Molecular marker related to susceptibility of sheep brucellosis and application of molecular marker

Through whole-genome association analysis and genotyping technology, SNP molecular markers related to susceptibility to sheep brucellosis were identified, which solved the problem of difficulty in identifying susceptibility to sheep brucellosis, achieved early detection and improved breeding efficiency, and reduced virus transmission and environmental pollution.

CN120700166AActive Publication Date: 2025-09-26INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511166730.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-20
Publication Date
2025-09-26
Estimated Expiration
2045-08-20

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively identify and prevent susceptibility to brucellosis in sheep, making it difficult to control the spread of the virus, and the abuse of antibiotics leads to environmental pollution and drug residue problems.

Method used

Through genome-wide association analysis, SNP molecular markers associated with susceptibility to brucellosis in the sheep genome were discovered, primer pairs and probes were designed, genotyping was performed using gene chips, and kits were provided for detection and breeding to screen low-susceptibility sheep breeds.

Benefits of technology

It has achieved early and accurate detection of sheep susceptibility to brucellosis and molecular marker-assisted breeding, improved breeding efficiency, reduced virus transmission and drug contamination, and protected excellent sheep breed resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120700166A_ABST
    Figure CN120700166A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of animal breeding, in particular to a molecular marker related to sheep brucellosis susceptibility and application of the molecular marker. The molecular marker comprises nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1, the 101st site of the molecular marker has polymorphism, and the polymorphism is G / A. According to the invention, a molecular marker related to sheep brucellosis susceptibility is obtained through research and screening, and identification of sheep brucellosis susceptibility can be realized through detection of polymorphism of the molecular marker. The molecular marker provided by the invention can also be used for breeding sheep varieties with low brucellosis susceptibility, which has important significance in the field of sheep breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of animal breeding, in particular to a molecular marker related to the susceptibility of sheep brucellosis and an application thereof. Background Art

[0002] Brucellosis is a zoonotic disease caused by Brucella bacteria. Clinical symptoms include undulating fever, fatigue, and reproductive impairment (orchitis and epididymitis in males, and miscarriage and endometritis in females). Brucella is a facultative intracellular parasite with the ability to evade the immune system. Brucellosis presents as an insidious infection with a chronic course, making it difficult to detect in the early stages and control in the later stages. Brucella melitensis is the most virulent and infective of all species. Sheep and goats are susceptible to Brucella and are one of the most dangerous sources of human brucellosis. This poses a significant threat to the current sheep and goat industry.

[0003] Single nucleotide polymorphism (SNP) is the most common type of genetic variation at the genomic level, caused by changes in a single base. It specifically includes transition and transversion: transition refers to the substitution between purines (G / A) or pyrimidines (T / C), while transversion refers to the substitution between purines and pyrimidines. In livestock and poultry breeding, SNPs are widely used in genetic markers and genomic analysis. SNP markers allow accurate identification and differentiation of individual animal genotypes, helping researchers understand important genetic traits such as disease resistance and production performance.

[0004] Identifying molecular markers associated with brucellosis susceptibility in sheep, the host animal, and applying them to aid in disease-resistant sheep breeding will not only fundamentally cut off the transmission pathways of brucellosis, truly implementing the "human-animal disease prevention" and "moving the checkpoints forward," but also mitigate environmental pollution and drug residue hazards caused by overuse of antibiotics. Therefore, identifying molecular markers associated with brucellosis susceptibility in sheep is of great practical significance. Summary of the Invention

[0005] In order to solve the problems existing in the prior art, the present invention provides a molecular marker related to the susceptibility of sheep brucellosis and application thereof.

[0006] The present invention conducted genome-wide association analysis on the susceptibility of different breeds of sheep to brucellosis and discovered SNP molecular markers in the sheep genome that are associated with the susceptibility of sheep to brucellosis. Through population verification, it was proved that the SNP molecular markers are significantly correlated with the susceptibility of sheep to brucellosis, and can be used to detect the susceptibility of sheep to brucellosis.

[0007] In a first aspect, the present invention provides a molecular marker, comprising a nucleic acid having a nucleotide sequence as shown in SEQ ID NO. 1, wherein a polymorphism exists at position 101, and the polymorphism is G / A.

[0008] The nucleotide sequence shown in SEQ ID NO.1: CCAGGACTGACATGCACCCACTGTTCCCCAAAAGCTTACTGTCTAGAAGGGAAGAGAGACACGATAGCTTTGACTGTAATTAACATATGGATGGGAAGCARGGAAATACATGCACGGGGCTCATGAGATCAGTGGGCAGGAGTCCATGATTAGGGGTTGGTGGGGGGTGGGGGTTGAGGAGTGGAGATAAAGGAGACAGAG.

[0009] Where R represents G or A (according to the internationally accepted IUPAC-IUBMB standard).

