Enhanced AAV vector and application thereof

Abstract

The invention provides an enhanced AAV vector and application thereof. Specifically, the invention provides an adeno-associated virus capsid protein variant, a recombinant AAV virus particle containing the capsid protein, a preparation method of the recombinant AAV virus particle and application of the recombinant AAV virus particle in disease treatment and prevention.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an enhanced AAV vector and applications thereof. Background Art

[0002] Significant progress has been made in gene therapy using viruses to deliver therapeutic genetic material. Adeno-associated virus (AAV) has attracted considerable attention as a highly effective viral vector for gene therapy due to its low immunogenicity and ability to efficiently transduce non-dividing cells. AAV can infect a wide variety of cell and tissue types, and significant advances in its viral system over the past decade have made it suitable for human gene therapy.

[0003] Prior art (CN 107012171 A) utilizes the AAV2 variant AAV2.7m8 for ocular gene therapy. AAV2.7m8 is a modified adeno-associated virus (AAV) vector that enhances retinal cell infectivity by inserting a 10-peptide amino acid sequence between amino acids 587 and 588 in the GH loop of the AAV2 capsid protein. Although AAV2.7m8 has demonstrated enhanced retinal cell infectivity through directed evolution, further improvements are needed. First, although AAV2.7m8 exhibits superior penetration of the inner limiting membrane compared to wild-type AAV2 after intravitreal injection, the viral load reaching the inner and outer nuclear layers remains limited. This physical barrier, resulting in uneven distribution, may directly impact gene delivery efficiency, particularly for diseases involving multiple retinal cell layers, where the penetration of existing capsids is insufficient to meet clinical needs. Further optimization of the inserted peptide structure or the integration of enhanced penetration technologies may be necessary.

[0004] Secondly, cross-species activity differences in targeted screening warrant attention. Existing patented technologies utilize macaque models to assess transduction efficiency, but significant differences exist between primates and humans in retinal anatomy (e.g., inner limiting membrane thickness) and cell receptor expression profiles, potentially leading to discrepancies between clinical efficacy and expected outcomes. For example, the biochemical microenvironment or immune clearance mechanisms of the human vitreous cavity may further reduce the actual transduction efficiency of modified AAV2 variants. This potential disconnect between preclinical and clinical data can be verified through human organoid models or transgenic animal studies.

[0005] Therefore, there is an urgent need in this field to develop AAV vector subtypes that can improve retinal transduction efficiency, effectively solving the problems of insufficient transduction efficiency or insufficient expression intensity during intravitreal injection in existing technologies for intraocular treatment. Summary of the Invention

[0006] The purpose of the present invention is to provide an AAV variant that can improve retinal transduction efficiency, effectively solving the problems of insufficient transduction efficiency or insufficient expression intensity during vitreous cavity injection in intraocular treatment in the prior art.

[0007] The first aspect of the present invention provides an adeno-associated virus (AAV) capsid protein variant, wherein the VP1 of the AAV capsid protein variant has an inserted peptide relative to the amino acid sequence of the parent AAV capsid protein VP1, the inserted peptide is 9 amino acids in length, and its amino acid sequence differs from the sequence shown in any one of SEQ ID NOs: 29-32 by no more than 3, 2 or 1 amino acids.

[0008] In another preferred embodiment, the amino acid sequence of the inserted peptide differs from any one of SEQ ID NOs: 29-32 by no more than 1 amino acid.

[0009] In another preferred embodiment, the VP1 of the AAV capsid protein variant has an inserted peptide between positions 588 and 589 relative to the amino acid sequence of the parent AAV2 capsid protein VP1, the length of the inserted peptide is 9 amino acids, and the amino acid sequence thereof differs from the sequence shown in any one of SEQ ID NOs: 29-32 by no more than 3, 2 or 1 amino acids.

[0010] In another preferred embodiment, the insertion peptide is an insertion peptide of formula I: X1X2X3X4X5X6X7X8X9 formula I in: X1 is selected from Asp (D), Glu (E) and Met (M); X2 is selected from Pro (P), Thr (T), Gly (G) and Asp (D); X3 is selected from Pro (P) and Gln (Q); X4 is selected from the group consisting of Glu (E), Asp (D), Pro (P) and Asn (N); X5 is selected from Gln (Q), Thr (T), Pro (P) and Arg (R); X6 is selected from Arg (R) and Ser (S); X7 is selected from Pro (P), Gln (Q) and Arg (R); X8 is selected from Ala (A), Ser (S) and Glu (E); X9 is selected from Arg (R) and Val (V).

[0011] In another preferred embodiment, the insertion peptide is an insertion peptide of formula II: X1X2PX4X5RPX8R Formula II in: X1 is selected from Asp (D), Glu (E) and Met (M); X2 is selected from Pro (P), Thr (T), Gly (G) and Asp (D); X4 is selected from the group consisting of Glu (E), Asp (D), Pro (P) and Asn (N); X5 is selected from Gln (Q), Thr (T), Pro (P) and Arg (R); X8 is selected from Ala (A), Ser (S) and Glu (E).

[0012] In another preferred embodiment, the insertion peptide is an insertion peptide of formula III: X1X2X3X4X5X6X7AR Formula III in: X1 is selected from Asp (D), Glu (E) and Met (M); X2 is selected from Pro (P), Thr (T), Gly (G) and Asp (D); X3 is selected from Pro (P) and Gln (Q); X4 is selected from the group consisting of Glu (E), Asp (D), Pro (P) and Asn (N); X5 is selected from Gln (Q), Thr (T), Pro (P) and Arg (R); X6 is selected from Arg (R) and Ser (S); X7 is selected from Pro (P), Gln (Q) and Arg (R).

[0013] In another preferred embodiment, the amino acid sequence of the inserted peptide is shown in any one of SEQ ID NOs: 29-32.

[0014] In another preferred embodiment, the amino acid sequence of the inserted peptide is shown in any one of SEQ ID NO: 29, 30 or 31.

[0015] In another preferred embodiment, the amino acid sequence of the inserted peptide is shown in SEQ ID NO: 29 or 30.

[0016] In another preferred embodiment, the inserted peptide is inserted between any two adjacent amino acid residues at positions 586-591 of the amino acid sequence of the parent AAV capsid protein VP1.

[0017] In another preferred embodiment, the functional peptide is inserted between positions 586 and 587, between positions 587 and 588, between positions 588 and 589, between positions 589 and 590, or between positions 590 and 591 of the corresponding parent AAV capsid protein VP1 amino acid sequence.

[0018] In another preferred embodiment, the parent AAV capsid protein is AAV1 capsid protein, AAV2 capsid protein, AAV3 capsid protein, AAV4 capsid protein, AAV5 capsid protein, AAV6 capsid protein, AAV7 capsid protein, AAV8 capsid protein, AAV9 capsid protein, AAV10 capsid protein, AAV11 capsid protein, AAV12 capsid protein, or AAV13 capsid protein.

[0019] In another preferred embodiment, the parent AAV capsid protein is AAV2 capsid protein.

[0020] In another preferred embodiment, the AAV capsid protein VP1 amino acid sequence includes the sequence shown in SEQ ID NO: 6.

[0021] In another preferred example, the amino acid sequence of the AAV2 capsid protein VP1 is shown in SEQ ID NO: 6.

[0022] In another preferred embodiment, the amino acid sequence of the AAV capsid protein variant comprises a sequence as shown in any one of SEQ ID NOs: 1-4.

[0023] In another preferred embodiment, the amino acid sequence of the AAV capsid protein variant is selected from the following group: (i) a sequence as shown in any one of SEQ ID NOs: 1-4; (ii) a sequence that has at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1-4.

[0024] In another preferred embodiment, the amino acid sequence of the AAV capsid protein variant is shown in any one of SEQ ID NOs: 1-4.

[0025] In another preferred embodiment, the amino acid sequence of the AAV capsid protein variant is shown in any one of SEQ ID NOs: 1-3.

[0026] In another preferred embodiment, the amino acid sequence of the AAV capsid protein variant is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0027] In a second aspect of the present invention, an isolated polynucleotide is provided, which encodes the AAV capsid protein variant according to the first aspect of the present invention.

