Oligonucleotide group for miRNA joint detection

Abstract

The invention relates to the field of molecular biological detection, in particular to an oligonucleotide group for detecting miRNA (micro Ribonucleic Acid), which is characterized in that the specificity of real-time detection is improved through the combination of first oligonucleotide and second oligonucleotide; the two specific sequences effectively improve the detection sensitivity; the third oligonucleotide can be flexibly adjusted in a design region according to the sequence difference between miRNAs to be detected, so that the detection specificity is improved; a two-step tailing method is integrated into a one-step tailing method, so that the operation steps are simplified, and the detection time is saved; multiple mature miRNAs can be detected in one tube at the same time only through one-time PCR detection, the detection time is shortened, and the detection efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the field of molecular biological detection, in particular, to an oligonucleotide group for detecting miRNA, and more particularly, to an oligonucleotide group for joint detection of miRNA, a kit and a detection method using the same. Background Art

[0002] MicroRNA (miRNA) is a highly conserved, endogenous, noncoding, single-stranded small RNA molecule widely found in eukaryotes. It is approximately 22 bases in length and is produced by cleavage of a longer double-stranded miRNA precursor (pre-miRNA) by the ribonuclease III Dicer. miRNAs regulate gene expression post-transcriptionally by specifically binding to target messenger RNA (mRNA) and degrading or inhibiting its translation. Due to their powerful regulatory functions, abnormal miRNA expression levels are considered biomarkers for a variety of diseases, including cancer, neurodegenerative diseases (and central nervous system damage), diabetes, cardiovascular disease, kidney disease, liver disease, and even immune dysfunction. Therefore, miRNAs have important applications in both scientific research and clinical diagnosis.

[0003] In recent years, miRNAs have been detected in body fluids such as blood, urine, and saliva, and the concept of circulating free miRNAs has been proposed. Because they are often bound to proteins, mature miRNAs are very stable in body fluids, with a half-life of approximately 15 days. Furthermore, the ease of obtaining body fluid samples, their high clinical operability, and minimal invasiveness make miRNAs promising potential non-invasive biomarkers for human disease.

[0004] Currently, there are multiple methods for detecting miRNAs, including high-throughput RNA sequencing, microarrays, and RT-qPCR. Sequencing and microarrays offer advantages in high-throughput miRNA analysis, enabling the discovery of novel miRNAs or the identification of differentially expressed disease-associated miRNAs. However, these methods are not suitable for routine use. For diagnostic purposes, the most promising method remains the gold standard, RT-qPCR. Currently, the commonly used RT-qPCR methods are ployA tailing and stem-loop reverse transcription.

[0005] The ployA tailing method first uses ployA polymerase to add a ployA tail to the 3' end of the miRNA. Reverse transcription is then performed using an oligo(dT) primer containing an adapter sequence at the 5' end. The adapter is added to the first-strand cDNA, which serves as a universal reverse primer sequence, and amplified with a forward primer specific for the miRNA sequence. This method has the advantages of being simple and rapid, and can simultaneously perform batch detection of multiple miRNAs. However, while the use of universal primers reduces detection costs, it also reduces detection specificity and sensitivity, making it particularly difficult to distinguish miRNAs with small sequence differences within the same family.

[0006] The stem-loop reverse transcription method uses a reverse transcription primer with a stem-loop structure. Its 3' end has six bases that complement the miRNA and the 5' end contains a stem-loop structure, which helps the miRNA bind to its single-stranded DNA and prevents interference between pri-miRNA and pre-miRNA. In the qPCR reaction, the stem-loop structure opens, and two primers bind to the opened stem-loop structure: one primer binds to the common sequence on the stem-loop primer, and the other specific primer binds to the corresponding miRNA sequence. Because both the reverse transcription primer and the qPCR primer have regions that specifically bind to miRNA, this method is highly specific and low-cost. However, because the complementary pairing fragment of the reverse transcription primer is short and prone to nonspecific binding, it can only detect one specific miRNA at a time.