[0010] Specifically, the polymorphic site of the aforementioned molecular marker is located at position 210186957 of chromosome 3 of the reference genome version number Oar_v4.0, and the polymorphism is G / A.

[0011] In a second aspect, the present invention provides a primer pair for amplifying the aforementioned molecular markers. The primer pair can be designed using conventional methods. A skilled artisan can design primer pairs (including primer pairs or KASP primer combinations) of varying lengths based on existing primer design rules and primer design software (e.g., Primer) for amplifying the aforementioned molecular markers.

[0012] Furthermore, the present invention provides probes for amplifying the aforementioned molecular markers. The prior art already has mature technical guidance and means for designing probes for molecular markers, and probes designed based on the existing technical guidance are within the scope of protection of the present invention.

[0013] Furthermore, the present invention provides a gene chip comprising the probe. The prior art also has mature gene chip design methods, which can include the above probe alone or combine the above probe with other probes to prepare a gene chip for genotyping or molecular marker-assisted breeding.

[0014] In a third aspect, the present invention provides a primer pair comprising the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

[0015] SEQ ID NO. 2: 5'-AGAGTGGGGTGAGAGTATCAG-3'.

[0016] SEQ ID NO. 3: 5'-AGCCCTGAGACCAAAACTCCTAC-3'.

[0017] The primer combination described above can achieve efficient amplification and genotyping for the above molecular markers.

[0018] In a fourth aspect, the present invention provides a kit comprising the aforementioned molecular marker, or the aforementioned primer pair, or the aforementioned gene chip.

[0019] In a fifth aspect, the present invention provides the use of SNP sites as targets in any of the following: (1) Predicting or detecting the susceptibility of sheep to brucellosis, or preparing a reagent for predicting or detecting the susceptibility of sheep to brucellosis; (2) Identifying or breeding sheep breeds with reduced susceptibility to brucellosis, or preparing reagents for identifying or breeding sheep breeds with reduced susceptibility to brucellosis; (3) Molecular marker-assisted breeding for brucellosis susceptibility in sheep; (4) Improvement of sheep breeds related to susceptibility to brucellosis; (5) Improvement of sheep germplasm resources; The SNP site is located at position 210186957 of chromosome 3 of the reference genome version number Oar_v4.0, and the polymorphism is G / A.

[0020] The targets described in the present invention include existing conventional methods and reagents for detecting nucleotides, such as gene sequencing, designing primers for amplification, designing probes for targeted detection, and the like.

[0021] In a sixth aspect, the present invention provides the use of the aforementioned molecular marker detection reagent, or the aforementioned primer pair, or the aforementioned gene chip, or the aforementioned kit in any of the following: (1) Predicting or detecting the susceptibility of sheep to brucellosis, or preparing a reagent for predicting or detecting the susceptibility of sheep to brucellosis; (2) Identifying or breeding sheep breeds with reduced susceptibility to brucellosis, or preparing reagents for identifying or breeding sheep breeds with reduced susceptibility to brucellosis; (3) Molecular marker-assisted breeding for brucellosis susceptibility in sheep; (4) Improvement of sheep breeds related to susceptibility to brucellosis; (5) Improvement of sheep germplasm resources.

[0022] The sheep breed improvement related to susceptibility to brucellosis described in the present invention includes: using the aforementioned molecular markers to breed sheep, for example, in the breeding process, selecting individuals with a genotype of GG in the offspring.

[0023] In a seventh aspect, the present invention provides a method for identifying susceptibility to brucellosis in sheep, comprising: The sheep samples to be tested are tested for polymorphisms of the aforementioned molecular markers, and the susceptibility of the sheep to be tested to brucellosis is determined based on the genotype test results.

[0024] Furthermore, the method comprises: Extract the genomic DNA of the sheep sample to be tested, use the aforementioned primer pair for PCR amplification, or use the aforementioned gene chip for detection to obtain the genotype of the sheep to be tested, and determine the susceptibility of the sheep to be tested to brucellosis based on the genotype detection result.

[0025] Furthermore, the reaction conditions of the PCR amplification include: Pre-denaturation at 93-97°C for 2-4 minutes; denaturation at 93-97°C for 15-60 seconds, annealing at 54-60°C for 20-60 seconds, and extension at 70-74°C for 45-120 seconds, for a total of 40-55 cycles; extension after the last cycle for 2-5 minutes.

[0026] Furthermore, judging the susceptibility of the sheep to be tested to brucellosis according to the genotype detection result includes: genotype GG corresponds to low susceptibility to brucellosis, and genotypes AG and AA correspond to high susceptibility to brucellosis.

