A strain of Pseudomonas P150 and its application
By providing protection against Pseudomonas P150 and its application, the problem of poor control efficacy in existing technologies has been solved, achieving highly efficient control of bacterial wilt and soybean spot disease, reducing the amount of chemical pesticides used, and improving plant growth performance.
Patent Information
- Application Number
- CN202511204120.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-27
- Publication Date
- 2025-11-14
- Estimated Expiration
- 2045-08-27
AI Technical Summary
Existing anti-pseudomonas bacteria are not very effective in controlling bacterial wilt and soybean spot disease, and their limited functionality makes them difficult to meet the needs of comprehensive solutions in modern agriculture.
A strain of Pseudomonas aeruginosa P150, with the preservation number CGMCC No.34520, was provided. The bacterial solution was prepared by fermentation culture and applied to inhibit various pathogens, produce enzymes, and promote plant growth. Specific applications include the prevention and control of bacterial wilt in tomatoes and spotted rot in soybeans.
The control efficacy of Pseudomonas P150 against bacterial wilt and soybean spot disease reached 73.33% and 77.64% respectively, reducing the use of chemical pesticides. It is green and pollution-free and has good promotion value.
Smart Images

Figure CN120699853B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biocontrol technology, and in particular to a strain of Pseudomonas P150 for defense and its application. Background Technology
[0002] Soil-borne crop diseases refer to diseases caused by pathogens such as fungi, bacteria, nematodes, and viruses that live in the soil with diseased plant debris and attack crops through the roots or stems when conditions are suitable. These diseases are a significant factor restricting agricultural production. Biological control refers to the use of beneficial organisms and their metabolites to control plant diseases. Compared with chemical control, it is green and safe, less prone to resistance development, and highly selective. Therefore, the use of biocontrol microorganisms for plant disease control is gradually attracting attention, and a large amount of related research has been conducted both domestically and internationally, showing broad development prospects.
[0003] Defense against Pseudomonas ( Pseudomonas protegens Rhizosphere microorganisms (Pseudomonas) are one of the main groups of plant rhizosphere growth-promoting microorganisms. They have simple nutritional requirements, rapid proliferation, and strong rhizosphere colonization. They not only produce various antibacterial active substances but also secrete metabolic substances that promote crop growth. Currently, scholars both domestically and internationally have isolated several strains of Pseudomonas, but their antibacterial effects are poor. Their control efficacy against bacterial wilt is not high, generally ranging from 40% to 70%. For example, the invention patent application number "202310189115.9," entitled "A Pseudomonas and its Application," discloses a strain of Pseudomonas with a control efficacy of 61.46% against tobacco bacterial wilt. Furthermore, most Pseudomonas strains have limited functions, making it difficult to meet the demands of modern agriculture for integrated solutions. Summary of the Invention
[0004] In view of this, the present invention provides a strain of Pseudomonas aeruginosa P150 and its application. The Pseudomonas aeruginosa P150 of the present invention has a relatively stable and good control effect on bacterial wilt, with a control efficacy of 73.33%. Furthermore, the Pseudomonas aeruginosa P150 has a control efficacy of 77.64% against soybean spot disease. It also has multiple functions such as enzyme production and growth promotion, providing a new microbial resource for modern agriculture.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] This invention provides a strain of Pseudomonas P150, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34520, deposited on May 13, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
[0007] The present invention provides a method for preparing the bacterial culture of the defensive Pseudomonas P150, wherein the defensive Pseudomonas P150 is inoculated into a fermentation medium for fermentation culture to obtain the bacterial culture.
[0008] Preferably, the fermentation culture temperature is 28~32℃ and the rotation speed is 180~220 rpm.
[0009] The present invention also provides the application of the described defense against Pseudomonas P150 in any one or more of the following:
[0010] (1) Application in inhibiting pathogens;
[0011] (2) Application in the prevention and control of bacterial wilt in tomatoes;
[0012] (3) Application in the prevention and control of soybean spot disease;
[0013] (4) Application in promoting plant growth;
[0014] (5) Application in the preparation of bacterial agents that inhibit pathogens;
[0015] (6) Application in the preparation of inoculants for the prevention and control of bacterial wilt in tomatoes;
[0016] (7) Application in the preparation of inoculants for the prevention and control of soybean spot disease;
[0017] (8) Application in the preparation of microbial agents that promote plant growth;
[0018] (9) Application in the preparation of enzyme preparations.
