KASP molecular marker for detecting tomato gray leaf spot resistance and application of KASP molecular marker
By developing the KASP molecular marker at tomato SL4.0ch11: 9474573 nucleotides, the problem of accuracy in detecting tomato gray leaf spot resistance was solved, and efficient breeding support was achieved.
Patent Information
- Application Number
- CN202510886213.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-30
- Publication Date
- 2025-09-23
AI Technical Summary
In the existing technology, the prevention and control of tomato gray leaf spot disease is difficult. The positioning of the Sm gene is inaccurate, which affects the accuracy of molecular markers and makes it impossible to effectively breed varieties resistant to gray leaf spot disease.
A KASP molecular marker located at the SNP site at nucleotide 9474573 of tomato SL4.0ch11 was developed, and specific primers were used for PCR amplification and fluorescence detection to achieve accurate and high-throughput detection of tomato gray leaf spot resistance.
It has achieved accurate and rapid detection of tomato gray leaf spot resistance, provided important breeding clues, and supported commercial breeding and genetic improvement.
Smart Images
Figure CN120683300A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of biology, and particularly relates to a KASP molecular marker for detecting resistance to tomato gray leaf spot disease and an application thereof. Background Art
[0002] Tomatoes are an important vegetable crop worldwide, occupying a crucial place in the human diet for their delicious flavor and nutritious properties. my country is the world's largest producer and consumer of tomato. As tomato cultivation continues to expand, tomato diseases are becoming increasingly serious. Gray leaf spot, a newly emerging global disease, has become one of the most serious tomato diseases due to its rapid onset and spread, and the difficulty of prevention and control.
[0003] Tomato gray leaf spot is caused by the fungus Solanum. After years of investigation, Li Baoju's team discovered that Solanum solani is the dominant strain currently causing tomato gray leaf spot in my country, and that no pesticides are currently registered in China for the prevention and control of Solanum solani gray leaf spot. The Sm gene, derived from the wild species Solanum impinellifolium, confers good resistance to S. solani, S. lycopersici, and S. botryosum. Sm is the only gene currently found and used in tomatoes for resistance to gray leaf spot, and its resistance has remained unsolved. In recent years, significant progress has been made in the localization of the Sm gene, and closely linked molecular markers have been developed, but the gene has not yet been cloned, and the localization intervals are not entirely consistent, affecting the accuracy of the molecular markers. Therefore, using wild currant tomato populations to analyze the natural variation and develop markers for the Sm gene of tomato gray leaf spot resistance, and based on this, to carry out marker-assisted resistance breeding for tomato gray leaf spot resistance, has important application value in production practice. Summary of the Invention
[0004] In order to solve the above problems in the prior art, the present invention provides a KASP molecular marker for detecting resistance to tomato gray leaf spot disease and its application.
[0005] To achieve the purpose of the present invention, the present invention provides an application of a SNP site in detecting resistance to tomato gray leaf spot disease, wherein the SNP site is located at nucleotide 9474573 of tomato SL4.0ch11, and its base is C or A.
[0006] The present invention also provides a KASP molecular marker for detecting resistance to tomato gray leaf spot disease. The primers for amplifying the KASP molecular marker are used to specifically detect the SNP site at nucleotide 9474573 of tomato SL4.0ch11, whose base is C or A.
[0007] In a preferred embodiment of the present application, the primers for amplifying the KASP molecular marker are a specific forward primer 1, a specific forward primer 2, and a universal reverse primer; the nucleotide sequence of the specific forward primer 1 is shown as SEQ ID NO.1 in the sequence listing; the nucleotide sequence of the specific forward primer 2 is shown as SEQ ID NO.2 in the sequence listing; and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.3 in the sequence listing.
[0008] In a preferred embodiment of the present application, specific forward primer 1 and specific forward primer 2 are connected to two different fluorescent tag sequences.
[0009] The present invention also provides a detection kit or a detection reagent prepared by primers for amplifying the KASP molecular marker.
[0010] The present invention also provides the use of the detection kit or the detection reagent in detecting resistance to tomato gray leaf spot disease.
[0011] The present invention also provides a method for identifying resistance to tomato gray leaf spot disease, comprising the following steps: (1) Extract genomic DNA from the tomato plants to be tested; (2) Using genomic DNA from tomato plants as a template, PCR amplification and KASP reaction detection were performed using primers that amplify KASP molecular markers; (3) Read the fluorescence signal of KASP reaction detection and judge the gray leaf spot resistance of tomato based on the fluorescent group signal.