[0028] In another preferred embodiment, the polynucleotide sequence is shown in any one of SEQ ID NOs: 7-10.

[0029] In the third aspect of the present invention, a vector is provided, wherein the vector contains the polynucleotide according to the second aspect of the present invention.

[0030] In another preferred embodiment, the vector is a plasmid.

[0031] In a fourth aspect of the present invention, a host cell is provided, wherein the host cell contains the vector according to the third aspect of the present invention, or the polynucleotide according to the second aspect of the present invention is integrated into the genome.

[0032] In another preferred embodiment, the host cell further contains a helper plasmid containing the target nucleic acid.

[0033] In another preferred embodiment, the host cell is a eukaryotic cell or a prokaryotic cell.

[0034] In another preferred embodiment, the host cell is a plant cell, an insect cell, or an animal cell, preferably a mammalian cell.

[0035] In another preferred embodiment, the host cell is HEK-293T cell.

[0036] In a fifth aspect of the present invention, a recombinant adeno-associated virus (rAAV) particle is provided, wherein the rAAV particle comprises: (i) The AAV capsid protein variant according to the first aspect of the present invention.

[0037] (ii) a nucleic acid of interest packaged within the AAV capsid.

[0038] In another preferred embodiment, the target nucleic acid is an ophthalmic disease-related gene, or a nucleic acid encoding a protein for treating ophthalmic diseases.

[0039] In another preferred embodiment, the ratio of the transduction efficiency E1 of the rAAV particles to the target cells to the transduction efficiency E0 of the AAV particles containing the parent AAV capsid protein is E1 / E0≥2, preferably E1 / E0≥5, and more preferably E1 / E0≥10.

[0040] In the sixth aspect of the present invention, a method for preparing the rAAV particles as described in the fifth aspect of the present invention is provided, comprising the steps of: culturing the host cells as described in the fourth aspect of the present invention under suitable conditions to obtain the rAAV particles.

[0041] In another preferred embodiment, the method further comprises the step of isolating and / or purifying the rAAV particles from the culture.

[0042] In a seventh aspect of the present invention, a pharmaceutical composition is provided, comprising: (a) the rAAV particle according to the fifth aspect of the present invention; and (b) a pharmaceutically acceptable carrier.

[0043] In an eighth aspect of the present invention, a drug combination is provided, comprising: (a) a first active ingredient: the rAAV particle according to the fifth aspect of the present invention, or the pharmaceutical composition according to the seventh aspect of the present invention; and (b) a second active ingredient.

[0044] In another preferred embodiment, the second active ingredient is an immunomodulator, such as an immunosuppressant.

[0045] In another preferred embodiment, the second active ingredient is an ophthalmic therapeutic agent.

[0046] In the ninth aspect of the present invention, there is provided the use of the rAAV particles as described in the fifth aspect of the present invention, or the pharmaceutical composition as described in the seventh aspect of the present invention, or the drug combination as described in the eighth aspect of the present invention, or a combination thereof in the preparation of a drug for treating a disease.

[0047] In another preferred embodiment, the disease is an eye disease.

[0048] In another preferred embodiment, the eye disease is selected from the following group: dry age-related macular degeneration (dAMD), geographic atrophy, crystalline retinal degeneration (BCD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), Fabry disease, choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, and inherited retinal degeneration (IRD).

[0049] In another preferred embodiment, the drug further comprises an active ingredient for treating a disease selected from the group consisting of hemophilia, Canavan disease, Alzheimer's disease, lysosomal storage disease, adrenomedullary neuropathy, Parkinson's disease, amyotrophic lateral sclerosis (ALS), hereditary cardiomyopathy, familial hypercholesterolemia, Wilson's disease, Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), epidermolysis bullosa (EB), hereditary deafness, and type 1 diabetes.

[0050] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Shown are the fluorescence intensity detection results (a) and QPCR detection results (b) of different AAV variant viruses on the optic cup at day 14 of infection in the embodiment of the present invention, where MOI=1E9 and mScarlet primers are used to detect the target viral RNA transcription intensity.

[0052] Figure 2 Shown are the results of the efficacy test of different AAV vectors injected into the intravitreal cavity (IVT) of mice in the examples of the present invention, wherein a is the in vivo autofluorescence (AF) examination result at 4 and 6 weeks after administration, b and c are the AF mean fluorescence intensity and total fluorescence intensity detection results of both eyes of mice after 6 weeks of administration, respectively, and d is the QPCR quantitative analysis result after extracting retinal RNA from both eyes of mice after 6 weeks of administration.

[0053] Figure 3 The results of fluorescent staining of frozen sections of the retina of mice treated with different AAV vectors for 6 weeks are shown in the examples of the present invention. IVT represents the administration of different AAV vectors by intravitreal (IVT) injection, and 1E9vg represents a dose of 1×10 per eye. 9 Viral genome (vg); green fluorescence marks rhodopsin (R), blue fluorescence marks the cell nucleus with DAPI, and red fluorescence marks the red fluorescent protein (S) produced by the expression of mScarlet carried by AAV. The leftmost column of images is a complete retinal section, and the remaining columns of images are local retinal staining images with a scale of 75μm, showing the retinal ganglion cell layer (GCL), inner nuclear layer (INL) and outer nuclear layer (ONL) respectively.

[0054] Figure 4 Shown is a graph showing the inhibition efficiency of IVIG against different viruses in an embodiment of the present invention, wherein IVIG is intravenous immunoglobulin and RLUs stands for relative luminescence units. DETAILED DESCRIPTION

[0055] After extensive research and extensive screening, the inventors unexpectedly discovered the insertion of a 9-amino acid (9mer) peptide between amino acids 588 and 589 of the AAV2 capsid protein (VP1). This led to the successful screening of a series of novel AAV variants with enhanced retinal penetration and transduction efficiency, effectively addressing the existing challenges of insufficient transduction efficiency or expression intensity during intravitreal injection for intraocular therapy. The inventors also conducted cross-species validation, further verifying the transduction efficiency of these novel AAV variants in human retinal organoids. This approach overcomes the limitation of existing techniques, which limited validation to primate models, and provides more direct and reliable experimental evidence for the application of AAV vectors in the treatment of ophthalmic diseases. This is the basis for the present invention.

[0056] the term For the purpose of interpreting this specification, the following definitions will be used, and whenever appropriate, terms used in the singular may also include the plural, and vice versa. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0057] The term "about" or "approximately" includes within statistically significant ranges of values. Such ranges can be within an order of magnitude of a given value or range, preferably within 50%, more preferably within 20%, still more preferably within 10%, and even more preferably within 5% or within 1%. The permissible variations encompassed by the term "about" or "approximately" depend on the specific system under investigation and can be readily understood by those of ordinary skill in the art.

[0058] As used herein, the term "and / or" means any one of the alternatives or two or more or all of the alternatives.

[0059] As used herein, the term "comprising" or "including" means including the recited elements, integers, or steps, but not excluding any other elements, integers, or steps. In this document, when the term "comprising" or "including" is used, unless otherwise indicated, it also encompasses the situation where it consists of the recited elements, integers, or steps. For example, when referring to a polypeptide "comprising" a specific sequence, it is also intended to encompass a polypeptide consisting of the specific sequence.

[0060] As described in this article, adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus Dependinovirus in the family Parvoviridae. It is the simplest single-stranded DNA defective virus discovered to date and requires a helper virus (usually an adenovirus) to participate in replication. It encodes the VP1 gene and rep gene between the two inverted repeat sequences (ITRs) at the two ends. The ITRs play a decisive role in viral replication and packaging. The VP1 gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. AAV can infect a variety of cells. Because AAV is smaller than other viral vectors, is non-pathogenic, and can transfect both dividing and non-dividing cells, AAV-based gene therapy methods for the eye, especially for inherited retinal degenerative diseases, have attracted widespread attention.

