Application of PLA1A gene / protein as anti-tumor target
Patent Information
- Application Number
- CN202510614069.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-09-26
AI Technical Summary
Colorectal cancer patients have a problem of resistance to chemotherapy drugs, especially patients with microsatellite stable colorectal cancer who are ineffective against immune checkpoint blockade therapy. New resistance-related genes are urgently needed to improve prognosis and enhance quality of life.
Using the PLA1A gene/protein as a target, by inhibiting its expression or activity, we can develop chemotherapy drug sensitizers that can be combined with chemotherapy drugs such as oxaliplatin to enhance the sensitivity of tumor cells to chemotherapy, reverse macrophage polarization, and enhance the immune response.
It significantly enhances the sensitivity of tumor cells to chemotherapy drugs, inhibits tumor growth, prolongs the survival time of tumor-bearing mice, and provides a new strategy for tumor chemotherapy resistance.
Smart Images

Figure CN120695181A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology and more specifically relates to the application of PLA1A gene / protein as an anti-tumor target. Background Art
[0002] Colorectal cancer (CRC) is one of the most common malignant tumors of the digestive system and ranks third in morbidity and second in mortality worldwide. With economic development and the continuous improvement of people's living standards, their lifestyles and dietary habits have also changed accordingly. The incidence and mortality rates of colorectal cancer in my country have been increasing year by year, making it one of the top five tumors with the highest morbidity and mortality rates, seriously affecting public health. Current treatments for CRC include surgery, chemotherapy, radiotherapy, targeted therapy, and immunotherapy. However, colorectal cancer is prone to recurrence, metastasis, and treatment resistance after surgery. There is an urgent need to identify new resistance-related genes to improve prognosis and enhance quality of life.
[0003] Chemotherapy is the main treatment for metastatic or locally advanced colorectal cancer. Although chemotherapy has significantly improved the treatment effect of CRC, recurrence and metastasis caused by primary or acquired resistance lead to poor treatment efficacy. Chemotherapy resistance has become a major challenge in the treatment of colorectal cancer. Therefore, more effective strategies are needed to improve patient survival. The immune checkpoint blockade (ICB) treatment strategy has shown good anti-tumor efficacy and therapeutic potential in colorectal cancer, but it is only effective in patients with dMMR / MSI-H mutations, which only account for 15% of patients. The majority of patients with microsatellite stable (MSS) colorectal cancer do not benefit.
[0004] Currently, more and more studies have shown that chemotherapy combined with immunotherapy can produce synergistic effects, providing a new strategy for tumor treatment. However, the molecular mechanism behind chemoimmunotherapy is still unclear, and the immunomodulatory effects of different chemotherapy drugs have not been deeply analyzed. Cisplatin induces CCL20 and IL-1β activation and recruits ILC3s to secrete CXCL10, which promotes CD4 + and CD8 + T cells infiltrate tumors, thereby enhancing responses to immune checkpoint inhibitors. However, doxorubicin, by inducing macrophages to secrete IL-18, upregulates the expression of the amino acid transporter LAT2 in tumor cells, which in turn upregulates CD47 expression, inhibiting macrophage phagocytosis and leading to immune escape of tumor cells. Therefore, it is of great clinical significance to explore and clarify the regulatory effects of colorectal cancer chemotherapy drugs on the immune microenvironment and the mechanism of drug resistance, and to develop more effective new strategies for combined immunotherapy. Summary of the Invention
[0005] The present invention aims to solve the problem of drug resistance of existing colorectal cancer patients to chemotherapy drugs and provides an application of PLA1A gene / protein as a target in the development of chemotherapy drug sensitizers.
[0006] The first object of the present invention is to provide the use of PLA1A gene / protein as an anti-tumor target.
[0007] The second object of the present invention is to provide a composition and its use in preparing anti-tumor drugs.
[0008] The above-mentioned purpose of the present invention is achieved through the following technical solutions:
[0009] The present invention provides the use of PLA1A gene / protein as an anti-tumor target in the preparation of anti-tumor drugs.
[0010] Specifically, the tumor is a tumor with high expression of the PLA1A gene, including but not limited to colorectal cancer, liver cancer, and colorectal cancer liver metastasis.
[0011] The present invention provides the use of PLA1A gene / protein as a target in the preparation of a product for improving the sensitivity of tumor cells to chemotherapy drugs.