[0019] Preferably, the pathogenic bacteria include oomycetes, fungi, and bacteria; the oomycetes include *Phytophthora capsici*, and the fungi include *Fusarium oxysporum*. Fusarium oxysporum Verticillium dahliae Verticillium dahliae Fusarium oxysporum ( ), Fusarium oxysporum Fusarium fujikuroi ) and / or gray mold ( Botrytis cinerea The pathogenic bacteria include *Lauroceras sorbifolium* (of the Solanaceae family). Ralstonia solanacearum ) and / or citrus xanthomonocytes-mediated soybean pathogens ( Xanthomonas axonopodis pv. glycines ).
[0020] Preferably, the plants include tomatoes and soybeans.
[0021] Preferably, the enzyme preparation includes protease and / or amylase.
[0022] The present invention also provides a microbial inoculant comprising a bacterial suspension of the aforementioned strain of Pseudomonas P150, wherein the effective viable count in the bacterial suspension is 0.8~1.2×10⁻⁶.9 CFU / mL.
[0023] The present invention also provides a method for promoting plant growth by spraying the plants with the aforementioned microbial agent.
[0024] Preferably, the plants include tomatoes and soybeans.
[0025] By adopting the above technical solution, the present invention has the following beneficial effects: The protective *Pseudomonas* P150 of the present invention is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34520, deposited on May 13, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The protective *Pseudomonas* P150 of the present invention has the effects of inhibiting various pathogens, producing enzymes, promoting growth, and controlling bacterial wilt of tomatoes and spotted leaf spot of soybeans. The inoculant prepared using this biocontrol bacterium can reduce the amount of chemical pesticides used, lower the cost of plant disease control, and is green and pollution-free. It can be used in the control of bacterial wilt of tomatoes and spotted leaf spot of soybeans, and has good promotional value. Attached Figure Description
[0026] Figure 1 To protect against the colony morphology of Pseudomonas P150.
[0027] Figure 2 Taxonomic map of strains defending against Pseudomonas P150 based on multi-gene tandem analysis.
[0028] Figure 3 To defend against the enzyme-producing characteristics of Pseudomonas P150 strain.
[0029] Figure 4 The diagram shows the inhibitory effect of Pseudomonas P150 bacterial suspension on pathogens.
[0030] Figure 5 The diagram shows the inhibitory effect of Pseudomonas P150 bacterial suspension on Solanaceae Raulella and Citrus Xanthomonas aurantiacus, a pathogenic soybean strain.
[0031] Figure 6 To prevent the growth-promoting effect of Pseudomonas P150 bacterial solution on soybeans.
[0032] Figure 7 To prevent the growth-promoting effect of Pseudomonas P150 bacterial solution on tomatoes.
[0033] Figure 8 The effect of using Pseudomonas P150 bacterial solution to control bacterial wilt in tomatoes.
[0034] Figure 9 The effect of using Pseudomonas P150 bacterial suspension to control soybean spot disease.
[0035] Instructions for Preservation of Microbial Strains
[0036] The present invention classifies and names the P150 defensive pseudomonads. Pseudomonas protegens It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34520, deposited on May 13, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Detailed Implementation
[0037] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0038] The KB fermentation medium in this embodiment of the invention was prepared as follows: 20 g / L tryptone, 1.5 g / L dipotassium hydrogen phosphate (K2HPO4·H2O), 1.5 g / L magnesium sulfate heptahydrate (MgSO4·7H2O), 10 g / L glycerol, and 1000 mL sterile water, with a pH of 7.0, and sterilized at 121°C for 20 min.
[0039] Example 1
[0040] 1. Isolation and purification of strain P150
[0041] The *Pseudomonas* P150 strain used in this invention was isolated from grape leaves of the Yongbin Farm vineyard in Houbai Town, Jurong City, Jiangsu Province. The strain was isolated using a serial dilution method, and the specific steps are as follows:
[0042] Randomly select healthy grape leaves, first use a cotton swab dipped in 0.1% Tween to brush the healthy leaves three times, put the cotton into 1mL of sterile PBS buffer, add 1mL of glycerol, and mix well with a pipette to obtain a microbial sample, which is stored at -80℃ for later use.