[0061] Recombinant adeno-associated viral vectors (rAAVs), derived from non-pathogenic wild-type adeno-associated viruses, are considered one of the most promising gene transfer vectors due to their safety, broad host cell range (dividing and non-dividing cells), low immunogenicity, and prolonged in vivo expression of exogenous genes. They are widely used in gene therapy and vaccine research worldwide. In medical research, rAAVs are being used in gene therapy studies for a variety of diseases (both in vivo and in vitro). As a unique gene transfer vector, they are also widely used in gene function research, disease model development, and the creation of knockout mice.

[0062] The term "capsid protein" refers to a protein that is part of the viral capsid. For adeno-associated viruses, the capsid proteins are generally referred to as VP1, VP2, and / or VP3, and are each encoded by a single VP1 gene. For AAV, these three AAV capsid proteins are produced in an overlapping manner from the capsid open reading frame (ORF) via alternate mRNA splicing and / or alternate translation start codons. All three proteins use a common stop codon (Warrington et al. (2004) J. Virol. 78: 6595). The amino acid sequences of the capsid proteins of adeno-associated viruses are well known in the art and are generally conserved. Accordingly, although the amino acid positions provided herein may be provided relative to the capsid protein VP1 of AAV2, and unless otherwise specified, the amino acid positions provided herein are determined with reference to the amino acid positions of the AAV2 capsid protein set forth in SEQ ID NO: 6, a skilled person can separately and easily determine the corresponding positions of the same amino acids in different AAV serotypes. The "capsid protein" described in this article includes the capsid proteins of existing serotypes such as AAV type 1 (AAV1), AAV type 2 (AAV2), AAV type 3 (AAV3), AAV type 4 (AAV4), AAV type 5 (AAV5), AAV type 6 (AAV6), AAV type 7 (AAV7), AAV type 8 (AAV8), and AAV type 9 (AAV9).

[0063] As used herein, the term "rAAV" refers to recombinant adeno-associated virus, also known as recombinant adeno-associated viral particles or recombinant AAV.

[0064] The term "retinal cell" as used herein may refer to any cell type comprising the retina, such as retinal ganglion cells, amacrine cells, horizontal cells, bipolar cells and photoreceptor cells (including rods and cones), Mullerian glial cells and retinal pigment epithelial cells.

[0065] As used herein, the phrase "operably linked" includes a physical juxtaposition (e.g., in three-dimensional space) of components or elements that interact directly or indirectly with each other, or otherwise coordinate with each other to participate in a biological event, the juxtaposition achieving or permitting such interaction and / or coordination. In some embodiments, "operably linked" involves covalently linking the relevant components or elements to each other. However, those skilled in the art will appreciate that in some embodiments, covalent linkage is not required to achieve effective operable linkage.

[0066] The term "capsid protein variant" includes capsid proteins having at least one mutation (eg, substitution, deletion, or insertion) compared to the corresponding capsid protein as a parent.

[0067] In this article, amino acid mutation can be amino acid substitution, deletion or insertion. Any combination of substitution, deletion or insertion can be performed to obtain optimized variants with desired properties. Amino acid deletion and insertion are included in the deletion and insertion of the amino and / or carboxyl terminal of the polypeptide sequence, and are also included in the deletion and insertion inside the polypeptide sequence. In some embodiments, amino acid mutation is amino acid substitution, such as single amino acid substitution, or the combination of several amino acid substitutions. In some embodiments, amino acid mutation is insertion, such as the insertion of several amino acid fragments. The inserted amino acid can simply be inserted between two given amino acids of the capsid protein. Amino acid insertion can also be carried out together with the deletion of the given amino acid of the capsid protein at the insertion site.

[0068] Herein, when referring to amino acid positions of the capsid protein to be mutated, they are determined by reference to the amino acid sequence set forth in SEQ ID NO: 6. The corresponding amino acid positions on hybrid proteins or polypeptides having other amino acid sequences can be identified by comparing the amino acid sequence with SEQ ID NO: 6.

[0069] The terms "transduction" or "infection" refer to the introduction of a nucleic acid into target cells via a viral vector. The term "transduction efficiency" refers to the fraction (e.g., percentage) of cells expressing the target nucleic acid after incubation with a defined number of viral vectors containing the target nucleic acid. Well-known methods for determining transduction efficiency include fluorescence-activated cell sorting of cells transduced with a fluorescent reporter gene, PCR for target nucleic acid expression, and the like.

[0070] "Identity" or "percent identity (%)" of an amino acid sequence or nucleic acid sequence refers to the percentage of amino acid residues / nucleotides in the candidate sequence that are identical to the amino acid residues / nucleotides in the specific sequence shown in this specification, after aligning the candidate sequence with the specific sequence shown in this specification and introducing gaps, if necessary, to achieve the maximum percentage identity, and not considering any conservative substitutions as part of the sequence identity. In some embodiments, the present invention includes variants of the proteins or polypeptides or nucleic acids of the present invention that have a considerable degree of identity, for example, at least 80%, 85%, 90%, 95%, 97%, 98% or 99% or more, relative to the polypeptides or proteins or nucleic acids specifically disclosed herein. The variants may contain conservative changes.

[0071] The terms "individual" or "subject" are used interchangeably and refer to mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In particular, the individual is a human.

[0072] The term "treating" includes administering a composition or hybrid polypeptide to prevent or delay the onset of symptoms, complications, or biochemical indicators of a disease, to alleviate symptoms, or to arrest or inhibit further development of a disease, condition, or disorder. The term "preventing" includes inhibiting the onset or development of a disease or disorder or symptoms of a particular disease or disorder.

[0073] The term "pharmaceutical excipient" refers to a diluent, adjuvant (eg, Freund's adjuvant (complete and incomplete)), excipient, carrier, stabilizer, or the like, which is administered together with the active substance.

[0074] The term "pharmaceutical composition" refers to a composition that is in form permitting the biological activity of the active ingredient contained therein to be effective, and that contains no additional ingredients that are unacceptably toxic to a subject to which the composition would be administered.

[0075] The term "effective amount" refers to that amount or dosage of a rAAV or composition or combination of the invention which, after single or multiple doses, produces the desired effect in a patient in need of treatment or prevention.

[0076] The term "therapeutically effective amount" refers to an amount effective to achieve the desired therapeutic outcome at the required dosage and for the required period of time. A therapeutically effective amount is also one in which any toxic or deleterious effects of the rAAV or composition or combination are outweighed by the therapeutically beneficial effects. A "therapeutically effective amount" preferably inhibits a measurable parameter or improves a measurable parameter by at least about 40%, even more preferably by at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or even 100%, relative to an untreated subject.

[0077] The term "polynucleotide" refers to a polymeric form of nucleotides of any length, including deoxyribonucleotides or ribonucleotides or their analogs. A polynucleotide may contain modified nucleotides, such as methylated nucleotides and nucleotide analogs, and may be interrupted by non-nucleotide components. As used herein, the term polynucleotide may refer interchangeably to double-stranded and single-stranded molecules.

[0078] The term "target nucleic acid" refers to a nucleic acid to be transduced by recombinant AAV viral particles, which encodes, for example, a preventive or therapeutic protein, particularly a protein for preventing or treating ophthalmic diseases, such as AIPL1, PROM1, RS1, RPE65, macromolecular antibodies and antibody analogs, etc.

[0079] AAV capsid protein variants In some embodiments, the present invention relates to a novel AAV capsid protein variant having a 9aa insertion peptide relative to the parent AAV2 capsid protein.

[0080] In some embodiments, the amino acid sequence of the inserted peptide has a sequence identity of ≥60%, ≥70%, ≥80% or ≥90% with the sequence shown in any one of SEQ ID NOs: 29-32. In some embodiments, the amino acid sequence of the inserted peptide may have 3, 2 or 1 amino acid differences with the sequence shown in any one of SEQ ID NOs: 29-32, and the differences do not change or substantially do not change the retinal transduction efficiency of the AAV virus particles containing the capsid protein variant of the present invention. In some embodiments, the amino acid sequence of the inserted peptide is as shown in Formula I, Formula II or Formula III. In some embodiments, the amino acid sequence of the inserted peptide may be as shown in any one of SEQ ID NOs: 29-32. In some embodiments, the amino acid sequence of the inserted peptide is as shown in any one of SEQ ID NOs: 29, 30 or 31. In another preferred example, the amino acid sequence of the inserted peptide is as shown in SEQ ID NO: 29 or 30.