[0012] The present invention provides the use of PLA1A gene / protein as a target in the preparation of a chemotherapy drug sensitizer.
[0013] The present invention provides use of a PLA1A gene / protein inhibitor in the preparation of an anti-tumor drug.
[0014] Specifically, the PLA1A gene / protein inhibitor is an agent that inhibits PLA1A protein activity or an agent that reduces PLA1A gene expression.
[0015] The present invention provides the use of a PLA1A gene / protein inhibitor as a tumor chemotherapy sensitizer.
[0016] The present invention also provides a composition, characterized in that it comprises a PLA1A gene / protein inhibitor and a chemotherapy drug.
[0017] As an optional embodiment, the PLA1A gene / protein inhibitor is PLA1A-shRNA capable of inhibiting the expression of PLA1A gene / protein.
[0018] As an optional embodiment, the target site of the PLA1A-shRNA for inhibiting the expression of the PLA1A gene / protein is shown in SEQ ID NO.1.
[0019] As an optional embodiment, the PLA1A gene / protein inhibitor includes at least one of arachidonic acid trifluoromethyl ketone, methylarachidonic acid fluorophosphate, benzofuran-2-carboxylic acid, 8-phenyl-2-(1-piperazinyl)-4H-1-benzopyran-4-one, and manoamide.
[0020] As an optional embodiment, the chemotherapy drug includes at least one of cisplatin, carboplatin, and oxaliplatin.
[0021] As an optional embodiment, the chemotherapy drug is oxaliplatin.
[0022] As an optional embodiment, the composition further comprises a pharmaceutically acceptable excipient.
[0023] As an optional embodiment, the pharmaceutical excipients include any one or a combination of at least two of carriers, diluents, excipients, fillers, binders, wetting agents, emulsifiers, solubilizers, surfactants or buffers.
[0024] As an optional embodiment, the pharmaceutical excipient further comprises any one of a colorant, a pH adjuster, an antioxidant, and an antibacterial agent, or a combination of at least two thereof.
[0025] As an alternative embodiment, the carrier comprises a liposome, a micelle, a dendrimer, a microsphere or a microcapsule.
[0026] The use of the above composition in the preparation of anti-tumor drugs should also be within the scope of protection of the present invention.
[0027] The present invention has the following beneficial effects:
[0028] This invention reveals for the first time the key role of the PLA1A gene / protein in promoting chemotherapy resistance, and deeply elucidates its new mechanism of affecting chemotherapy sensitivity by regulating the tumor microenvironment (especially macrophage polarization). This groundbreaking discovery provides a new perspective for understanding tumor chemotherapy resistance. The research of the present invention has shown that knocking down the PLA1A gene or inhibiting its protein activity can significantly enhance the sensitivity of tumor cells to chemotherapy drugs (such as oxaliplatin), thereby improving the treatment effect. This sensitization effect provides a new strategy for overcoming tumor chemotherapy resistance. In animal model experiments, knocking down PLA1A and combining it with oxaliplatin treatment significantly inhibited the growth of mouse transplanted tumors and liver metastases, and prolonged the survival time of tumor-bearing mice, indicating that PLA1A has important clinical application value and broad application prospects as an anti-tumor target.
[0029] This study systematically evaluated the role of PLA1A in colorectal cancer and its impact on the efficacy of chemotherapy drugs, revealing the core role of PLA1A in tumor chemotherapy resistance and providing new ideas and targets for precision tumor treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] Figure 1 The results of subcutaneous growth curve and weight measurement of mouse tumor cells MC38 under different treatments (Figure A is the WB verification result of PLA1A knockdown; Figure B is a representative picture of mouse subcutaneous tumor; Figure C is the result of mouse tumor growth curve measurement; Figure D is the result of tumor weight measurement; ***P<0.001).
[0031] Figure 2 Results of the effects of different treatments on liver metastasis of mouse tumor cells MC38 (Figure A shows the metastatic livers and HE staining images of mice in different treatment groups; Figure B shows the liver weights of mice in different treatment groups; Figure C shows the survival curves of mice in different treatment groups; ***P<0.001).
[0032] Figure 3 Figure 3 is the UMAP diagram, stacked bar graph and flow cytometry analysis diagram of immune cells in tumor tissues of mice treated with shNC+OXA and shPLA1A+OXA (Figure A is the UMAP diagram of various immune cells in mouse tumor tissues; Figure B is the stacked bar graph statistics of the proportion of immune cells in tumor tissues of mice in the shNC+OXA and shPLA1A+OXA groups; Figure C is the MHCII expression in mouse tumor tissues + With CD206 + F4 / 80 + Quantitative statistical analysis of macrophage infiltration; ***P<0.001).