[0012] In a preferred embodiment of the present application, in step (2), the primers for amplifying the KASP molecular marker are specific forward primer 1, specific forward primer 2, and universal reverse primer; The nucleotide sequence of the specific forward primer 1 is shown in SEQ ID NO.1 in the sequence listing; the nucleotide sequence of the specific forward primer 2 is shown in SEQ ID NO.2 in the sequence listing; and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3 in the sequence listing.
[0013] Preferably, when the genomic DNA of the tomato material shows the fluorescent group signal carried by the specific forward primer 1, it can be determined that the tomato material carries the genotype CC and the tomato material is susceptible to gray leaf spot disease; if the genomic DNA of the tomato plant sample shows the fluorescent group signal carried by the specific forward primer 2, it can be determined that the sample carries the genotype AA and the tomato material is resistant to gray leaf spot disease.
[0014] The beneficial effects of the present invention are as follows: the present invention identifies an important SNP site that is significantly associated with the Sm gene, which can provide important clues for research on population evolution, gene chips, etc.; and based on this, the KASP molecular marker that can be used for breeding is developed, which can realize the accurate, rapid and high-throughput detection of the Sm gene for resistance to tomato gray leaf spot disease, and can be applied to commercial tomato breeding and application research on genetic improvement of resistance to gray leaf spot disease. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 Genome-wide association analysis for resistance to tomato gray leaf spot; Figure 2 The typing results of KASP marker KASP-4573 used to detect the Sm gene for resistance to tomato gray leaf spot disease; Note: Blue indicates FAM genotype (genotype C, susceptible to gray leaf spot), green indicates HEX genotype (genotype A, resistant to gray leaf spot), red indicates heterozygous genotype, and gray indicates negative control. DETAILED DESCRIPTION
[0016] The present invention is further described in detail below through specific implementation cases.
[0017] Example 1 Development of SNP variant sites and KASP-4573 markers for detecting the Sm gene for resistance to tomato gray leaf spot 1) Whole-genome resequencing of tomato populations DNA was extracted from 200 collected currant tomato germplasms using the CTAB method, and high-depth whole-genome resequencing was performed using the BGI series platform, with an average sequencing depth of >10×.
[0018] 2) Identification of gray leaf spot resistance phenotype S. solani is the dominant pathogenic strain that harms tomatoes in my country. Tomato seedlings are inoculated with the pathogen during the 4th to 6th leaf stage. The OD600 of the mycelial suspension of the pathogen is approximately 1.6. The environmental conditions after inoculation are as follows: temperature around 25°C and humidity maintained above 80% (maintained for 48-72 hours). Normal management is then followed. The leaf lesions are investigated 7 days after inoculation. Leaves with lesions are identified as susceptible and recorded as S, while leaves without lesions are identified as resistant and recorded as R.
[0019] 3) Variant identification and genome-wide association analysis The BWA alignment software was used to align the short sequences of the whole genome resequencing of each tomato material to the tomato Heinz1706 reference genome SL4.0. Samtools, Bcftools, and GATK processes were then used to filter the alignment files, convert the file formats, identify SNP / InDel variants, and perform quality control. The EMMAX tool was used to perform association analysis between the high-quality variants after quality control and the resistance-susceptibility phenotype of the inoculated tomato germplasm. Figure 1 shown.
[0020] The physical location is the SL4.0 version of tomato Heinz1706, chromosome 11, base 9474573, The base mutation type C / A is significantly associated with tomato gray leaf spot disease, with a genome-wide association p = 1.18e-24. Therefore, this variant can be used to detect the Sm gene.
[0021] 4) Development of KASP-4573 marker Based on the C / A variant at position 9474573 on chromosome 11, a KASP marker was designed. The sequence of the marker KASP-4573 is as follows: Specific forward primer 1 (5'-3'): GAAGGTGACCAAGTTCATGCTGGTTTGAGGCTAGAGATGTGAAAC (SEQ ID NO.1) Specific forward primer 2 (5'-3'): GAAGGTCGGAGTCAACGGATTTGGTTTGAGGATAGAGATGTGAAAA (SEQ ID NO.2) Universal reverse primer (5'-3'): AAAACTTAGCTTGGATACTCCTCACT (SEQ ID NO. 3) Example 2 Application of labeled KASP-4573 The tomato materials listed in Table 1 were used for KASP marker identification, and DNA was extracted from the leaves of the test materials using the CTAB method.