[0043] Prepare LB, 0.1×TSB, TYG, YEM, M408, M715, and TWYE solid culture media. Sterilize in an autoclave (121℃, 20 min) and pour into plates for later use. Take the above microbial samples and gently pipette to mix them, thus preparing the stock solution. Serially dilute the stock solution with sterile 1×PBS buffer, and take three dilution gradients (10-10). -1 10 -2 10 -3 The diluted bacterial suspension was spread onto the above-mentioned culture media, with three replicates for each concentration gradient of the seven culture media. The spread plates were inverted and incubated in a 30°C incubator for 3-4 days. The plates were then streaked and purified. The purified bacterial strains were stored in a 4°C refrigerator.
[0044] Select single bacteria from the above culture and incubate them in KB liquid medium at 30°C and 200 rpm for 24 h. Mix the bacterial culture with 60% glycerol at a 1:1 ratio, store in liquid nitrogen, and then store at -80°C.
[0045] 2. Identification of strain P150
[0046] (1) Microbiological characteristics
[0047] The obtained strain was inoculated onto KB medium plates and cultured at 30°C for 2 days. Colony characteristics were then observed, such as... Figure 1 As shown. Single colonies of this strain are round, milky white, and opaque, measuring 2-3 mm in size. They have a smooth, moist surface, regular edges, and a slightly raised center. Some colonies develop a clear biofilm around their periphery. Gram-negative, it exhibits typical Pseudomonas characteristics.
[0048] (2) Molecular biological characteristics
[0049] Single colonies were picked and placed in a 1.5 mL centrifuge tube containing 1 mL of KB medium. The culture was shaken at 30 °C and 200 rpm for 24 h. Using the bacterial culture as a template, the 16S rRNA sequence was amplified using universal primers 27F / 1492R.
[0050] The PCR amplification reaction system consisted of 50 μL of 2xTaq enzyme, including 25 μL of 27F primer, 1 μL of 1492R primer, 1 μL of bacterial culture, and 22 μL of ddH2O. Amplification conditions were as follows: 95℃ pre-denaturation for 10 min, 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min, 32 cycles, followed by a final extension at 72℃ for 5 min. The amplified products were stored at 4℃. The amplified products were separated and identified by 1% agarose gel electrophoresis, and the PCR products were sent to Beijing Qingke Biotechnology Co., Ltd. for bidirectional sequencing. The 16S rDNA of strain P150 is shown in SEQ ID NO: 1 below, containing three housekeeping genes. rpoB , rpoD , gyrB The sequences are shown as SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, respectively.
[0051] >16S rDNA:
[0052]
[0053] >rpoB:
[0054] TTCAGTTCAAATGGCCAGAACAACCCGCTGTCCGAGATCACCCACAAGCGTCGTGTTTCTGCACTTGGCCCAGGTGGTCTGACCCGTGAGCGTGCAGGCTTCGAAGTCCGTGACGTACACCCGACCCACTACGGTCGTGTATGCCCGATTGAAACGCCGGAAGGTCGAACATCGGTCTGATCACACTCCTGGCGGCCTATGCGCGCACAACCAGTACGGCTTCCTGAGAGCCGCTACCGTGTGGTGAAGGACGCTC TGGTAACCGACGAGATCGTGTTCCTGTCCGCTATCGAAGAGGCCGATCACGTGATCGCCCAGGCTTCGGCGACCATGAACGACAAAGGTCAGTTGGTCGATGAGCTGGTAGCTGTTCGTCACTTGAACGAATTCACCGTCAAGGCGCCGGAAAGACGTCACCTTGATGGACGTTTCGCCGAAGCAGGTAGTTTCGGTCGCAGCGTCGGATTCCGTTCCTCGAGCACGACGCCAACCGCGTTGATGGGA (SEQ ID NO:2).