[0033] Figure 4 Figure 3 shows the subcutaneous growth curve and weight measurement results of mouse tumor cells MC38 in different treatment groups (Figure A shows the subcutaneous tumor phenotype in different treatment groups; Figure B shows the growth curve of tumors in mice in different treatment groups; Figure C shows the tumor weights in mice in different treatment groups; ***P<0.001).
[0034] Figure 5 Figure 1 shows the overall survival of patients with colorectal cancer and colorectal cancer liver metastasis based on PLA1A expression (Figure A shows the results of immunohistochemical staining of colorectal cancer tissue chips to detect PLA1A expression; Figure B shows the correlation between the level of PLA1A in colorectal cancer tissue chips and the survival of patients; Figure C shows the correlation between the level of PLA1A in colorectal cancer tissue chips and the survival of patients with colorectal cancer liver metastasis; *P<0.05).
[0035] Figure 6These are the results of HE and PLA1A immunohistochemical staining of colorectal cancer chemotherapy tissue chips (Figure A shows the results of HE and immunohistochemical staining of colorectal cancer chemotherapy tissue chips to detect PLA1A expression; Figure B shows the correlation analysis results of the evaluation of PLA1A levels in colorectal cancer chemotherapy tissue chips and chemotherapy resistance; **P<0.01). DETAILED DESCRIPTION
[0036] The present invention will be further described below with reference to the accompanying drawings and specific examples, but the examples do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.
[0037] Unless otherwise specified, the reagents and materials used in the following examples were commercially available.
[0038] In the following examples, the PLA1A gene (phospholipase A1 member A) has a Gene ID of 85031 in NCBI.
[0039] The mouse shPLA1A lentivirus was synthesized by FuNeng Gene Technology Co., Ltd., and the target sequence of the mouse PLA1A lentivirus shPLA1A was GGTTTATCTCCTGACTACATC (SEQ ID NO. 1).
[0040] Arachidonic acid trifluoromethane (AACOCF3), CAS: 149301-79-1, structural formula:
[0041]
[0042] Methylarachidonic acid fluorophosphate (MAFP), CAS: 188404-10-6, structural formula:
[0043]
[0044] Benzofuran-2-carboxylic acid, CAS: 496-41-3, structural formula:
[0045] 8-Phenyl-2-(1-piperazinyl)-4H-1-benzopyran-4-one (LY 303511), CAS: 154447-38-8, structural formula:
[0046]
[0047] Manoamide, CAS: 75088-80-1, structural formula:
[0048]
[0049] Example 1 Knockdown of PLA1A enhances the sensitivity of colorectal cancer to oxaliplatin in subcutaneous and liver metastasis models
[0050] 1. Experimental Methods
[0051] (1) Construction of a mouse colorectal cancer MC38 cell line with stable knockdown of PLA1A (shPLA1A)
[0052] Mouse shPLA1A lentivirus was synthesized by FuNeng Gene Technology Co., Ltd., and the lentiviral vector carries puromycin resistance. Mouse colorectal cancer cells MC38 in the logarithmic phase were digested with trypsin and counted, and the cells were counted according to 4×10 5 The cells were passaged into 6-well plates, and the medium was changed after 24 hours. The amount of virus required was calculated according to a 10-fold infection rate (MOI). The virus and polybrene were added to the 6-well plates to transfect MC38 cells. Puromycin was added for selection after 48 hours. When the control group was completely killed by puromycin, puromycin was removed and the cells were replaced with ordinary culture medium to obtain a cell line with stable knockdown of shPLA1A. The knockdown efficiency was detected by WB.
[0053] (2) Mouse subcutaneous transplant tumor model
[0054] The control (shNC) and PLA1A knockdown (shPLA1A) mouse colorectal cancer cells MC38 were respectively cultured at 1×10 7 The cells were inoculated subcutaneously into C57BL / 6J mice at a concentration of 100 μL per mouse. PBS or OXA (5 mg / kg) was injected intraperitoneally starting on day 7, every 3 days, and tumors were collected on day 18. The subcutaneous tumor volume of the mice was measured starting on day 7, every 3 days, and tumors were collected on day 18. The collected tumors were photographed and weighed.