[0081] The present invention also relates to a plasmid comprising a nucleic acid encoding the capsid protein variant of the present invention.

[0082] Target nucleic acid The capsid protein of the present invention can package target nucleic acid to form virus particles.

[0083] The nucleic acid of interest suitable for encoding by the viral particles of the present invention is any nucleic acid encoding a therapeutic or preventive protein, in particular a nucleic acid encoding a protein for the prevention or treatment of ophthalmic diseases, such as ophthalmology-related genes, such as RPE65, AIPL1, PROM1, RS1 genes, etc. In some embodiments, proteins for the prevention or treatment of ophthalmic diseases include, but are not limited to, RPE65, AIPL1, PROM1, RS1, or antibody analogs, etc.

[0084] The nucleic acid of interest can be contained in an expression cassette and packaged within an AAV capsid.

[0085] In some embodiments, the expression cassette comprises at least one ITR sequence, so that the vector genome can be smoothly assembled into the capsid.The expression cassette can be single-stranded DNA, double-stranded DNA, or single-stranded RNA or double-stranded RNA.

[0086] In some embodiments, the expression cassette may comprise one or more regulatory sequences to direct the expression of the target nucleic acid coding sequence in target cells (e.g., retinal target cells, such as photoreceptor cells or optic nerve cells). The regulatory sequence may be selected from a transcription initiation sequence, a termination sequence, a promoter, and / or an enhancer sequence operably linked to the coding sequence; efficient RNA processing signals such as splicing and polyadenylation (poly A) regions, including human growth hormone polyadenylation regions; inverted repeat sequences (e.g., L-ITR or R-ITR); a selective marker or reporter gene, such as a resistance gene; microRNA; a post-transcriptional regulatory sequence, such as WPRE (post-transcriptional regulatory sequence of woodchuck hepatitis virus); a sequence that stabilizes cytoplasmic mRNA; a nucleic acid restriction site; a homologous recombination sequence; a sequence that enhances translation efficiency (e.g., a Kozak sequence); a sequence that enhances protein stability; and, when desired, a sequence that enhances secretion of the encoded product.

[0087] In some preferred embodiments, the regulatory sequence is located in the 5'UTR or 3'UTR. In some preferred embodiments, the regulatory sequence is selected from one or more of the following: Promoters, inverted repeats, introns, enhancers, post-transcriptional regulatory sequences, polyadenylation regions, selectable markers or reporter genes.

[0088] Examples of promoters suitable for use in the present invention include, but are not limited to, promoters from bacteria, yeast, plants, viruses, and mammals (including monkeys and humans). Promoters can be constitutive or inducible. Constitutive promoters initiate RNA synthesis independently of regulatory influences.

[0089] Expression cassette of the present invention can also comprise selective marker or reporter gene, for example, to determine the expression of carrier in growth system (for example bacterial cell) or in target cell." selective marker " or " reporter gene " of the present invention can be selected from those as known in the art.Suitable reporter gene includes, but is not limited to enhanced green fluorescent protein, red fluorescent protein, luciferase and secreted embryo alkaline phosphatase (seAP), it can comprise the sequence of encoding geneticin, hygromycin or puromycin resistance, etc. Such selective marker or reporter gene (it can be located at or not located at outside the viral genome to be packaged into virion) can be used for sending the signal of the existence of plasmid in bacterial cell, such as antibiotic resistance marker gene, for example ampicillin or tetracycline resistance or kanamycin resistance.

[0090] The expression cassette or expression vector of the present invention may further comprise a polyadenylation region, such as hGHpA (human growth hormone polyadenylation region).

[0091] The expression cassette or expression vector of the present invention may also contain introns, such as introns of a chimeric or native gene.

[0092] Virus particles The present invention relates to a recombinant AAV virus (rAAV) particle comprising (i) an AAV capsid protein variant of the present invention; and (ii) a nucleic acid of interest packaged in the AAV capsid, such as a gene associated with an ophthalmic disease or a nucleic acid encoding a protein for treating an ophthalmic disease.

[0093] Preparation method The present invention relates to a method for preparing recombinant AAV viral particles (rAAV). Many methods are known in the art for packaging and producing rAAV. Currently commonly used rAAV packaging systems mainly include three-plasmid co-transfection systems, systems using adenovirus as a helper virus, packaging systems using herpes simplex virus type 1 (HSV1) as a helper virus, and baculovirus-based packaging systems. Each packaging system has its own characteristics, and those skilled in the art can make an appropriate choice as needed.

[0094] rAAV production cultures for producing rAAV viral particles all require: 1) suitable host cells, including, for example, human-derived cell lines such as HEK-293T cells, or insect-derived cell lines (in the case of baculovirus production systems); 2) suitable helper functions, which are provided by wild-type or mutant adenovirus (such as temperature-sensitive adenovirus), herpes virus, baculovirus, or plasmid constructs that provide helper functions; 3) AAV rep and VP1 genes and gene products; 4) the target gene / target nucleic acid, which is flanked by at least one AAV ITR sequence that retains full function and is preferably driven by an operably linked promoter; and 5) a suitable culture system to support rAAV production.

[0095] In some embodiments, the present invention relates to a method for producing recombinant AAV virus particles, comprising culturing packaging cells under conditions sufficient to produce recombinant AAV virus particles, wherein the packaging cells comprise a plasmid comprising a nucleic acid encoding a capsid protein variant according to the present invention or a nucleic acid encoding a capsid protein variant according to the present invention.

[0096] In some embodiments, the packaging cell further comprises a helper plasmid and / or a transfer plasmid comprising the nucleic acid of interest.

[0097] In some embodiments, the method further comprises isolating the recombinant AAV viral particles from the culture supernatant.

[0098] In some embodiments, the method further comprises lysing the packaging cells and isolating the recombinant AAV viral particles from the cell lysate.

[0099] In some embodiments, the method further comprises one or more of the following steps: a. Remove cell debris, b. Treating the supernatant containing recombinant AAV viral particles with universal nuclease, c. Concentrate the recombinant AAV virus particles, d. Purify the recombinant AAV virus particles.

[0100] Therefore, the present invention also relates to a packaging cell for producing recombinant AAV virus particles, wherein the packaging cell comprises a plasmid comprising a nucleic acid encoding a capsid protein variant according to the present invention or a capsid protein encoding nucleic acid according to the present invention or an expression cassette according to the present invention.

[0101] Composition, drug or preparation The present invention provides a formulation, composition or drug, comprising (a) the rAAV of the present invention, and (b) pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers.

[0102] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, isotonic and absorption delaying agents that are physiologically compatible. For the use and applications of pharmaceutical excipients, see also Handbook of Pharmaceutical Excipients (8th Edition), edited by RC Rowe, PJ Sheskey and SC Owen, Pharmaceutical Publishing House, London, Chicago.

[0103] In some embodiments, pharmaceutical excipients include, but are not limited to, one or more compatible solid or liquid fillers or gel substances that are suitable for human use and must be of sufficient purity and sufficiently low toxicity. "Compatibility" herein refers to the ability of the components in the composition to blend with the active ingredients of the present invention and with each other without significantly reducing the efficacy of the active ingredients. Suitable pharmaceutical excipients will be known to those skilled in the art. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween®), wetting agents (such as sodium lauryl sulfate), colorants, flavorings, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0104] The preparation or composition or medicine of the present invention can be liquid or solid, for example powder, gel or paste.Preferably, the preparation or composition or medicine of the present invention is liquid, preferably an injectable liquid.Preferably, the injectable liquid is provided as a capsule or in a syringe.

[0105] The rAAV of the present invention or a formulation, composition or medicament comprising the same can be administered intravenously, intramuscularly, subcutaneously, orally, by mucosal contact, intraperitoneally or intralesionally, preferably topically to the eye, for example, by intraretinal administration or intravitreal administration, such as intravitreal injection, subretinal injection or suprachoroidal injection. In some embodiments, the rAAV of the present invention or a formulation, composition or medicament comprising the same can be administered intraretinaly or intravitreally, for example, by intravitreal or subretinal administration, such as intravitreal administration (IVT administration). In any mode of administration, the formulation, composition or medicament of the present invention is preferably provided as an injectable liquid.