[0055] >rpoD:
[0056] ACTAACGTTCGAGAGGGTATCCGTGAAGTGATGGGCGCAATCGCGCACTTCCCTGGCACGGTTGATCACATCCTCTCCGAGTACACTCGCGTCACCACCGAAGGTGGACGCCTGTCCGACGTTCTCAGCGGGTACATCGACCCGGATGACGGCATTACGCCGCCTGCCGCCGAAGTGCCACCGCCTGTCGACACCAAGACCGCGAAAGCGGATGACGACAGCGAAGACGAAGAAGCGGAAGCGACCGAAGACGAAGAAGAAGCCGAAAGCGGTCCGGATCCGGTCATCGCCGCACAGCGCTTTGGCGCCGTCGCCGACCAGATGGAAGTCACCCGCAAGGCGCTGAAGAAACACGGCCGCGAGAACAAGCAAGCCATCGCCGAAATGCTGGCCCTGGCTGAACTGTTCATGCCGATCAAACTGGTTCCGAAGCAATTCGAAGGCCTGGTTGAACGTGTACGCAGTGCCCTGGATCGCCTGCGCCAGCAGGAACGCGCCATCATGCAGCTCTGCGTGCGTGATGCCCGCATGCCACGTGCCGACTTCCTGCGCCAGTTCCCGGGCAACGAAGTGGATGAAAGCTGGACCGACGCCCTGGCCAAAGGCAAGAGCAAGTACGCCGAAGCCATCGCCCGCCTGCAGCCGGACATCATCCGTTGCCAGCAGAAGCTGACCGCTCTTGAAGTCGAAACCGGCTTGAAGATCGCCGAGATCAAGGACATCAACCGTCGCATGTCGATCGGTGAGGCCAAGGCCCGCCGCGCGAAGAAAGAGATGGTCGAAGCCAACCTGCGTCTGGTGATCTCCATCGCCAAGAAGTACACCAACCGGTCATGCATATAGTCTAC(SEQ ID NO:3).
[0057] >gyrB:
[0058]
[0059] BLAST homology alignment of the 16S rDNA sequence showed that this strain was similar to *Pseudomonas aeruginosa*. Pseudomonas protegens The similarity was 99.86%. The three housekeeping gene sequences obtained from sequencing were spliced together to construct a sequence library. A phylogenetic tree was constructed using the Neighbor-Joining (NJ) method with MEGA 6.0 software. All component sequences of the sequence library were derived from the NCBI gene database. The position of strain P150 in the constructed library is shown below. Figure 2 As shown, this strain was named *Pseudomonas leukemia* P150.
[0060] Example 2. Enzyme production characteristics of Pseudomonas P150 strain.
[0061] The ability of the Pseudomonas aeruginosa P150 strain to produce various extracellular hydrolases was detected by agar plate colorimetric assay. Qualitative detection of protease production was performed on skim milk agar plates. A 0.15 g / mL stock solution of skim milk powder was prepared and added to KB solid medium at a concentration of 2%. After solidification, 2 µL of P150 bacterial suspension was added to the agar plate, with KB liquid medium as a blank control. After the bacterial suspension was dried, it was incubated at 30℃ for 24 h, and the presence of a clear hydrolysis zone around the cells was observed. The appearance of a clear hydrolysis zone indicated protease production; the absence of a clear hydrolysis zone indicated the inability to produce the corresponding enzyme. The activities of cellulase and amylase produced by this strain were detected using CMC-Na and starch agar media, respectively. 2 µL of bacterial suspension was added dropwise to the corresponding agar plates and incubated at 30 °C for 24 h. Gram staining was then performed, and the plates were left in the dark for 5 min. The surface stain was then removed. The appearance of a clear hydrolysis zone around the bacterial cells indicated that the strain could produce the corresponding enzyme. Plate results showed that the Pseudomonas aeruginosa P150 strain possessed protease and amylase activities. Figure 3 As shown.
[0062] Example 3. Antibacterial properties against Pseudomonas P150 strain
[0063] Preparation method of Pseudomonas aeruginosa P150 fermentation broth: Pseudomonas aeruginosa P150 strain was inoculated into KB liquid medium and cultured at 30℃ and 200 rpm for 12 h with shaking. The OD of the broth was measured using a UV spectrophotometer. 600 Value, up to OD 600 Fermentation was stopped at 1.0. Measurements showed that the number of viable bacteria in the fermentation broth at this point was approximately 1 × 10⁻⁶. 9 CFU / mL was used to obtain a fermentation broth that defends against Pseudomonas P150.