[0055] (3) Mouse portal vein liver metastasis model
[0056] C57BL / 6J mice were anesthetized with 1% sodium pentobarbital by intraperitoneal injection, the upper abdominal hair was shaved, and the skin of the target area was routinely disinfected. An incision was made at the midline of the lower sternum of the mouse to expose the portal vein. 100 μL of shNC and shPLA1A MC38 cells were injected into the portal vein using a syringe, allowing them to enter the liver through the portal vein. After surgery, the mice were temporarily caged until they were fully awake. On the 7th day, PBS or OXA (5 mg / kg) were injected intraperitoneally for treatment. On the 18th day, the mouse livers were harvested, liver weights were recorded, and the liver lobes were stained with HE.
[0057] 100 μL of shNC or shPLA1A MC38 cells were injected into the portal vein, allowing them to enter the liver via the portal vein. Mice were then temporarily housed in separate cages until fully awake. On day 7, treatment was initiated with intraperitoneal injections of PBS or OXA (5 mg / kg). The time of death of mice in the different treatment groups was recorded, and survival curves were plotted.
[0058] shNC+PBS group: 7 days after mice were inoculated with shNC MC38 tumor cells, 100 μL PBS was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0059] shPLA1A+PBS group: 7 days after mice were inoculated with shPLA1A MC38 tumor cells, 100 μL PBS was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0060] shNC+OXA group: 7 days after mice were inoculated with shNC MC38 tumor cells, 100 μL OXA (5 mg / kg) was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0061] shPLA1A+OXA group: 7 days after mice were inoculated with shPLA1A MC38 tumor cells, 100 μL OXA (5 mg / kg) was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0062] 2. Experimental Results
[0063] After shPLA1A was transfected into MC38 cells, the knockdown effect of PLA1A was detected by WB. The results are as follows: Figure 1 The results showed that after MC38 cells were transfected with shPLA1A, the expression of PLA1A protein was significantly downregulated, indicating that the MC38 cell line with stable knockdown of PLA1A was successfully constructed. The mouse model of transplanted tumor and portal vein liver metastasis was established and treated with OXA. Figure 1 and Figure 2 As shown, the results showed that knocking down PLA1A and treating with oxaliplatin significantly inhibited the growth of MC38 colorectal cancer cells in subcutaneous and liver metastases, and significantly prolonged the survival time of mice with liver metastasis.
[0064] Example 2 Knockdown of PLA1A enhances sensitivity to oxaliplatin by reversing macrophage polarization
[0065] 1. Experimental Methods
[0066] (1) Single-cell sequencing analysis of immune cell infiltration in mouse tumor tissues
[0067] The control and PLA1A knockdown mouse colorectal cancer cells MC38 were respectively cultured at 1×10 7 The cells were inoculated subcutaneously into C57BL / 6J mice at a concentration of 100 μL per mouse. OXA (5 mg / kg) was injected intraperitoneally starting on the 7th day, once every 3 days. Tumors were collected on the 18th day. The collected tumor tissues were prepared into single-cell suspensions and cell activity was tested. Single-cell sequencing was used to analyze the infiltration of immune cells in different treatment groups.
[0068] shNC+OXA group: 7 days after mice were inoculated with shNC MC38 tumor cells, 100 μL OXA (5 mg / kg) was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0069] shPLA1A+OXA group: 7 days after mice were inoculated with shPLA1A MC38 tumor cells, 100 μL OXA (5 mg / kg) was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0070] (2) Flow cytometry analysis of immune cell infiltration in mouse tumor tissues
[0071] The control and PLA1A knockdown mouse colorectal cancer cells MC38 were respectively cultured at 1×10 7 The cells were inoculated subcutaneously into C57BL / 6J mice at a concentration of 100 μL per mouse. OXA (5 mg / kg) was injected intraperitoneally starting on the 7th day, once every 3 days. Tumors were collected on the 18th day. The collected tumor tissues were prepared into single-cell suspensions and macrophages were stained using different fluorescent-labeled flow cytometry antibodies. The macrophage infiltration in different treatment groups was analyzed by flow cytometry.
[0072] shNC+OXA group: 7 days after mice were inoculated with shNC MC38 tumor cells, 100 μL OXA (5 mg / kg) was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0073] shPLA1A+OXA group: 7 days after mice were inoculated with shPLA1AMC38 tumor cells, 100 μL OXA (5 mg / kg) was injected intraperitoneally for treatment. The drug was administered every 3 days for 2 weeks until the 18th day.