[0027] Taking the aforementioned primer pair as an example, the 165th position in the amplification result corresponds to the polymorphic site, thereby enabling identification of the susceptibility of the sheep to brucellosis. In fact, in addition to this, direct detection of the molecular marker polymorphism can also be achieved through any method including gene sequencing, molecular probes, liquid phase capture, or mass spectrometry (all conventional methods in the art).

[0028] The brucellosis described in the present invention is brucellosis caused by Brucella infecting sheep.

[0029] The present invention has the following beneficial effects: The present invention discloses a molecular marker associated with sheep brucellosis susceptibility. This molecular marker can relatively accurately detect the susceptibility of sheep to brucellosis, enabling early prediction of sheep brucellosis susceptibility, regardless of the sheep's age, gender, and other limitations. The molecular marker provided by the present invention can be used for detecting sheep brucellosis susceptibility and molecular marker-assisted breeding. It is of great significance for the prevention and screening of sheep susceptible to brucellosis, effectively improving breeding efficiency, and is also of great significance for the development and utilization of the excellent economic characteristics of superior sheep breeds, as well as the protection and rational use of breed resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the present invention or the prior art, a brief introduction is given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0031] Figure 1 This is the expanded population verification result of the SNP molecular marker disclosed in Example 2 of the present invention in the sheep population, wherein, represents p<0.01, Represents p < 0.001. DETAILED DESCRIPTION

[0032] To make the objectives, technical solutions, and advantages of the present invention more clear, the technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.

[0033] Unless otherwise specified, the experimental methods involved in the following examples are all conventional methods in the art. For example, reference can be made to experimental manuals in the art, or the conditions recommended by the manufacturer's instructions.

[0034] Unless otherwise specified, the experimental materials and reagents involved in the following examples can be obtained from commercial sources.

[0035] Example 1 Screening of SNP molecular markers associated with susceptibility to sheep brucellosis In this example, a screening method uses a sheep population, the infected host of brucellosis, as a sample, and uses genome-wide association analysis (GWAS) to develop SNP molecular markers associated with susceptibility to brucellosis in sheep. The specific steps are as follows: (1) Blood collection and serological testing.

[0036] Blood samples were collected from 50 sheep raised under the same conditions. Competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA) and fluorescence polarization assay (FPA) were used to detect the concentration of Brucella antibodies in sheep serum. The test results were used as indicators of susceptibility to sheep brucellosis and as phenotypic data for GWAS analysis.

[0037] (2) Total DNA extraction, genome resequencing and quality control.

[0038] The blood DNA samples of the above 50 sheep were subjected to whole-genome resequencing with a sequencing depth of 20×. The sequencing data were subjected to sequence alignment and quality control. The number of effective SNPs after quality control was 22,833,320.

[0039] (3) Use whole genome association analysis technology to screen SNP sites associated with susceptibility to brucellosis in sheep.

[0040] Genome-wide association analysis was performed using GEMMA (Version 0.95) software and MLM (y=γCov+Xβ+Zα+Wμ+e) as the model, with cELISA value as the phenotype; GEMMA (Version 0.95) software and MLM (y=γCov+Xβ+Zα+Wμ+e) as the model, with iELISA value as the phenotype; and GEMMA (Version 0.95) software and MLM (y=γCov+Xβ+Zα+Wμ+e) as the model, with FPA value as the phenotype.

[0041] (4) Screening of SNP sites significantly associated with susceptibility to brucellosis in sheep.

[0042] By comparing the top 500 SNPs in the three GWAS results, the present invention finally obtained a SNP molecular marker significantly associated with the susceptibility of sheep brucellosis, whose physical location was based on position 210186957 on chromosome 3 of the sheep reference genome Oar_v4.0.

[0043] The above-mentioned SNP molecular marker corresponds to the nucleotide sequence shown in SEQ ID NO.1, wherein the polymorphic site is located at the 101st bp, and the polymorphism is G or A.

[0044] Example 2 Application of SNP molecular markers associated with susceptibility to brucellosis in sheep In this example, a method is used to expand the population validation of the SNP molecular markers associated with susceptibility to brucellosis in sheep developed in Example 1, as follows: (1) Primer design.

[0045] Based on the information of the sheep genomic DNA sequence, a pair of primers was designed as follows to amplify the nucleotide fragment where the SNP to be tested is located: Forward primer F: 5′-AGAGTGGGGTGAGAGTATCAG-3′.

[0046] Reverse primer R: 5′-AGCCCTGAGACCAAACTCCTAC-3′.

[0047] (2) Collect blood samples from the sheep to be tested and determine the serum antibody concentration.

[0048] Jugular vein blood was collected from 135 unvaccinated sheep (Texel, East Frisen, Suffolk, and White Suffolk) from a farm naturally infected with Brucella. Serum Brucella antibody concentrations were measured using competitive enzyme-linked immunosorbent assay (cELSA), indirect enzyme-linked immunosorbent assay (iELISA), and fluorescence polarization assay (FPA).