[0007] In addition, the current scientific research kits or clinical detection products for miRNA detection all use a step-by-step method of reverse transcription and qPCR amplification. Although RNA one-step amplification is widely used in clinical testing, miRNA one-step amplification is not popular. The main reason is that its fragments are too short (20nt-25nt). When using conventional RNA one-step amplification, non-specific amplification will be amplified; and the circulating miRNA content itself is very low, and one-step amplification will lose sensitivity. Therefore, the two-step method is still the first choice for miRNA detection. However, the two-step amplification operation takes a long time, and the opening of the lid for pipetting increases the possibility of contamination, which cannot meet clinical needs.

[0008] In summary, there is a demand for simultaneous one-step mixed detection of multiple miRNAs, which can detect multiple miRNAs in a single tube without opening the lid in the middle, so as to reduce contamination and operation time, while ensuring the specificity and sensitivity of the detection. Summary of the Invention

[0009] In view of this, a first aspect of the present invention provides an oligonucleotide set for miRNA detection, the oligonucleotide set comprising:

[0010] A first oligonucleotide composition, comprising:

[0011] a first oligonucleotide comprising a first universal sequence and a first specific sequence, wherein the first specific sequence is complementary to 10-15 bases at the 5' end of the first miRNA to be detected;

[0012] a second oligonucleotide comprising a second universal sequence and a second specific sequence, wherein the second specific sequence is complementary to 6-10 bases at the 3' end of the first miRNA to be detected; and

[0013] The third oligonucleotide comprises 4 to 8 bases at the 3' end of the first universal sequence and / or 4 to 8 bases at the 5' end of the second universal sequence and the first miRNA sequence to be detected.

[0014] Further, in some specific embodiments, the oligonucleotide set includes:

[0015] A first oligonucleotide composition, comprising:

[0016] a first oligonucleotide comprising a first universal sequence and a first specific sequence, wherein the first specific sequence is complementary to 10-15 bases at the 5' end of the first miRNA to be detected;

[0017] a second oligonucleotide comprising a second universal sequence and a second specific sequence, wherein the second specific sequence is complementary to 6-10 bases at the 3' end of the first miRNA to be detected;

[0018] The third oligonucleotide is designed to include, from the 5' end to the 3' end, 4-8 bases of the 3' end of the first universal sequence, the first miRNA sequence to be detected, and the 5' end 4-8 bases of the second universal sequence.

[0019] When designing the first and second oligonucleotide groups for detecting miRNA, in addition to considering the usual specifications, it is also necessary to consider the specificity, conservation and Tm value of the designed fragment. Specificity refers to the degree of dissimilarity between the designed fragment sequence and other existing nucleic acid sequences (it will not undergo non-specific binding with other oligonucleotides and known miRNA mature sequences). Conservation refers to the consistency of the designed fragment sequence in the target to be detected. The Tm value of the first oligonucleotide is usually 68-78°C, which is about 10°C higher than that of the second oligonucleotide. Among the limited target sequences, there are often few sequences that meet the above requirements.

[0020] When designing a third oligonucleotide for miRNA detection, in addition to considering common specifications, it is also important to consider the Tm value of the designed fragment. The Tm values ​​of the second and third oligonucleotide sets are generally between 58-68°C, and the difference should be as small as possible to reduce the occurrence of primer dimers.

[0021] The present invention improves the specificity of real-time detection by combining the first and second oligonucleotides; the two specific sequences effectively improve the sensitivity of detection; the third oligonucleotide can be flexibly adjusted within the designed region according to the sequence differences between the miRNAs to be tested, thereby improving the specificity of detection; by integrating the two-step tailing method into a one-step tailing method, the operation steps are simplified and the detection time is saved; and it is achieved that only one PCR test is required to simultaneously detect multiple mature miRNAs in a single tube, shortening the detection time and improving the detection efficiency.

[0022] In some specific embodiments, the first universal sequence can be GTTGATTCCTAATGTTGTCTATGATCACGTCTACACCACAGCACAGTCTAACGACCATCAGCATCGCGTT or

[0023] CGCGCATTTCGCCAACATACATGTTGGGCTAATTGGCCTGCACATTAATCTCGCC, the maximum number of replacement bases allowed is 15bp.

[0024] In some specific embodiments, the second universal sequence may be CGCACCCTGCACTGGATGACTC or GACGCTGTCGACCTGCCTA, and the maximum number of replacement bases allowed is 6 bp.