[0064] The inhibitory activity of bacterial suspensions containing *Pseudomonas aeruginosa* P150 against pathogenic oomycetes, fungi, and bacteria was determined using the plate confrontation method. *Phytophthora capsici* was selected as the pathogenic oomycete. Phytophthora capsici ), pathogenic fungus Fusarium oxysporum ( Fusarium oxysporum Verticillium dahliae Verticillium dahliae Fusarium oxysporum ( ), Fusarium oxysporum Fusarium fujikuroi ) and gray mold ( Botrytis cinerea ), pathogenic bacteria Raulella solanaceae ( Ralstonia solanacearum ) and citrus xanthomonocytes in soybean pathogens ( Xanthomonas axonopodis pv. glycines The assay method was the plate confrontation method. For oomycetes and fungi, the assay method was as follows: a 1 cm diameter bacterial dish was placed in the center of a PDA plate, and 5 μL of Pseudomonas suspension (OD) was added 2 cm away from it. 600 =1.0); the bacterial assay method is as follows: mix 1‰ of the pathogenic bacteria into the NA plate, and add 5 μL of Pseudomonas P150 bacterial suspension (OD) to the plate. 600 =1.0), the result is as follows Figure 4 , Figure 5 As shown in Table 1.
[0065] Table 1. Inhibitory effect of P150 bacterial suspension on pathogenic fungi and oomycetes.
[0066]
[0067] The test results showed that the bacterial suspension of strain P150 had a good inhibitory effect on four pathogenic fungi: Botrytis cinerea, Fusarium oxysporum, Verticillium dahliae, and Fusarium truncatum, as well as the pathogenic oomycete Phytophthora capsici, the pathogenic bacteria Raulella solanaceae, and Xanthomonas citrus, a pathogenic soybean pathogen.
[0068] Example 4. Growth-promoting experiment against Pseudomonas P150 strain
[0069] The preparation method of the Pseudomonas P150 bacterial suspension used in this embodiment is the same as that in Example 3.
[0070] 1. The growth-promoting effect of Pseudomonas p150 on soybeans
[0071] Soybean seeds with plump grains, intact seed coats, and uniform size were selected and placed in seedling trays. After germination at 25℃ for 3 days, they were transplanted into individual petri dishes, divided into a control (CK) group and a treatment group, with 3 pots per group and one soybean seedling per pot, and 3 replicates per group. Seven days after transplanting, the treatment group was treated with 10 mL of a bacterial solution for protection against Pseudomonas p. 150 once, while the control group was treated with an equal volume of KB culture solution. Fourteen days after root drenching, plant height, root length, fresh weight, and dry weight were measured. The results are shown in Table 2. Figure 6 As shown.
[0072] Table 2. Growth-promoting effects of Pseudomonas P150 bacterial suspension on soybean plants
[0073]
[0074] The results showed that soybean seedlings treated with Pseudomonas aeruginosa P150 bacterial solution exhibited better growth. Biomass measurements indicated that, compared with the control group, the soybean plants in the treatment group had a 64.93% increase in plant height, a 50% increase in root length, a 103.36% increase in fresh weight, and a 64.47% increase in dry weight. All of these indicators were significantly higher than the control, indicating that Pseudomonas aeruginosa P150 bacterial solution can promote the aboveground growth and root development of soybean plants, thereby improving their growth performance.
[0075] 2. The growth-promoting effect of Pseudomonas p150 on tomatoes
[0076] Tomato seeds with plump kernels, intact seed coats, and uniform size were selected and placed in seedling trays. After germination at 25℃ for 3 days, the seeds were transplanted into individual petri dishes, divided into a control (CK) group and a treatment group, with 3 pots per group, 1 plant per pot, and 3 replicates per group. Three weeks after transplanting, the treatment group was treated with 10 mL of Pseudomonas aeruginosa P150 bacterial solution per pot for root drenching once, while the CK group was treated with an equal volume of KB culture solution for root drenching. After five weeks of cultivation, the plant height, root length, fresh weight, and dry weight of the tomato plants were measured. The results are shown in Table 3. Figure 7 As shown.