[0022] Primer synthesis and dilution: 2OD of each of the three primers was synthesized; the two specific primers were dissolved in 45 μL ddH2O; the common primer was dissolved in 228 uL ddH2O; after vortexing, 36 μL of the specific primers and the common primer were respectively aspirated and mixed, and the vortexed mixture was used for PCR reaction.
[0023] PCR reaction system: 2 μL DNA template (concentration 10-50 ng / μL), 0.055 μL primer mix, 2 μL LGC-Taqmaster mix.
[0024] PCR amplification program: pre-denaturation at 94°C for 15 min (1 cycle); denaturation at 94°C for 20 s (10 cycles), annealing and extension at 65-57°C for 60 s (10 cycles, temperature decreased by 0.8°C each cycle), denaturation at 94°C for 20 s (32 cycles), and annealing at 57°C for 60 s (32 cycles).
[0025] After PCR, the fluorescence signal was read using a TECAN infinite M1000 microplate reader. The online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was then used to analyze and convert the fluorescence signal to obtain a clear and intuitive genotyping diagram. The genotype results were output based on the color. The PCR amplification procedure described above was followed for 134 processing tomato materials. PCR products were detected and fluorescence data were read. The test results are shown in [ 1 ]. Figure 2 .
[0026] like Figure 2 As shown, the KASP-4573 marker generated clearly defined population typing results in 288 tomato accessions. The KASP-4573 genotype HEX represents gray leaf spot resistance, while the genotype FAM represents gray leaf spot susceptible. We inoculated and phenotypic evaluations of 226 of these accessions revealed a 91% accuracy rate for detecting the gray leaf spot resistance Sm gene within the population.
[0027] The above is a detailed introduction to the KASP molecular marker for detecting resistance to tomato gray leaf spot disease and its application provided by the present invention.
[0028] This document uses specific examples to illustrate the principles and implementation methods of the present invention. The above examples are only intended to help understand the method and core concept of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the present invention, and such improvements and modifications also fall within the scope of protection of the claims of the present invention.
Claims
1. Application of a SNP site in detecting resistance to tomato gray leaf spot disease, characterized in that: The SNP site is located at nucleotide 9474573 of tomato SL4.0ch11, and its base is C or A.
2. KASP molecular marker for detecting resistance to tomato gray leaf spot disease, characterized by: The primers for amplifying the KASP molecular marker are used to specifically detect the SNP site at nucleotide 9474573 of tomato SL4.0ch11, whose base is C or A.
3. The KASP molecular marker for detecting resistance to tomato gray leaf spot according to claim 1, characterized in that: The primers for amplifying the KASP molecular marker are specific forward primer 1, specific forward primer 2, and universal reverse primer; the nucleotide sequence of the specific forward primer 1 is shown in SEQ ID NO.1 in the sequence listing; the nucleotide sequence of the specific forward primer 2 is shown in SEQ ID NO.2 in the sequence listing; and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3 in the sequence listing.
4. The KASP molecular marker for detecting resistance to tomato gray leaf spot according to claim 3, characterized in that: Specific forward primer 1 and specific forward primer 2 are connected to two different fluorescent tag sequences.
5. A detection kit or detection reagent prepared by using primers for amplifying the KASP molecular marker according to claim 2.
6. Use of the detection kit or the detection reagent according to claim 5 in detecting resistance to tomato gray leaf spot disease.
7. A method for identifying resistance to tomato gray leaf spot disease, characterized in that: The following steps are involved: (1) Extract genomic DNA from the tomato plants to be tested; (2) Using genomic DNA from tomato plants as a template, PCR amplification and KASP reaction detection were performed using primers that amplify KASP molecular markers; (3) Read the fluorescence signal of KASP reaction detection and judge the gray leaf spot resistance of tomato based on the fluorescent group signal.
8. The method according to claim 7, characterized in that In step (2), the primers for amplifying the KASP molecular marker are a specific forward primer 1, a specific forward primer 2, and a universal reverse primer; the nucleotide sequence of the specific forward primer 1 is shown in SEQ ID NO.1 in the sequence listing; the nucleotide sequence of the specific forward primer 2 is shown in SEQ ID NO.2 in the sequence listing; and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3 in the sequence listing.
9. The method according to claim 8, characterized in that When the genomic DNA of the tomato material shows the fluorescent group signal carried by specific forward primer 1, it can be determined that the tomato material carries the CC genotype and the tomato material is susceptible to gray leaf spot disease; if the genomic DNA of the tomato plant sample shows the fluorescent group signal carried by specific forward primer 2, it can be determined that the sample carries the genotype AA and the tomato material is resistant to gray leaf spot disease.