[0025] The first and second universal sequences can be adaptively adjusted according to the sequence of the specific RNA to be detected to avoid the possibility of non-specific hybridization.

[0026] In some specific embodiments, the miRNA to be detected is the mature sequence of the miRNA to be detected.

[0027] In some specific embodiments, the first specific sequence is complementary to the first 15, first 14, first 13, first 12, first 11, first 10, or first 9 bases at the 5' end of the miRNA to be detected.

[0028] In some specific embodiments, the second specific sequence is complementary to the last 6, 7, 8, 9 or 10 bases at the 3' end of the miRNA to be detected.

[0029] In some specific embodiments, the first specific sequence is complementary to 10-13 bases at the 5' end of the miRNA to be detected; and the second specific sequence is complementary to 6-9 bases at the 3' end of the miRNA to be detected.

[0030] When the base lengths of the first region and the second region are within this range, the sensitivity and accuracy are higher.

[0031] In some specific embodiments, the fluorescent group and the quencher group can be labeled at the 5' end of the sequence and at any region in the middle of the sequence, respectively. More preferably, the fluorescent group and the quencher group are at least 5 bases apart.

[0032] In some specific embodiments, the oligonucleotide is 15-50 bases in length.

[0033] The type of fluorescent group used is not limited, including but not limited to FAM, HEX, VIC, ROX, CY3, CY5, etc.

[0034] The type of quenching group used is not limited, including but not limited to BHQ series, TAMRA, MGB, etc.

[0035] In some specific embodiments, in addition to conventional oligonucleotides, unconventional or non-natural nucleotides, such as LNA, PNA, etc., can be used at any position of any of the above oligonucleotides.

[0036] In some specific embodiments, an oligonucleotide set for miRNA detection is provided, the oligonucleotide set comprising:

[0037] A first oligonucleotide composition, comprising:

[0038] a first oligonucleotide comprising a first universal sequence and a first specific sequence, wherein the first specific sequence is complementary to 10-15 bases at the 5' end of the first miRNA to be detected;

[0039] a second oligonucleotide comprising a second universal sequence and a second specific sequence, wherein the second specific sequence is complementary to 6-10 bases at the 3' end of the first miRNA to be detected;

[0040] a third oligonucleotide comprising 4 to 8 bases from the 3' end of the first universal sequence, the first miRNA sequence to be detected, and 4 to 8 bases from the 5' end of the second universal sequence;

[0041] and / or

[0042] A second oligonucleotide composition, comprising:

[0043] a first oligonucleotide comprising a first universal sequence and a first specific sequence, wherein the first specific sequence is complementary to 10-15 bases at the 5' end of the second miRNA to be detected;

[0044] a second oligonucleotide comprising a second universal sequence and a second specific sequence, wherein the second specific sequence is complementary to 6-10 bases at the 3' end of the second miRNA to be detected;

[0045] a third oligonucleotide comprising 4 to 8 bases from the 3' end of the first universal sequence, the second miRNA sequence to be detected, and 4 to 8 bases from the 5' end of the second universal sequence;

[0046] and / or

[0047] A third oligonucleotide composition, comprising:

[0048] a first oligonucleotide comprising a first universal sequence and a first specific sequence, wherein the first specific sequence is complementary to 10-16 bases at the 5' end of the third miRNA to be detected;

[0049] a second oligonucleotide comprising a second universal sequence and a second specific sequence, wherein the second specific sequence is complementary to 6-10 bases at the 3' end of the third miRNA to be detected;

[0050] The third oligonucleotide comprises 4 to 8 bases at the 3' end of the first universal sequence, a third miRNA sequence to be detected, and 4 to 8 bases at the 5' end of the second universal sequence.

[0051] The oligonucleotide group for detecting miRNA includes the oligonucleotides as described above. More specifically, the oligonucleotide pair includes a combination of the oligonucleotides as described above and any conventional primer design. Conventional primers refer to primers designed according to conventional methods known to those skilled in the art.

[0052] In a second aspect, the present invention provides a miRNA detection kit comprising the oligonucleotide set described above.

