 'F7'. A hybrid using 'F7' as the male parent and 'Rainier' as the female parent yielded the disease-resistant progenies 'LN×F7-1' and 'LN×F7-5'. Three disease-resistant segregating populations were obtained by hybridizing 'Duiying', 'LN×F7-1', and 'LN×F7-5' as male parents with 'Linda' as the female parent, resulting in 128 offspring from 'Linda×(LN×F7-1),' 133 from 'Linda×Duiying', and 21 from 'Linda×(LN×F7-5). All the parents and disease-resistant segregating populations were planted at a cherry base in Xifa Village, Yujiawu Township, Tongzhou District, Beijing, with a plant spacing of 2m×4m and normal field management.

[0039] 1.2 Indoor disease resistance identification

[0040] Healthy leaves were inoculated with a Colletotrichum gloeosporioides cake, and disease resistance was assessed by measuring the diameter of the lesions five days after inoculation (Zhou et al., 2023). Spores of Colletotrichum gloeosporioides were inoculated onto PDA medium and incubated at 25°C for 3-5 days. Incubation was stopped when the mycelium covered more than 80% of the medium. A 0.4 cm diameter round borer was used to punch holes along the edge of the mycelium to remove the cake. Healthy leaves without lesions were harvested, rinsed with running water, soaked in 75% ethanol for 30 seconds, and then rinsed three times with sterile water for 30 seconds each. After drying, the base of the petiole was wrapped with cotton wool soaked in sterile water to maintain moisture. Eight leaves from each sample were placed in a humidifying box, and wounds were punctured on the underside of the leaves with a needle. Three leaves were inoculated with blank culture medium as a control, and five leaves were inoculated with a Colletotrichum cake of the same size. The treated samples were placed in an inoculation chamber at 90% humidity and 25°C. Five days after inoculation, measure the longest and shortest diameters of leaf lesions. Lesion diameter = (longest diameter + shortest diameter) / 2. Different batches were inoculated with the same strain of 'Duiying' for uniformity. The relative lesion diameter (RDS) = lesion diameter / 'Duiying' lesion diameter. A smaller RDS indicates greater disease resistance, while a larger RDS indicates greater susceptibility.

[0041] 1.3 Anti-influx pool construction

[0042] According to the average RDS in 2023 and 2024, the 15 materials with the smallest RDS were selected from the 'Linda×(LN×F7-1)' population to form the disease-resistant mixed pool 'R-pool', and the 15 materials with the largest RDS were selected to form the disease-susceptible mixed pool 'S-pool'.

[0043] 1.4 BSA-seq analysis

[0044] The reference genome is a merger of the sweet cherry 'Mei Zao' T2T genome (https: / / db.cngb.org / search / project / CNP0004619 / ) and the Chinese cherry 'Dui Ying' genome (https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCA_041222475.1 / ). The sweet cherry genome is designated Chr1-8, and Chr1a, 1b, 1c, and 1d of the Du Ying genome are homologous to sweet cherry Chr1, and so on.

[0045] Before association analysis, SNPs and Indels were filtered according to the following criteria: (1) SNP sites with multiple genotypes were filtered out, and only diallel genotype sites were retained; (2) SNP sites with mixed pool read support less than 4 were filtered out; (3) SNP sites with homozygous and consistent genotypes between mixed pools were filtered out; (4) SNP sites with homozygous and consistent genotypes between parents were filtered out; (5) SNP sites with recessive mixed pool genotypes that did not come from the recessive parent were filtered out; (6) SNP sites with dominant mixed pool genotypes that did not come from the dominant parent were filtered out.

[0046] The filtered high-quality SNPs and InDels were used to identify the mutations using Euclidean distance (ED) (Hill, JT, Demarest, BL, Bisgrove, BW, Gorsi, B., Su, Y.-C. and Yost, HJ (2013) MMAPPR: Mutation Mapping Analysis Pipeline for Pooled RNA-seq. Genome Research, 23, 687-697.) and Δ(SNP / Indel-index) (Liu, Z., Fekih, R., Takagi, H., Tamiru, M., Abe, A., Natsume, S., et al. (2013) MutMap+: Genetic Mapping and Mutant Identificationwithout Crossing in Rice. PLoS ONE, 8., Takagi, H., Abe, A., Yoshida, K., Kosugi, S., Natsume, S., Mitsuoka, C., et al. (2013) QTL-seq: rapid mapping of quantitative trait loci in rice by whole genome resequencing of DNA from two bulked populations. The Plant Journal, 74, 174-183.) was used for association analysis. The four association results were then intersected to identify disease resistance-associated QTL loci.

[0047] 1.5KASP marker development and validation

[0048] Based on the physical location of the QTL loci obtained by BSA-seq, high-quality SNPs (sequencing depth greater than 30, with genotypes consistent between the resistant and resistant parents in the pooled population and between the susceptible and susceptible parents in the pooled population) were selected to develop KASP markers. Three KASP primers were designed and synthesized based on the 100-bp sequence flanking the SNPs (Appendix Table 9). The KASP markers were first tested using DNA from both parents. If the results were consistent with the next-generation sequencing data, the KASP primers were effective. The results were then validated in three disease-resistant segregating populations, and a one-way analysis of variance (ANOVA) using SPSS V27 was used to determine if the correlation between genotype and lesion diameter was significant.