[0106] The composition or formulation or medicament may comprise a physiologically acceptable sterile aqueous or anhydrous solution, dispersion, suspension or emulsion, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0107] The composition of the present invention, such as a pharmaceutical composition or pharmaceutical preparation, may further comprise other active ingredients, such as one or more other therapeutic agents, such as an immunomodulator (eg, an immunosuppressant).

[0108] Combination products The present invention also provides combination products (eg, pharmaceutical combination products) comprising the rAAV of the present invention and one or more other therapeutic agents. The combination products of the present invention can be used in the treatment methods of the present invention.

[0109] The present invention also provides a kit comprising the combination product, for example, the kit comprises in the same package: A first container containing the rAAV of the present invention or a medicament comprising the same; A second container of a pharmaceutical composition comprising one or more additional therapeutic agents (e.g., an immunomodulatory agent).

[0110] In some embodiments, the other therapeutic agent is an immunomodulator, such as an immunosuppressant, for example, to reduce the immune response generated by the rAAV particles, such as an immune inflammatory response.

[0111] Treatment In one embodiment, the rAAV, formulation or composition, or medicament of the invention is used to treat an ocular disease.

[0112] In some embodiments, ocular diseases include, but are not limited to, dry age-related macular degeneration (dAMD), geographic atrophy, crystalline retinopathy (BCD), wet age-related macular degeneration (wAMD), retinitis pigmentosa (RP), Fabry disease, choroideremia, Leber hereditary optic neuropathy (LHON), Stargardt disease, X-linked retinoschisis and X-linked retinitis pigmentosa, Leber congenital amaurosis, hereditary retinal degeneration (IRD), congenital cataract, glaucoma, congenital retinal, iris or choroidal coloboma, retinoblastoma, pathological myopia, congenital optic neuropathy, strabismus, keratoconus, etc.

[0113] In one embodiment, the rAAV, formulation or composition or medicament of the invention is administered intraocularly, for example, intraretinally or intravitreally, for example, subretinally or intravitreally. In one embodiment, the administration is by injection.

[0114] In one embodiment, the present invention also relates to the use of the recombinant AAV virus particle, a preparation or composition comprising the same, or a combination product in the preparation of a medicament for treating an eye disease according to the present invention.

[0115] AAV variants with enhanced retinal cell transduction To explore the role of display peptides in enhancing the retinal penetration of AAV vectors, the present inventors synthesized DNA sequences corresponding to a series of 9-mer short peptides. These 9-mer sequences were precisely inserted between 588 and 589 of the VP1 protein of wild-type AAV2 using polymerase chain reaction (PCR) and Gibson ligation techniques. Subsequently, these 9-mer-containing capsid variants were packaged to construct a 9mer-AAV library.

[0116] In order to screen out viral variants with efficient retinal penetration ability, the present invention injected the 9mer-AAV library into a mouse model that specifically expresses GFP in rod photoreceptors for tissue-specific screening. One week after the injection, the mouse eyes were dissected, and the retinas were processed and dissociated into single-cell suspensions. Next, a flow cytometer was used to separate the photoreceptor cells labeled with GFP, and the viral gene amplified fragments were subjected to second-generation sequencing analysis. The sequencing results showed that the most enriched viral variants contained 9mer sequences of the following amino acid sequences: "DPPEQRPAR", "ETPDTRPSR", "MGQPPSQAR" and "EDPNRRREV". These variants showed significant advantages in retinal penetration ability, providing an important reference for the development of new AAV vectors.

[0117] The technical solution of the present invention has the following main advantages: (1) The novel AAV variants RC-V63 and RC-V68 provided by the present invention are significantly superior to the AAV2.7m8 variant in the prior art in terms of transduction efficiency and penetration into the eyes of living animals.

[0118] (2) When injected intravitreally into the mouse eye, the novel AAV variants RC-V63 and RC-V68 provided by the present invention showed a wider distribution in both fundus and biopsy examinations compared to the prior art AAV2.7m8 variant. Specifically, RC-V63 and RC-V68 were able to carry the reporter gene to more outer regions of the eye, particularly the inner and outer nuclear layers, indicating that they have higher penetration and transduction efficiency in the retina.

[0119] (3) The transduction efficiency of the novel AAV variants RC-V53, RC-V62, RC-V63, and RC-V68 provided by the present invention in human retinal organoids has been fully verified. The transduction effect of RC-V53 and RC-V62 in human retinal cells was significantly higher than that of AAV2.7m8 (the expression levels of RC-V53 and RC-V63 were 4.5 times and 6.8 times that of AAV2.7m8, respectively), while RC-V63 and RC-V68 could also reach a similar level to AAV2.7m8. This finding indicates that these variants, especially RC-V53 and RC-V62, have significant advantages in the treatment of human eye diseases and can effectively overcome the problem of low transduction efficiency of existing AAV variants in the treatment of eye diseases.

[0120] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples, for which specific conditions are not specified, are generally performed under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. The experimental materials and reagents involved in the present invention can be obtained from commercial sources unless otherwise specified.

[0121] Example 1: Screening for AAV variants with enhanced retinal cell transduction (1) Experimental methods and principles: Inserting display peptides into AAV can improve gene delivery capabilities, primarily through the following mechanisms: First, the displayed peptides can specifically bind to novel receptors or highly abundant molecules on the target cell surface, enhancing the virus's initial attachment and cell entry capabilities. Second, certain peptides (such as pH-sensitive peptides or transmembrane peptides) can promote endosomal escape or directly penetrate the cell membrane, improving viral delivery efficiency. Furthermore, displayed peptides can mask capsid antigen epitopes, reducing recognition by neutralizing antibodies and prolonging the virus's duration of action in the body. Finally, some peptides can activate non-classical endocytosis pathways, preventing viral degradation by lysosomes. These modifications collectively optimize AAV targeting, internalization efficiency, and intracellular trafficking, significantly enhancing gene delivery.

[0122] (2) Experimental steps: In the present embodiment, a series of 9mer sequences were synthesized, and these fragments were precisely inserted between the R588 and Q589 residues of the AAV2 capsid by molecular cloning technology. The plasmid containing the 9mer sequence was then packaged into a viral library in 293T cells. After the viral library was qualified for quality identification, it was injected into the vitreous cavity of a mouse model that specifically expressed GFP in rod photoreceptors. One week after the injection, the mouse eyes were dissected, the retinas were separated, and they were dissociated into single cell suspensions. Then, GFP-labeled photoreceptor cells were isolated using a flow cytometer (FACS), and the viral gene fragments were recovered by PCR. The recovered target fragments were then subjected to second-generation sequencing analysis. Finally, the sequencing data were subjected to bioinformatics analysis, the enrichment of different 9mer sequences was statistically analyzed, and the dominant sequences with high transduction ability in photoreceptor cells were screened.

[0123] The results showed that the present invention successfully identified a series of novel capsid variants with varying degrees of enhanced retinal penetration, including RC-V53, RC-V62, RC-V63, and RC-V68. The VP1 amino acid sequence of RC-V53 is shown in SEQ ID NO. 1; the VP1 amino acid sequence of RC-V62 is shown in SEQ ID NO. 2; the VP1 amino acid sequence of RC-V63 is shown in SEQ ID NO. 3; and the VP1 amino acid sequence of RC-V68 is shown in SEQ ID NO. 4.

[0124] In order to more comprehensively evaluate the performance of these variants, the present invention not only verified them one by one in mouse models, but also introduced human retinal organoid models to deeply characterize the infection ability of each variant.