[0053] Furthermore, the kit also includes nucleic acid extraction reagents, dNTP, Mg 2+ , DNA polymerase, reverse transcriptase, and PCR buffer.

[0054] Furthermore, the dNTP, Mg 2+ The final concentrations of DNA polymerase and reverse transcriptase were 1-5 mM, 1-5 mM, 0.05-0.2 U / μL and 1-4 U / μL, respectively.

[0055] In a third aspect, the present invention provides a detection method, which comprises the step of using the above-mentioned oligonucleotide set or kit for detection.

[0056] Furthermore, the detection method of the present invention comprises:

[0057] 1) performing amplification using the oligonucleotide set described above or the kit described above;

[0058] 2) Obtain and analyze the results.

[0059] In a specific embodiment, if the detection template is RNA, a conventional RT-PCR step is used, and the annealing temperature is determined according to the Tm value of the designed oligonucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0060] Figure 1 is a structural diagram of an oligonucleotide group according to a specific embodiment of the present invention;

[0061] Figure 2 This is a graph showing the detection results of the oligonucleotide panel of the present invention for detecting Let7 family miRNA;

[0062] Figure 3 This is a graph showing the detection results of the miR-17-92 family miRNA by the oligonucleotide panel of the present invention;

[0063] Figure 4 and 5 This is a graph showing the results of the first universal primer replacement test of the oligonucleotide set of the present invention;

[0064] Figure 6 and 7 This is a graph showing the results of the second universal primer replacement test of the oligonucleotide set of the present invention;

[0065] Figure 8 Graph showing the test results of the conventional one-step stem-loop method and the mixed detection method of the present invention;

[0066] Figure 9 Graph showing the test results of the comparative example composition and the mixed test method of the present invention. DETAILED DESCRIPTION

[0067] The present invention will be described in detail below with reference to specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. Those skilled in the art will understand that these specific embodiments and examples are intended to illustrate the present invention, not to limit it. The oligonucleotides involved in the present invention are a general structure and are applicable to the detection of any target. Below, only miRNAs associated with human intestinal pathogens are used as examples.

[0068] The specific structure of the oligonucleotide involved in the present invention is as follows Figure 1 The first, second, and third in the present invention are only used to distinguish different matters and do not specifically refer to a certain order.

[0069] Example 1: Oligonucleotides used in the present invention

[0070] The oligonucleotide group used in the present invention is shown in Table 1.

[0071] Table 1

[0072]

[0073]

[0074]

[0075] Note: 1. The lowercase regions in SEQ ID NOs: 1-48 are miRNA sequences; 2. The underlined regions are universal sequences: Among them, the underlined regions in SEQ ID NOs: 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, and 49 are the first universal sequences; the underlined regions in SEQ ID NOs: 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, and 50 are the second universal sequences; 3. The bolded regions are base substitution regions of the universal sequences: Among them, the bolded sequences in SEQ ID NOs: 19, 22, 25, 40, and 43 are the first universal sequences with base substitutions; the bolded sequences in SEQ ID NOs: 29, 32, 35, 47, and 50 are the second universal sequences with base substitutions.

[0076] Example 2: Method for detecting miRNA using oligonucleotides used in the present invention

[0077] The PCR reaction solution using the oligonucleotide of the present invention was prepared according to Tables 2 and 3 below.

[0078] Table 2. PCR reaction solution formula

[0079] Reagents Dosage Final concentration PCR buffer 31.975μL 1X <![CDATA[1M Mg 2+ ]]> 0.8μL 16mM 100mM DNTP(U) 2μL 4mM 5U reverse transcriptase 5μL 1U / μL RNasin 0.125 μL 10 U / μL 15U Taq enzyme 5μL 3U / μL SPRT primer (50 μM) 0.1μL 0.1μM SBDE primer (50 μM) 1 μL 1 μM Probe (50 μM) 1 μL 1 μM template 5μL /

[0080] Mix the reaction solution and add 5 μL of the sample nucleic acid to be tested to each reaction tube. Then, cover the PCR tube cap, centrifuge briefly, and place in the real-time fluorescence PCR instrument. Perform the reaction and detection according to the cycling conditions shown in Table 3:

[0081] Table 3. PCR cycling conditions

[0082]

[0083] Example 3: Detection of Let7 family miRNA by oligonucleotide panel of the present invention

[0084] This example takes hsa-Let7a, egr-Let7, and hsa-Let7g in the Let7 family as examples. The specific target miRNA sequences are shown in Table 4, where the bolded regions are the differential bases between the target miRNAs, and the detection channels are shown in Table 5 (the oligonucleotide groups used for detection are SEO ID NO. 1 to 9).