[0049] 2. Results

[0050] 2.1 Construction of mixed pools of cherry leaf spot disease-resistant and susceptible samples

[0051] By backcrossing 'Duiying' with sweet cherry varieties for multiple generations, a cherry leaf spot disease-resistant segregating population, 'Linda×(LN×F7-1)', was constructed. In 2023 and 2024, 68 and 136 offspring of 'Linda×(LN×F7-1)' were identified for disease resistance indoors. Correlation analysis was performed on the relative diameter (RDS) of the lesions of 62 materials that were identified for disease resistance in both years. The RDSs of the two years were significantly correlated (Table 1). The 15 offspring with the smallest RDSs were selected as the extremely disease-resistant materials to form the 'R-pool', and the 15 offspring with the largest RDSs were selected as the extremely susceptible materials to form the 'S-pool'. The average RDS of the disease-resistant pool was 0.43, and the average RDS of the disease-susceptible pool was 1.31. The difference in RDS between the resistant and susceptible pools was extremely significant (p < 0.01).

[0052] Table 1 Correlation analysis of RDS in the 'Linda×(LN×F7-1)' population in 2023 and 2024

[0053]

[0054] Note: Statistical analysis was performed using bivariate correlation, and the correlation coefficient was analyzed using Spearman's two-tailed test (*, p<0.05).

[0055] 2.2 BSA analysis

[0056] Next-generation sequencing was performed on the parental lines 'LN×F7-1' and 'Linda', as well as the resistant and susceptible mixed pools 'R-pool' and 'S-pool'. The genetic background of the disease-resistant segregating population was derived from the diploid sweet cherry and the tetraploid Chinese cherry 'Duiying'. Therefore, the sweet cherry genome (341.62 Mb) and the 'Duiying' genome (1035.19 Mb) were merged to form a reference genome. Next-generation sequencing data from 'R-pool', 'S-pool', 'LN×F7-1', and 'Linda' were aligned to the reference genome. Paired-end sequencing reads were mapped to the reference genome, with 91.39% to 95.51% of the reads matching the sequence length (Properly_mapped). The average sequencing depth (Ave_depth) ranged from 6X to 10X (Table 2).

[0057] Table 2 Comparison results of the second-generation sequencing data of the mixed pool of affinity and resistance with the reference genome

[0058]

[0059] Ultimately, we identified 284,944 high-quality SNPs and InDel differential loci between the resistant and susceptible parents and the mixed pool of resistant and susceptible varieties. We then conducted association analysis using the Euclidean distance (ED) and Δ(SNP-index) methods, and intersecting the results revealed a QTL associated with leaf spot resistance, located at 1,345,750-31,257,758 on Chr3a, from the resistant source 'Duiying'. See Table 3.

[0060] Table 3 Location information of QTLs related to resistance to cherry leaf spot

[0061]

[0062] 2.3 Development of molecular markers

[0063] 2.3.1 Primer design and dilution

[0064] 2.3.1.1 Primer design

[0065] KASP technology uses three primers: two upstream typing primers (specific to the two bases of the SNP (G / T) respectively) and a downstream universal primer. The upstream primers contain universal adapter sequences, amplification primers and key typing sites. This enables them to specifically recognize and amplify the target SNP or Indel. The 3' end of the upstream primers (F1 and F2) are complementary to the two bases of the SNP respectively, and the 5' end is added with universal fluorescent adapter sequences VIC: GAAGGTCGGAGTCAACGGATT and FAM:

[0066] GAAGGTGACCAAGTTCATGCT

[0067] 2.3.1.2 Primer dilution

[0068] Dilute the primer powder to 100ul / ml, and then dilute the three sequences according to the ratio of F1:F2:R:water = 24:24:48:100.

[0069] 2.3.2 DNA dilution

[0070] The DNA was uniformly diluted to 20 ng / ul.

[0071] 2.3.3 PCR reaction system is shown in Table 4.

[0072] Table 4 PCR reaction system

[0073] name 384-well plate (4 μL system) 2xTaq DNA Polymerase Mix 2μL SNP Primer Mix (4x) 1 μL DNA samples 2ul

[0074] 2.3.4 PCR amplification system

[0075] During the amplification process, KASP technology uses a touchdown PCR strategy, gradually lowering the annealing temperature to ensure specificity and efficiency. Specific PCR thermal cycling conditions are shown in the table. PCR thermal cycling can be performed on any suitable PCR amplification instrument. See Table 5.

[0076] Table 5 PCR amplification conditions

[0077]

[0078] 2.3.5 Fluorescence value reading

[0079] After the PCR amplification cycle, fluorescence values ​​were read using a fluorescence quantitative PCR instrument at a temperature below 40°C. In this method, SNP locus detection uses the fluorophores FAM and VIC to distinguish two isogenic loci. The passive reference dye ROX is used to correct for signal differences between wells due to reaction volume errors. The relevant excitation and emission wavelengths are shown in Table 6 below. The reading software is the LGC OMEGA F SNP typing instrument.