[0125] Example 2: Preparation of AAV variants Variants RC-V53, RC-V62, RC-V63, and RC-V68 were designed, inserting the short peptides "DPPEQRPAR (SEQ ID NO. 29)," "ETPDTRPSR (SEQ ID NO. 30)," "MGQPPSQAR (SEQ ID NO. 31)," and "EDPNRRREV (SEQ ID NO. 32)" after position 588 of AAV2 VP1. The amino acid sequences of VP1 for RC-V53, RC-V62, RC-V63, and RC-V68 are shown in SEQ ID NOs. 1-4, respectively; the amino acid sequence of VP1 for the AAV variant AAV2.7m8 disclosed in the prior art is shown in SEQ ID NO. 5; and the amino acid sequence of VP1 for wild-type AAV2 is shown in SEQ ID NO. 6.

[0126] The following describes the construction of plasmids and the packaging of a series of AAV viruses containing the mScarlet transgene, including RC-V53, RC-V62, RC-V63, RC-V68, AAV2, and AAV2.7m8, for subsequent in vitro cell and in vivo mouse transduction experiments. The nucleic acid sequences of VP1 of RC-V53, RC-V62, RC-V63, and RC-V68 are shown in SEQ ID NOs. 7-10, respectively; the nucleic acid sequence of VP1 of AAV2.7m8, a variant of AAV disclosed in the prior art, is shown in SEQ ID NO. 11; and the nucleic acid sequence of VP1 of wild-type AAV2 is shown in SEQ ID NO. 12.

[0127] (1) Construction of RC-V53 plasmid The cap gene and downstream poly sequence of the AAV2 plasmid were completely digested with Swa I at 2003 bp and Sma I at 4348 bp to obtain a linearized vector. The cap gene and downstream poly sequence of AAV2 were removed and replaced by a 2372 bp fragment containing the RC-V53 cap and downstream poly sequence through homologous recombination. This fragment was amplified by polymerase chain reaction (PCR). Using the AAV2 plasmid as a template, PCR was performed to obtain two amplified products. (a) Upstream of the 589-597aa mutation region: The 5′ end amplification primer was RC-V53-F1: AACAATAAATGATTTAAATCAGGTATGG (SEQ ID NO. 13), and the 3′ end amplification primer was RC-V53-R1: GGTCTCTGTTCCGGAGGATCTCTGTTGCCTCTCTGGAGGT (SEQ ID NO. 14); (b) Downstream of the 589-597aa mutation region: The 5' end amplification primer was RC-V53-F2: ATCCTCCGGAACAGAGACCGGCTAGACAAGCAGCTACCGCAGATGTC (SEQ ID NO. 15), and the 3' end amplification primer was RC-V53-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQID NO. 16). The above two amplification products were overlapped to obtain a 2372 bp fragment containing the RC-V53 cap and the downstream partial poly sequence.

[0128] (2) Construction of RC-V62 plasmid Similar to the above construction method, the RC-V62 vector was constructed by homologous recombination of the fragment containing the RC-V62 cap with the linearized vector. The fragment containing the RC-V62 cap was amplified by PCR using the AAV2 plasmid as a template, resulting in two amplification products: (a) upstream of the 589-597aa mutation region, the 5' end amplification primer was RC-V62-F1: AACAATAAATGATTTAAATCAGGTATGG (SEQ ID NO. 17), and the 3' end amplification primer was RC-V62-R1: CTAGGCCTGGTGTCGGGTGTTTCTCTGTTGCCTCTCTGGAGGT (SEQ ID NO. 18); (b) downstream of the 589-597aa mutation region: the 5' end amplification primer was RC-V62-F2: ACACCCGACACCAGGCCTAGTAGACAAGCAGCTACCGCAGATGT (SEQ ID NO. 19), and the 3' end amplification primer was RC-V62-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID The above two amplification products were overlapped to obtain a 2372 bp fragment containing the RC-V62 cap and part of the downstream poly sequence.

[0129] (3) Construction of RC-V63 plasmid Similar to the above construction method, the RC-V63 vector was constructed by homologous recombination of the fragment containing the RC-V63 cap and the linearized vector. The fragment containing the RC-V63 cap was amplified by PCR using the AAV2 plasmid as a template, resulting in two amplification products: (a) upstream of the 589-597aa mutation region: the 5' end amplification primer was RC-V63-F1: AACAATAAATGATTTAAATCAGGTATGG (SEQ ID NO. 21), and the 3' end amplification primer was RC-V63-R1: CTTGGCTAGGTGGCTGACCCATTCTGTTGCCTCTCTGGAGGT (SEQ ID NO. 22); (b) downstream of the 589-597aa mutation region: the 5' end amplification primer was RC-V63-F2: GGGTCAGCCACCTAGCCAAGCTAGGCAAGCAGCTACCGCAGATGT (SEQ ID NO. 23), and the 3' end amplification primer was RC-V63-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO. NO.24), the above two amplification products were overlapped to obtain a 2372 bp fragment containing the RC-V63 cap and part of the downstream poly sequence.

[0130] (3) Construction of RC-V68 plasmid Similar to the above construction method, the RC-V68 vector was constructed by homologous recombination of the fragment containing the RC-V68 cap with the linearized vector. The fragment containing the RC-V68 cap was amplified by PCR using the AAV2 plasmid as a template, resulting in two amplification products: (a) upstream of the 589-597aa mutation region: the 5' end amplification primer was RC-V68-F1: AACAATAAATGATTTAAATCAGGTATGG (SEQ ID NO. 25), and the 3' end amplification primer was RC-V68-R2: CGGCGGCGGTTGGGGTCCTCTCTGTTGCCTCTCTGGAGGTT (SEQ ID NO. 26); (b) downstream of the 589-597aa mutation region: the 5' end amplification primer was RC-V68-F2: AGGACCCCAACCGCCGCCGCGAGGTCCAAGCAGCTACCGCAGATGT (SEQ ID NO. 27), and the 3' end amplification primer was RC-V68-R2: CGCTGTTTAAACGCCCGGGCTGTAG (SEQ ID NO. The above two amplification products were overlapped to obtain a 2372 bp fragment containing the RC-V68 cap and part of the downstream poly sequence.

[0131] (2) AAV packaging and purification Seed cells were diluted to 1E+6 / ml in 300ml of suspension culture medium (SMM 293-CD1, Sino Biological) and cultured in a shaking incubator at 37°C, 120 rpm, and 5% CO2. 300µg of plasmid was added to 15ml of SMM 293-TII medium without antibiotics or GlutaMax. The molar ratio of the three packaging plasmids (LX-GOI-E10 (mScarlet reporter genome plasmid), RC-V53 / RC-V62 / RC-V63 / RC-V68 (Rep-Cap plasmids), and pHelper (auxiliary packaging plasmid) was 1:1:1. 300µl of Fecto VIR-AAV was then added to the dilution, vortexed, and allowed to stand at room temperature for 30 minutes. The transfection mixture was then added dropwise to the suspension cells and cultured in a shaking incubator at 37°C, 120 rpm, and 5% CO2. 24 and 48 hours after packaging, the cells were fed at a ratio of 35 ml / L SMS 293-SUPI (Sino-Bio) per liter of cell culture. After 72 hours, the cells were harvested by centrifugation at 1500 rpm in a swinging rotor for 10 minutes. The supernatant was discarded and the cells were resuspended in PBS. The enzyme was added at 50 U / ml and digested on a shaker at 37°C for 1 hour. The cells were then centrifuged at 4000 rpm in a swinging rotor for 15 minutes, and the supernatant was collected and subjected to iodixanol ultracentrifugation. The 40% iodixanol layer was replaced with PBS using a 50 ml Millipore 100KD ultrafiltration tube. The virus was stored at -80°C.

[0132] Example 3: Retinal organoid experiment Retinal organoids (optic cups) are differentiated from human iPSCs and can form three-dimensional structures encompassing all retinal cell types. The optic cups closely resemble the human retina, better simulating the effects of AAV infection on the human retina. When the optic cups differentiated to photoreceptor maturation (approximately 150-200 days), the researchers tested the transduction activity of RC-V52, RC-V62, RC-V63, AAV2, and AAV2.7m8 viral vectors in human retinal organoids.