[0074] 2. Experimental Results
[0075] To verify how PLA1A regulates chemotherapy sensitivity, we collected subcutaneous tumor tissues from mice and performed single-cell sequencing and flow cytometry to analyze immune cell infiltration. Figure 3The results showed that the combination of shPLA1A and oxaliplatin significantly reduced the infiltration of macrophages, including MHCII + The infiltration of macrophages increased significantly, and CD206 + Macrophage infiltration was significantly reduced.
[0076] In addition, anti-CSF1R was used to eliminate macrophages in mice (shPLA1A+OXA+anti-CSF1R). Figure 4 As shown, the results showed that the combination of shPLA1A and oxaliplatin and the elimination of macrophages could reverse the inhibitory effect of the combination of the two on tumors, indicating that knocking down PLA1A can exert an anti-tumor effect by reversing macrophage polarization.
[0077] Example 3 PLA1A expression is upregulated in tumor tissue and negatively correlated with patient prognosis
[0078] 1. Experimental Methods
[0079] Through our hospital's tumor biobank, we retrieved a large sample of colorectal cancer tissues (RNAlater-treated frozen tissues) from adjacent, adjacent, and metastatic colorectal cancer tissues. Immunohistochemistry was used to detect PLA1A protein levels in these tissues, and the relationship between PLA1A expression and overall survival was analyzed. We also used immunohistochemistry to detect PLA1A expression in tissue microarrays from colorectal cancer patients who had undergone chemotherapy, and analyzed the correlation between PLA1A expression and chemotherapy resistance.
[0080] 2. Experimental Results
[0081] To explore the correlation between the differential expression of PLA1A in tumor tissues and the survival prognosis of patients, we first performed immunohistochemical staining of PLA1A in primary cancer and adjacent tissues of 58 patients with colorectal cancer and 47 patients with colorectal cancer liver metastasis in our hospital. Figure 5 As shown, the results showed that PLA1A expression was higher in cancer tissues and liver metastases than in adjacent adjacent tissues.
[0082] According to the immunohistochemical score of PLA1A, 58 patients with colorectal cancer were divided into a PLA1A high expression group (28 cases) and a PLA1A low expression group (30 cases). 47 patients with liver metastasis were also divided into a PLA1A high expression group (24 cases) and a PLA1A low expression group (23 cases). Survival analysis was performed on the two groups of patients. The survival curves are shown in Figure 5. Figure 5 As shown, the results showed that patients with high PLA1A expression had a shorter overall survival (OS).
[0083] Further immunohistochemical staining was performed on tissue chips of colorectal cancer patients who had undergone chemotherapy. Figure 6 As shown, the results showed that PLA1A was highly expressed in chemotherapy-resistant patients, indicating that high expression of PLA1A in tumor tissues was positively correlated with chemotherapy resistance.
[0084] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.
Claims
1. Application of PLA1A gene / protein as an anti-tumor target in the preparation of anti-tumor drugs.
2. Application of PLA1A gene / protein as a target in the preparation of products that increase the sensitivity of tumor cells to chemotherapy drugs.
3. Application of PLA1A gene / protein as a target in the preparation of chemotherapy drug sensitizers.
4. Application of PLA1A gene / protein inhibitors in the preparation of anti-tumor drugs.
5. Application of PLA1A gene / protein inhibitors as tumor chemotherapy sensitizers.
6. A composition, characterized in that These include inhibitors of the PLA1A gene / protein and chemotherapy drugs.
7. The composition according to claim 6, characterized in that The PLA1A gene / protein inhibitor is a PLA1A-shRNA capable of inhibiting the expression of the PLA1A gene / protein.
8. The composition according to claim 6, characterized in that The PLA1A gene / protein inhibitor includes at least one of arachidonic acid trifluoromethyl ketone, methylarachidonic acid fluorophosphate, benzofuran-2-carboxylic acid, 8-phenyl-2-(1-piperazinyl)-4H-1-benzopyran-4-one, and manoamide.
9. The composition according to claim 6, characterized in that The chemotherapy drug includes at least one of cisplatin, carboplatin, and oxaliplatin.
10. Use of the composition according to any one of claims 6 to 9 in the preparation of anti-tumor drugs.