[0049] (3) Extract genomic DNA from the sheep blood sample to be tested.

[0050] The genomic DNA from the sheep blood samples was extracted using the solution method.

[0051] (4) Use genotyping technology to extract SNP markers from the genome to be tested.

[0052] Based on the primer design in this Example (1), genotyping detection was performed on the SNP molecular markers associated with susceptibility to sheep brucellosis developed in Example 1.

[0053] (5) Compare whether there are significant differences in susceptibility among different genotypes.

[0054] The polymorphic genotypes of the SNP molecular markers of the above 135 sheep were detected, and the significance test of the mean differences of the brucellosis susceptibility traits (cELISA value, iELISA value, FPA value) of different genotypes of the sites was performed using SPSS one-way analysis of variance.

[0055] The results are as follows Figure 1 As shown, three genotypes of "GG", "GA" and "AA" were distinguished in the tested sheep population, and the iELISA mean value of sheep individuals with "GG" genotype was significantly lower than that of "GA" and "AA" genotypes, indicating that sheep individuals with "GG" genotype were less susceptible to brucellosis than those with "GA" and "AA" genotypes. The SNP molecular markers provided by the present invention have high accuracy in identifying susceptibility traits to brucellosis.

[0056] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A molecular marker, characterized in that The molecular marker includes a nucleic acid having a nucleotide sequence as shown in SEQ ID NO. 1, wherein a polymorphism exists at position 101, and the polymorphism is G / A.

2. A primer pair, characterized in that: The primer pair is used to amplify the molecular marker according to claim 1.

3. The primer pair according to claim 2, characterized in that The primer pair includes the nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.

3.

4. A gene chip, characterized in that The invention comprises a probe for detecting the molecular marker according to claim 1.

5. A kit, characterized in that include: The molecular marker according to claim 1, or the primer pair according to claim 2 or 3, or the gene chip according to claim 4.

6. Application of SNP sites as targets in any of the following: (1) Predicting or detecting the susceptibility of sheep to brucellosis, or preparing a reagent for predicting or detecting the susceptibility of sheep to brucellosis; (2) Identifying or breeding sheep breeds with reduced susceptibility to brucellosis, or preparing reagents for identifying or breeding sheep breeds with reduced susceptibility to brucellosis; (3) Molecular marker-assisted breeding for brucellosis susceptibility in sheep; (4) Improvement of sheep breeds related to susceptibility to brucellosis; (5) Improvement of sheep germplasm resources; The SNP site is located at position 210186957 of chromosome 3 of the reference genome version number Oar_v4.0, and the polymorphism is G / A.

7. Use of the molecular marker detection reagent according to claim 1, or the primer pair according to claim 2 or 3, or the gene chip according to claim 4, or the kit according to claim 5 in any of the following: (1) Predicting or detecting the susceptibility of sheep to brucellosis, or preparing a reagent for predicting or detecting the susceptibility of sheep to brucellosis; (2) Identifying or breeding sheep breeds with reduced susceptibility to brucellosis, or preparing reagents for identifying or breeding sheep breeds with reduced susceptibility to brucellosis; (3) Molecular marker-assisted breeding for brucellosis susceptibility in sheep; (4) Improvement of sheep breeds related to susceptibility to brucellosis; (5) Improvement of sheep germplasm resources.

8. A method for identifying susceptibility to brucellosis in sheep, characterized in that: include: The polymorphism of the molecular marker according to claim 1 is detected in the sheep sample to be tested, and the susceptibility of the sheep to be tested to brucellosis is determined according to the genotype detection result.

9. The method according to claim 8, characterized in that include: Extract genomic DNA from the sheep sample to be tested, perform PCR amplification using the primer pair described in claim 2 or 3, or use the gene chip described in claim 4 for detection to obtain the genotype of the sheep to be tested, and determine the susceptibility of the sheep to be tested to brucellosis based on the genotype detection result.

10. The method according to claim 8 or 9, characterized in that The method of judging the susceptibility of the sheep to be tested to brucellosis according to the genotype detection result includes: genotype GG corresponds to low susceptibility to brucellosis, and genotypes AG and AA correspond to high susceptibility to brucellosis.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to brucellosis resistance character of sheep as well as detection primer and application of SNP molecular marker

    CN117051131A

  • Sheep SNP (Single Nucleotide Polymorphism) molecular marker and application thereof in detection of anti-brucellosis character of sheep

    CN117051132A

  • SNP (Single Nucleotide Polymorphism) molecular marker for detecting resistance to sheep brucellosis as well as detection primer and application of SNP molecular marker

    CN117051133A

  • Sheep brucellosis resistance SNP molecular marker and application thereof

    CN117051135A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to resistance to sheep brucellosis and application of SNP molecular marker

    CN117070643A