[0133] (1) Optic cup differentiation Wild-type H9 cells were used for retinal organoid differentiation. On Day 0, human embryonic stem cell line H9 cells were gently digested at 37°C and embryoid bodies (EBs) were established in ultra-low attachment 6-well plates. On Days 1-5, NIM medium (DMEM / F12+1xN2+MEM-NEAA+Heparin) was replaced every 2 days. On Days 7-15, EBs were transferred to Matrigel-coated 6-well plates using a Pasteur pipette, and half of the NIM medium was replaced on Days 9, 12, and 15. On Days 16-25, the medium was replaced every 2 days with 3:1 medium (DMEM / F12+1x B27+MEM-NEAA). The optic cups were then isolated. Cells were scraped off using a cross-cutting pipette technique and transferred to a low-attachment 6-well plate with a Pasteur pipette. After optic cup isolation, the medium was changed to 3D-RDM (DMEM / F12 + 10% FBS + MEM-NEAA + 1x B27 + 100µM Taurine + CDLS). On days 30-40, distinct optic cups were selected under a stereomicroscope for long-term culture. The first stage of optic cup differentiation occurs as late as six weeks after isolation and is characterized by the appearance of a dark core in the center. By 17-24 weeks after isolation, most iPSC-derived optic cups have reached the second stage, characterized by the appearance of distinct surface hair-like appendages and the reappearance of a thin outer rim. By the onset of stage 3 differentiation (latest day 148-196), the optic cups have reached an advanced stage of photoreceptor cell development, including the formation of inner and outer segments, outer nuclear layer, and outer plexiform layer, making them suitable for AAV infection testing.

[0134] (2) Optic cup infection AAV2, AAV2.7m8, RC-V53, RC-V62, and RC-V63 viruses were diluted to 1E11 vg / μl. Mature retinal organoids were infected with 1E9 vg of the virus. 3D-RDM medium was changed every three days. Fluorescence imaging was performed on Day 14 of infection.

[0135] (3) Tissue RNA extraction and identification Retinal organoids were cultured and washed twice with PBS. Retinal organoids were then extracted using a DNA / RNA co-extraction kit (Tiangen, DP422). Finally, RNA was dissolved in 50 μl of DEPC water. Five μl of RNA was reverse-transcribed into cDNA using the PrimeScript™ Genomic DNA Cleanup Reverse Transcription Kit (Takara, RR047A). Quantitative quantitative PCR was performed using TB Green® Premix Ex Taq™ (TliRNaseH Plus (Takara, RR420A)). mScarlet primers were used to detect target viral RNA transcription intensity, and β-actin primers were used for normalization.

[0136] The results are as follows Figure 1 As shown, the fluorescence photography results showed that at MOI=1E9, after infection with each virus on Day 14, the fluorescence intensity of RC-V53 and RC-V62 was significantly higher than that of AAV2 and AAV2.7m8, while the fluorescence intensity of RC-V63 and RC-V68 was higher than that of AAV2 and close to that of AAV2.7m8 ( Figure 1 (a) Tissue RNA extraction and QPCR quantification results showed that at MOI = 1E9, on Day 14 after infection with each virus, the expression levels of mScarlet mRNA of RC-V53 and RC-V62 were higher than those of AAV2 and AAV2.7m8 (expression levels were 8.7 to 13 times that of AAV2, while AAV2.7m8 was only 1.9 times that of AAV2); the expression level of mScarlet mRNA of RC-V63 was 4.1 times that of AAV2, which was lower than that of RC-V53 and RC-V62, but higher than that of AAV2.7m8; and the expression level of mScarlet mRNA of RC-V68 was 1.6 times that of AAV2, slightly lower than that of AAV2.7m8 ( Figure 1 Middle b).

[0137] Example 4: Intravitreal (IVT) injection efficacy test in animals RC-V63 and RC-V68 were packaged with vectors carrying the CAG-mScarlet transgene to demonstrate their transduction properties.

[0138] To evaluate the transduction efficiency of different AAV vectors in the retina, three 6- to 8-week-old C57 wild-type (WT) mice were prepared. Four different AAV vectors were used in the experiment: RC-V63-mScarlet, RC-V68-mScarlet, AAV2.7m8-mScarlet, and AAV2-mScarlet. These vectors were administered via intravitreal (IVT) injection at a dose of 1 × 10 per eye. 9 At 4 and 6 weeks after administration, mice were examined by in vivo autofluorescence (AF) and retinal sections to assess transduction efficiency in vivo.

[0139] The results showed that the fluorescence intensity of RC-V63 and RC-V68 was significantly higher than that of AAV2.7m8 and AAV2 ( Figure 2 Middle a).

[0140] Then, ImageJ software was used to statistically analyze the AF fluorescence intensity of the two eyes of the mice treated for 6 weeks. The statistical results are shown in Table 1 and Figure 2As shown in (bc), the average fluorescence intensity and total fluorescence intensity of RC-V63 and RC-V68 were significantly higher than those of AAV2.7m8 and AAV2.

[0141] Table 1

[0142] In order to more accurately analyze the differences in transcriptional levels of each variant, the eyes of mice treated for 6 weeks were dissected, and the retinal tissue was isolated separately. Retinal RNA was extracted and then quantitatively analyzed by QPCR (the extraction and identification methods were the same as those for retinal organoids). Figure 2 As shown in Figure d, the delivery capacity of RC-V63 and RC-V68 in the mouse retina is higher than that of AAV2.7m8 and AAV2, which are 22.4 times and 8.4 times that of AAV2, respectively, while AAV2.7m8 is only 2.3 times that of AAV2.

[0143] Taken together, the above results indicate that in in vivo mouse experiments, the transduction efficiency of RC-V63 and RC-V68 in the retina is significantly better than that of AAV2.7m8 and AAV2.

[0144] The inventors of this application also performed cryosectioning on the retinas of mice that had been given the drug for 6 weeks, labeled rhodopsin with green fluorescence, and labeled the cell nuclei with DAPI. Figure 3 As shown in the results, RC-V63 and RC-V68 exhibited significantly enhanced expression levels and tissue penetration capabilities. These two vectors are not only expressed in large quantities in the retinal ganglion cell layer (GCL) and inner nuclear layer (INL), but can also achieve efficient expression in the outer nuclear layer (ONL) nuclei. In contrast, the AAV2 vector can only be delivered to the GCL, and the expression of the target gene is very weak, and no efficient transduction of the INL layer and ONL layer was observed; and although AAV2.7m8 has a certain penetration ability, its expression intensity is significantly lower than that of RC-V63 and RC-V68. These in vivo experimental data fully demonstrate that RC-V63 and RC-V68 are significantly superior to AAV2 in terms of transduction efficiency and penetration depth of retinal tissue. AV2.7m8 and AAV2 showed stronger target protein expression levels and wider cell type coverage.

[0145] Example 5: Anti-IVIG (human immunoglobulin) neutralization ability detection During the cell preparation phase, 293T cells in the logarithmic growth phase were obtained and digested, and the cell density was adjusted to 1.2 × 10 cells using high-glucose DMEM medium containing 10% FBS. 5 cells / mL, 500 μL of cell suspension (corresponding to 6×10 4Cells were pre-cultured at 37°C, 5% CO2 for 18 hours in a 37°C, 5% CO2 incubator to reach 30-40% confluency. Subsequently, a serial dilution system for IVIG (Taibang Biotech) was established, with the IVIG to be tested serially diluted with serum-free, high-glucose DMEM at a 1:3 (v / v) ratio (100 μL of each dilution was added to 200 μL of culture medium). This generated seven serial dilutions: 3×, 9×, 27×, 81×, 243×, 729×, and 2187×. A blank control without IVIG was also included. During the viral treatment phase, 50 μL of serum-free, high-glucose DMEM was added to each AAV virus at an MOI of 2,000. After thorough mixing, 50 μL of each serial IVIG dilution was added. The mixture was then vortexed and incubated at 37°C for 1 hour (gently flicking the EP tube every 15 minutes to promote neutralization). After the neutralization reaction is completed, the original culture medium in the cell culture plate is discarded and 100 μL of virus-IVIG mixture is added to each well. The experiment needs to set up a positive control (pure virus group without IVIG) and a negative control (uninfected cell group) simultaneously. After 24 hours of infection at 37°C and 5% CO2, 500ul of high-glucose DMEM with 10% fetal bovine serum (FBS) is added to each well, and flow cytometry is performed 72 hours after infection. Different capsid viruses are uniformly packaged with CAG-mScarlet, so the fluorescence intensity of mScarlet can be used to represent the virus infection activity, and then the inhibition efficiency of IVIG on different viruses can be analyzed after normalization by the pure virus group without IVIG. The neutralization effect is expressed by ID 50 It indicates that it reflects the concentration of neutralizing antibodies corresponding to the reduction of virus activity to 50%, ID 50 The lower the value, the stronger the concentration of neutralizing antibodies required, that is, the stronger the virus's anti-neutralization ability. The test results are shown in Table 2 and Figure 4 As shown in the figure, the results of anti-IVIG neutralization ability are as follows: the inhibitory effects of IVIG from large to small are: RC-V62, AAV2.7m8, RC-V68, AAV2, RC-V63, RC-V53, that is, the anti-IVIG neutralization ability of each variant is: RC-V53>RC-V63>AAV2>RC-V68>AAV2.7m8>RC-V62.