[0077] Table 3. Growth-promoting effects of Pseudomonas P150 bacterial suspension on tomato plants
[0078]
[0079] The results showed that tomato seedlings treated with Pseudomonas aeruginosa P150 bacterial solution grew better. Biomass measurements showed that, compared with the control group, the tomato plants in the treatment group had increased plant height by 47.88%, root length by 21.98%, fresh weight by 46.98%, and dry weight by 49.49%. All of these indicators were significantly higher than those of the control, indicating that Pseudomonas aeruginosa P150 bacterial solution can promote the aboveground growth and root development of tomato plants and improve their growth performance.
[0080] Example 6. Biocontrol characteristics against Pseudomonas P150 strain
[0081] The preparation method of the Pseudomonas aeruginosa P150 fermentation broth used in this embodiment is as follows: Pseudomonas aeruginosa P150 strain is inoculated into KB liquid medium and cultured with shaking at 30°C and 200 rpm until the effective viable count reaches 1 × 10⁻⁶. 9 CFU / mL.
[0082] Single colonies of *Raulella solanaceae* FJAT1458 were picked and placed in NB liquid medium. After incubation at 30°C and 200 rpm on a horizontal shaker for 36 h, the cells were collected by centrifugation at 5000 rpm for 10 min, resuspended in sterile water, and the concentration was adjusted to 1×10⁻⁶. 6 CFU / mL available for use.
[0083] Single colonies of *Xanthomonas citrus* pathogenic to soybean were picked and placed in NB liquid medium. After incubation at 30°C and 200 rpm on a horizontal shaker for 36 h, the bacterial cells were collected by centrifugation at 5000 rpm for 10 min, resuspended in sterile water, and the concentration was adjusted to OD0.05. 600 =2.0 spare.
[0084] 1. The protective effect of Pseudomonas p150 against bacterial wilt in tomato
[0085] Healthy tomato seeds were selected, sterilized, and sown in seedling trays. After one month of growth, uniformly growing tomato seedlings were transplanted into identical petri dishes, one seedling per dish. The seedlings were then divided into two groups: a control group and a treatment group. Each group consisted of 5 pots, with 3 replicates, and the plants were incubated at 37℃. The treatment group was irrigated with a bacterial solution containing 10 mL of bacterial solution with an effective viable bacteria count of 1×10⁻⁶. 9 The control group was treated with the same volume of KB culture medium, and the P150 fermentation broth (CFU / mL) was used to treat the P150 fermentation broth. One day later, the prepared *Rauvolfia solanaceae* broth was diluted 10 times and applied to both the control and treatment groups, 10 mL per pot. The incubation was continued for 10 days, and the disease occurrence was investigated and statistically analyzed. The results are shown in Table 4. Figure 8 As shown.
[0086] The grading standards for bacterial wilt of tomatoes are as follows:
[0087] Grade 0: The tomato plants are growing vigorously, with no wilted or dead diseased leaves present;
[0088] Grade 1: One leaf wilts;
[0089] Grade 2: 2-3 leaves show signs of wilting;
[0090] Level 3: Except for the top 2-3 leaves, all other leaves on the plant wilt.
[0091] Level 4: The entire plant is completely wilted or dead.
[0092] Disease index = ∑(Number of plants at each level × Corresponding level number) / (Total number of plants × Highest level number) × 100
[0093] Prevention and control effect = (disease index of control group - disease index of treatment group) / disease index of treatment group × 100%.
[0094] Table 4. Control effect of P150 bacterial suspension on bacterial wilt of tomato.
[0095]
[0096] As shown in Table 4, P150 can significantly reduce the incidence of bacterial wilt in tomatoes, with a control effect of 73.33%, indicating that the P150 anti-pseudomonas P150 of the present invention can control bacterial wilt in tomatoes.
[0097] 2. The protective effect of Pseudomonas p150 against soybean spot disease
[0098] Select soybean seeds of uniform size, disinfect them, and sow them in seedling trays. After germination at 25℃ for 3 days, transplant them into identical petri dishes, one seedling per dish. Divide the soybean seedlings into a control group and a treatment group, with 8 pots in each group and 3 replicates. 14 days after transplanting, use OD... 600 A solution of 2.0 g of *Xanthomonas citrinum*, a pathogenic bacterium in soybeans, was evenly sprayed onto the surface of soybean leaves until the leaves were dripping wet. One day later, the treatment group was treated with a solution containing 1 × 10⁻⁶ viable bacteria. 9 A CFU / mL solution of *Pseudomonas aeruginosa* P150 was sprayed evenly onto soybean leaves once, until the leaves were dripping wet. The control group was sprayed with an equal volume of KB culture solution. After 10 days of incubation, the incidence of soybean diseases was investigated and statistically analyzed. The results are shown in Table 5. Figure 9 As shown.