[0085] Table 4

[0086]

[0087] Table 5

[0088]

[0089] Test results such as Figure 2 As shown, from Figure 2 As can be seen from the figure, miRNAs in each channel can be detected. In other words, even when facing similar miRNAs of the same family, the oligonucleotide set of the present invention can detect them sensitively and accurately.

[0090] Taking hsa-Let7a as an example, hsa-Let7a dry powder was synthesized by Sangon Bioengineering and dissolved in DEPC water to 10 15 Copies / mL, marked as e15, and then a series of solutions were diluted with DEPC water in a 10-fold concentration gradient, and e4 to e2 were selected as templates for one-step LOD (sensitivity) analysis of miRNA probes. The results are as follows Figure 3 As shown, the probe can still accurately detect each channel of samples as low as 100 copies / mL, indicating that the sensitivity of the mixed detection probe of the present invention is 100 copies / mL.

[0091] Example 4: Oligonucleotide panel of the present invention detects miR-17-92 family miRNA

[0092] This example takes hsa-miR-92a-3p, hsa-miR-25-3p, and hsa-miR-17-5p in the miR-17-92 family as examples. The specific target miRNA sequences are shown in Table 6, and the detection channels are shown in Table 7 (the oligonucleotide group used for detection is SEO ID NO.10~18).

[0093] Table 6

[0094] miRNA Mature sequence hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU hsa-miR-25-3p AGGCGGAGACUUGGGCAAUUG hsa-miR-17-5p CAAAGUGCUUACAGUGCAGGUAG

[0095] Table 7

[0096]

[0097] Test results such as Figure 3 As shown, from Figure 3As can be seen from the figure, miRNAs in each channel can be detected. In other words, even when facing similar miRNAs of the same family, the oligonucleotide set of the present invention can detect them sensitively and accurately.

[0098] Example 5: Detection of hsa-Let-7a after base replacement by the oligonucleotide group of the present invention

[0099] In this example, hsa-Let-7a was used as an example. The first universal sequence in the first oligonucleotide was replaced by 15 bases (see SEQ ID NO: 19), 10 bases (see SEQ ID NO: 22), and 5 bases (see SEQ ID NO: 25), respectively. Alternatively, the second universal sequence in the second oligonucleotide was replaced by 6 bases (see SEQ ID NO: 29), 4 bases (see SEQ ID NO: 32), and 2 bases (see SEQ ID NO: 35), respectively. Detection channels are shown in Tables 8 and 9 (the oligonucleotides used for detection are SEQ ID NOs. 19 to 36).

[0100] Table 8

[0101]

[0102] Table 9

[0103]

[0104] The detection results of the first and second oligonucleotide substitutions are as follows: Figure 4 、 5 As shown in the figure, there is no significant difference in the hsa-Let-7a detection performance across channels. This means that when testing the same target miRNA, base substitutions in the universal sequence within the oligonucleotide set have no significant impact on the detection performance.

[0105] Example 6: The present invention designs an oligonucleotide group to detect hsa-miR-17-5p after replacing the base

[0106] This example uses hsa-miR-17-5p as an example. Based on the miRNA detection oligonucleotide panel design principles of the present invention, another set of oligonucleotides targeting hsa-miR-17-5p was designed (see SEQ ID NOs: 37-39). The first universal sequence was replaced by 12 bases (see SEQ ID NO: 40) or 5 bases (see SEQ ID NO: 43), respectively, or the second universal sequence was replaced by 6 bases (see SEQ ID NO: 47) or 3 bases (see SEQ ID NO: 50), respectively. The detection channels are shown in Tables 10 and 11 (the oligonucleotide panels used for detection are SEQ ID NOs. 37-51).