[0146] Table 2

[0147] Note: ID 50 Refers to the 50% infectious dose.

[0148] Furthermore, the inventors packaged AAV2, AAV2.7m8, and RC-V53 / V62 / V63 / V68 separately, each with a unique DNA barcode in its genome to facilitate subsequent analysis. The six viruses were mixed at the same titer (1.1E11 vg / eye) and injected into the eyes of cynomolgus monkeys. Twenty-three days after injection, the retinas were harvested and RNA was recovered. After reverse transcription and next-generation sequencing, the DNA barcode content of the different variants was compared, allowing for a side-by-side comparison of each variant, yielding corresponding percentages and rankings. The results are shown in Table 3 below: Table 3

[0149] That is, in cynomolgus macaques, the percentage of DNA barcode content of different variants is ranked from large to small as follows: V53>V63>V62>AAV2.7m8>AAV2>V68, that is, the transcription level of the target gene of the RC-V53, RC-V62, and RC-V63 variants is much higher than that of AAV2, and higher than that of AAV2.7m8. This shows that the AAV2 variant provided by the present invention has the following three advantages: (1) High-efficiency gene delivery ability: Compared with AAV2 or AAV2.7m8, it significantly improves the transcription level of the target gene in the retina of primates (closer to human physiological structure), and can achieve more efficient and stable gene expression. (2) Excellent animal adaptability and clinical application prospects: Non-human primates represented by cynomolgus macaques are advanced animal models for the development of retinal-related diseases and gene therapy vectors. The high transduction performance of the new capsids of RC-V53, RC-V62, and RC-V63 indicates that their potential for treating human retinal diseases in future clinical transformation is superior to that of existing mainstream vectors. (3) Risk of side effects due to reduced dose: Improved expression efficiency means that the dose of AAV viral vector required to achieve the same therapeutic effect can be significantly reduced, which helps to reduce potential immune responses and toxic side effects and improve the safety margin of treatment.

[0150] The partial sequence information involved in the present invention is as follows: SEQ ID NO.1: (VP1 amino acid sequence of RC-V53) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRDPPEQRPARQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL SEQ ID NO.2: (Amino acid sequence of VP1 of RC-V62) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRETPDTRPSRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL SEQ ID NO.3: (Amino acid sequence of VP1 of RC-V6 MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRMGQPPSQARQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL SEQ ID NO.4: (Amino acid sequence of VP1 of RC-V68) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNREDPNRRREVQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL SEQ ID NO.5: (Amino acid sequence of VP1 of AAV2.7m8) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNLALGETTRPARQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL SEQ ID NO.6: (Amino acid sequence of VP1 of AAV2) MAADGYLPDWLEDTLSEGIRQWWKLKPGPPPPKPAERHKDDSRGLVLPGYKYLGPFNGLDKGEPVNEADAAALEHDKAYDRQLDSGDNPYLKYNHADAEFQERLKEDTSFGGNLGRAVFQAKKRVLEPLGLVEEPVKTAPGKKRPVEHSPVEPDSSSGTGKAGQQPARKRLNFGQTGDADSVPDPQPLGQPPAAPSGLGTNTMATGSGAPMADNNEGADGVGNSSGNWHCDSTWMGDRVITTSTRTWALPTYNNHLYKQISSQSGASNDNHYFGYSTPWGYFDFNRFHCHFSPRDWQRLINNNWGFRPKRLNFKLFNIQVKEVTQNDGTTTIANNLTSTVQVFTDSEYQLPYVLGSAHQGCLPPFPADVFMVPQYGYLTLNNGSQAVGRSSFYCLEYFPSQMLRTGNNFTFSYTFEDVPFHSSYAHSQSLDRLMNPLIDQYLYYLSRTNTPSGTTTQSRLQFSQAGASDIRDQSRNWLPGPCYRQQRVSKTSADNNNSEYSWTGATKYHLNGRDSLVNPGPAMASHKDDEEKFFPQSGVLIFGKQGSEKTNVDIEKVMITDEEEIRTTNPVATEQYGSVSTNLQRGNRQAATADVNTQGVLPGMVWQDRDVYLQGPIWAKIPHTDGHFHPSPLMGGFGLKHPPPQILIKNTPVPANPSTTFSAAKFASFITQYSTGQVSVEIEWELQKENSKRWNPEIQYTSNYNKSVNVDFTVDTNGVYSEPRPIGTRYLTRNL SEQ ID NO.7: (VP1 nucleic acid sequence of RC-V53) SEQ ID NO.8: (VP1 nucleic acid sequence of RC-V62) SEQ ID NO.9: (VP1 nucleic acid sequence of RC-V63) SEQ ID NO.10: (VP1 nucleic acid sequence of RC-V68) SEQ ID NO.11: (AAV2.7m8 nucleic acid sequence) SEQ ID NO.12: (VP1 nucleic acid sequence of AAV2) All documents mentioned in this application are incorporated herein by reference, just as if each document were incorporated herein by reference individually. It should also be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and that such equivalents also fall within the scope of the claims appended hereto.

Claims

1. An adeno-associated virus (AAV) capsid protein variant, characterized in that: The VP1 of the AAV capsid protein variant has an inserted peptide relative to the amino acid sequence of the parent AAV capsid protein VP1, the length of the inserted peptide is 9 amino acids, and its amino acid sequence differs from the sequence shown in any one of SEQ ID NOs: 29-32 by no more than 3, 2 or 1 amino acids.

2. The AAV capsid protein variant according to claim 1, wherein The amino acid sequence of the inserted peptide differs from any one of the sequences shown in SEQ ID NOs: 29-32 by no more than 1 amino acid.

3. The AAV capsid protein variant according to claim 1, wherein The amino acid sequence of the AAV capsid protein variant is selected from the group consisting of: (i) a sequence as shown in any one of SEQ ID NOs: 1-4; (ii) a sequence that has at least 95%, 96%, 97%, 98% or 99% sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1-4.

4. An isolated polynucleotide, characterized in that The polynucleotide encodes the AAV capsid protein variant according to claim 1.

5. A carrier, characterized in that The vector contains the polynucleotide according to claim 4.

6. A host cell, characterized in that The host cell contains the vector according to claim 5, or the polynucleotide according to claim 4 is integrated into its genome.

7. A recombinant adeno-associated virus (rAAV) particle, characterized in that: The rAAV particles comprise: (i) the AAV capsid protein variant of claim 1; (ii) a nucleic acid of interest packaged within the AAV capsid.

8. A method for preparing the rAAV particles according to claim 7, characterized in that: The method comprises the steps of: culturing the host cell according to claim 6 under appropriate conditions, thereby obtaining the rAAV particles.

9. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises: (a) the rAAV particle of claim 7; and (b) a pharmaceutically acceptable carrier.

10. Use of the rAAV particles according to claim 7, or the pharmaceutical composition according to claim 9, or a combination thereof in the preparation of a medicament for treating a disease; the disease is an eye disease.

Images