[0099] The grading criteria for soybean spot disease are as follows:
[0100] Grade 0: The soybean plants are growing vigorously and there are no disease spots.
[0101] Grade 1: Leaf lesions cover less than 5% of the total leaf area;
[0102] Grade 2, with leaf lesions covering 6% to 10% of the total leaf area;
[0103] Grade 3, with leaf lesions covering 11% to 15% of the total leaf area;
[0104] Grade 4, with lesions covering 16% to 20% of the total leaf area.
[0105] Level 5, with leaf lesions covering more than 20% of the total leaf area.
[0106] Disease index = ∑(number of leaves at each level × corresponding level number) / (total number of leaves surveyed × highest level number) × 100
[0107] Prevention and control effect = (disease index of control group - disease index of treatment group) / disease index of treatment group × 100%.
[0108] Table 5. Control efficacy of Pseudomonas P150 bacterial suspension against soybean spot disease.
[0109]
[0110] As shown in Table 5, the protective Pseudomonas P150 can significantly reduce the incidence of soybean spot disease, with a control effect of 77.64%, indicating that the protective Pseudomonas P150 of the present invention can prevent and control soybean spot disease.
[0111] As can be seen from the above embodiments, the present invention provides a strain of Pseudomonas aeruginosa P150 and its application. The Pseudomonas aeruginosa P150 of the present invention has multiple functions such as enzyme production, disease prevention, and growth promotion.
[0112] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A strain of defensive pseudomonads ( Pseudomonas protegens P150, characterized in that, It is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34520, deposited on May 13, 2025, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.
2. The method for preparing the bacterial suspension for defense against Pseudomonas P150 as described in claim 1, characterized in that, The aforementioned Pseudomonas 150 was inoculated into a fermentation medium for fermentation culture to obtain the bacterial solution.
3. The preparation method according to claim 2, characterized in that, The fermentation culture temperature is 28~32℃, and the rotation speed is 180~220 rpm.
4. The use of the defense against Pseudomonas P150 as described in claim 1 in any one or more of the following: (1) Application in inhibiting pathogens; (2) Application in the prevention and control of bacterial wilt in tomatoes; (3) Application in the prevention and control of soybean spot disease; (4) Application in promoting plant growth; (5) Application in the preparation of bacterial agents that inhibit pathogens; (6) Application in the preparation of inoculants for the prevention and control of bacterial wilt in tomatoes; (7) Application in the preparation of inoculants for the prevention and control of soybean spot disease; (8) Application in the preparation of microbial agents that promote plant growth; (9) Application in the preparation of enzyme preparations; The pathogen is *Phytophthora capsici* (… Phytophthora capsici Fusarium oxysporum ( Fusarium oxysporum Verticillium dahliae Verticillium dahliae ), Fusarium oxysporum ( Fusarium fujikuroi ) and gray mold ( Botrytis cinerea ), Solanaceae Raulella ( Ralstonia solanacearum ) and citrus xanthomonocytes in soybean pathogens ( Xanthomonas axonopodis pv. glycines ); The plants are tomatoes and soybeans; The enzyme preparation is a protease and / or an amylase.
5. A microbial inoculant, characterized in that, The microbial agent comprises a bacterial suspension of the strain of Pseudomonas P150 as described in claim 1, wherein the effective viable count in the bacterial suspension is 0.8~1.2×10⁻⁶. 9 CFU / mL.
6. A method for promoting plant growth, characterized in that, The microbial agent according to claim 5 is used to treat plants by root irrigation and spraying; the plants are tomatoes and soybeans.
Citation Information
Patent Citations
Defense pseudomonas and application thereof
CN117025436A
Pseudomonas sp. and application thereof in prevention and control on bacterial wilt of solanaceae crops
CN112522136A
Defense pseudomonas BWT8-8 and application thereof in prevention and control of plant diseases and insect pests
CN117286046A