[0107] Table 10

[0108]

[0109] Table 11

[0110]

[0111] The detection results of the first and second oligonucleotide substitutions are as follows: Figure 6 、 7 As shown in the figure, no significant differences in the detection performance of hsa-miR-17-5p were observed across the channels. This suggests that multiple oligonucleotide sets can be designed based on the design principles of this invention for the detection of the same target miRNA, and that base substitutions in the universal sequence have no significant effect on the detection performance.

[0112] Comparative Example 1

[0113] Let7a e4 to e2 were used as templates and the conventional one-step stem-loop method and the mixed detection method of the present invention were used for detection. The results (see Table 12 and Figure 8 ) It can be seen that the mixed detection specific primers and probes designed by the method of the present invention have amplified Ct values ​​that are much smaller than those of conventional stem-loop primers and probes, and there is no non-specific amplification of NC (random small RNA template), and the fluorescence value is also higher than the conventional one.

[0114] Table 12

[0115] template Conventional method (CT) The present invention (CT) Let7a e4 28.53 23.4 Let7a e4 27.95 23.83 Let7a e3 29.44 25.22 Let7a e3 32.5 26.01 Let7a e2 34.07 30.57 Let7a e2 34.79 30.74 NC 37.67 39.81 NC 37.43 39.57

[0116] Comparative Example 2

[0117] Let7a e3 was used as a template and the comparative example (CN113373203A, hereinafter referred to as the comparative example) and the mixed detection method of the present invention were used for detection. From the results (see Table 13 and Figure 9 ) It can be seen that the mixed detection specific primers and probes designed by the method of the present invention have amplified Ct values ​​that are smaller than those of the control group, and there is no non-specific amplification of NC (scrambled small RNA template), and the fluorescence value is also higher than that of the control group.

[0118] Table 13

[0119] template Comparative Example (CT) The present invention (CT) Let7a e3 29.16 25.25 Let7a e3 28.79 25.66 NC No CT No CT NC No CT No CT

Claims

1. An oligonucleotide set for miRNA detection, comprising: A first oligonucleotide composition, comprising: a first oligonucleotide comprising a first universal sequence and a first specific sequence, wherein the first specific sequence is complementary to 10-15 bases at the 5' end of the first miRNA to be detected; a second oligonucleotide comprising a second universal sequence and a second specific sequence, wherein the second specific sequence is complementary to 6-10 bases at the 3' end of the first miRNA to be detected; and The third oligonucleotide comprises 4 to 8 bases at the 3' end of the first universal sequence and / or 4 to 8 bases at the 5' end of the second universal sequence and the first miRNA sequence to be detected.

2. The oligonucleotide set according to claim 1, wherein The Tm value of the first oligonucleotide is 68-78°C.

3. The oligonucleotide set according to claim 1, wherein The Tm values ​​of the second and third oligonucleotides are 58-68°C.

4. The oligonucleotide set according to claim 1, wherein The first universal sequence is GTTGATTCCTAATGTTGTCTATGATCACGTCTACACCACAGCACAGTCTAACGACCATCAGCATCGCGTT or CGCGCATTTCGCCAACATACATGTTGGGCTAATTGGCCTGCACATTAATCTCGCC, the maximum number of replacement bases allowed is 15bp.

5. The oligonucleotide set according to claim 1, wherein The second universal sequence is CGCACCCTGCACTGGATGACTC or GACGCTGTCGACCTGCCTA, and the maximum number of replacement bases allowed is 6 bp.

6. The oligonucleotide set according to claim 1, wherein The first specific sequence is complementary to 10-13 bases at the 5' end of the miRNA to be detected; the second specific sequence is complementary to 6-9 bases at the 3' end of the miRNA to be detected.

7. The oligonucleotide set according to claim 6, characterized in that The oligonucleotide is 15-50 bases in length.

8. An oligonucleotide set for miRNA detection, comprising: The oligonucleotide groups are shown as SEO ID NOs. 10 to 18.

9. A miRNA detection kit comprising the oligonucleotide set according to any one of claims 1 to 8.

10. A detection method comprising the step of performing detection using the oligonucleotide set according to any one of 1 to 8 or the kit according to claim 9.

Images