[0080] Table 6 Excitation and emission wavelengths of fluorescent groups

[0081] Fluorophore Excitation light (nm) Emitted light (nm) FAM 485 520 VIC 535 556 ROX 575 610

[0082] Note: If the fluorescence scanning instrument uses the HEX fluorophore as the detection signal, no modifications to the setup are required, as the excitation and emission values ​​for VIC and HEX are very similar.

[0083] 2.3.6 Data Analysis and Genotype Data Acquisition

[0084] The result data of step 2.2.5 were analyzed using LGC_OMEGA's genotype reading software (Kluster Caller). In this software, VIC and FAM data were plotted on the x-axis and y-axis, respectively. The VIC and FAM values ​​of each reaction well were corrected by the value of the reference dye (ROX) of that specific well, and the data fluorescence values ​​were standardized to obtain the relative fluorescence values ​​corresponding to VIC and FAM of each PCR reaction well. Based on the relative fluorescence values, the samples were clustered and the genotypes were further determined based on the sample clusters and fluorescence types. Figure 1 .

[0085] The upper left corner is red, indicating G / G, and the material is disease-resistant; the lower right corner is blue, indicating T / T, and the material is susceptible to disease.

[0086] A single nucleotide polymorphism (SNP) site (CLSR3a.01) located at 6514805 bp in qChr3a was selected, and KASP primers were designed based on the 100 bp sequence at both ends (Table 8). The KASP primers were highly significantly correlated with the RDS of three cherry leaf spot resistance segregating populations ('Linda×(LN×F7-1)', 'Linda×(LN×F7-5)', and 'Linda×Duiying') (Table 7). The average RDS of individuals with the CLSR3a.01-G / G, G / T, and T / T genotypes were 0.67, 0.85, and 0.85, respectively. The RDS of individuals with the CLSR3a.01-G / G genotype was 21.8% lower than that of individuals with the CLSR3a.01-T / T genotype.

[0087] CLSR3a.01 can be used to identify disease-resistant and disease-susceptible individuals.

[0088] Table 7 Analysis of variance between genotypes and RDS of CLSR3a.01 in the cherry leaf spot resistance segregating population

[0089]

[0090] Table 8 KASP primers of CLSR3a.01

[0091]

Claims

1. Primers for amplifying molecular markers associated with cherry leaf spot resistance were designed with specific primers for PCR amplification targeting the 6514805 bp position centered on Chr3a of the cherry genome and the 50-150 bp fragments before and after.

2. The primer according to claim 1, wherein the target is a fragment centered at the 6514805 bp position of Chr3a in the Cherry Blossom Genome and 100 bp before and after.

3. The primers according to claim 2, wherein the primers are three specific KASP primers, and the sequences thereof are as follows: F1: TTCCCCAAGTATTATAAATGGTTG, F2: TTCCCCAAGTATTATAAATGGTTT, R:AAGGGTATTAGAAGACGTCCATTAC, Different fluorescent labels were added to the 5' ends of F1 and F2.

4. The primer according to claim 3, wherein the three specific KASP primers are: F1: GAAGGTCGGAGTCAACGGATTTTCCCCAAGTATTATAAATGGTTG, F2: GAAGGTGACCAAGTTCATGCTTTCCCCAAGTATTATAAATGGTTT, R:AAGGGTATTAGAAGACGTCCATTAC.

5. A molecular marker associated with resistance to cherry leaf spot disease, characterized by: There is a SNP site located at the 6514805bp position of Chr3a in the genome of cherry. The SNP site is G / G in the disease-resistant material and T / T in the disease-susceptible material.

6. The molecular marker according to claim 6, using KASP primers, the genotype of the SNP site is obtained by PCR amplification using the cherry genome as a template, and the KASP primer sequence is as follows: F1: GAAGGTCGGAGTCAACGGATTTTCCCCAAGTATTATAAATGGTTG, F2: GAAGGTGACCAAGTTCATGCTTTCCCCAAGTATTATAAATGGTTT, R:AAGGGTATTAGAAGACGTCCATTAC.

7. Use of the molecular marker according to claim 5 or 6 in screening or identifying hybrid offspring resistant to cherry leaf spot.

8. The use according to claim 7, wherein the primers according to any one of claims 1 to 4 are used to obtain the genotype of the SNP site by PCR amplification using the cherry genome as a template, wherein the marker is G / G in disease-resistant materials and T / T in susceptible materials.

9. The use according to claim 8, wherein the primer is a KASP primer, and its sequence is as follows: F1: GAAGGTCGGAGTCAACGGATTTTCCCCAAGTATTATAAATGGTTG, F2: GAAGGTGACCAAGTTCATGCTTTCCCCAAGTATTATAAATGGTTT, R:AAGGGTATTAGAAGACGTCCATTAC.

Images