Gene knockout MSH2 tumor cell vaccine as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of tumor vaccine development, and particularly relates to a tumor cell vaccine of gene knockout MSH2 as well as a preparation method and application of the tumor cell vaccine. Aiming at the problems that the immunogenicity of pMMR tumor cells is low and the tumor cell vaccine prepared from the pMMR tumor cells is difficult to activate an organism to generate effective anti-tumor immunity, the invention provides a cell vaccine of gene knockout MSH2 as well as a preparation method and application of the cell vaccine. The invention discovers that the immunotherapy effect of the tumor cell vaccine can be improved by knocking out the MSH2 for the first time, and proves that the MSH2 can be used as a new transformation target of the tumor cell vaccine. The vaccine is prepared from MSH2 gene knockout tumor cells through irradiation inactivation, it is found that the vaccine can remarkably inhibit growth of far-end subcutaneous tumors and AOM + DSS induced primary colorectal cancer tumors, meanwhile, long-term broad-spectrum anti-tumor immune memory can be induced, and growth of heterogeneous tumor cells is effectively inhibited. In conclusion, the invention has potential significance in clinical application of broad-spectrum tumor cell vaccines.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor vaccine development, and particularly relates to a tumor cell vaccine with MSH2 gene knockout, a preparation method thereof, and uses thereof. Background Art

[0002] Colorectal cancer is a major malignancy that poses a serious threat to national health, necessitating the development of effective treatments. In recent years, immunotherapy, particularly with immune checkpoint antibodies, has demonstrated significant efficacy in colorectal cancers with DNA mismatch repair deficiency / microsatellite instability-high (dMMR / MSI-H) phenotypes. However, approximately 85% of colorectal cancers clinically present with DNA mismatch repair-proficient (MSS / pMMR) phenotypes. These patients exhibit a low anti-tumor immune response, weak tumor antigen recognition and clearance, and minimal T cell infiltration within the tumor. Consequently, immunotherapy fails to activate effective anti-tumor immunity, preventing them from benefiting from immunotherapies such as PD-1 antibodies. Therefore, new immunotherapy strategies are clinically needed to activate patients' anti-tumor immunity and enhance the efficacy of immunotherapy.

[0003] Therapeutic tumor vaccines can promote tumor antigen presentation, induce specific anti-tumor immune responses, inhibit tumor growth, improve immunotherapy efficacy, and establish long-lasting anti-tumor memory. Current therapeutic tumor vaccines primarily include neoantigen vaccines (neoantigen peptide vaccines and mRNA vaccines) and tumor cell vaccines. Neoantigen vaccines effectively promote tumor antigen recognition and inhibit tumor growth, holding great potential for clinical application. However, the high heterogeneity of tumor tissues presents significant challenges in the prediction, screening, and validation of neoantigens, making them time-consuming and expensive to develop. Furthermore, the vaccines exhibit poor inter-individual compatibility. In contrast, tumor cell vaccines can directly and simultaneously present a complete repertoire of tumor antigens, including shared antigens, neoantigens, and tumor-associated antigens, to the immune system, activating T cells and exerting anti-tumor effects. These vaccines offer greater therapeutic compatibility than neoantigen vaccines. However, conventional inactivated tumor cell vaccines exhibit poor immunogenicity, ineffective anti-tumor immune activation, and limited efficacy. Therefore, novel immunotherapy strategies are needed to enhance the therapeutic efficacy of tumor cell vaccines.

[0004] MSH2 (DNA mismatch repair protein MSH2, DNA mismatch repair protein MSH2), is an important component of the DNA mismatch repair system (MMR), which also includes MLH1, PMS2, and MSH6. During DNA damage repair, MSH2 and MSH6 molecules combine to form the heterodimer MutSα, which then binds to the DNA mismatch site and recruits the heterodimer MutLα formed by MLH1 and PMS2, finally forming the MutSα-mutlα complex together. The complex then recruits Exo1 to excise the mismatch sequence and activates downstream pathways to initiate DNA repair function. MSH2 gene deletion can cause the DNA mismatch repair system to be unable to bind to the DNA sequence, thereby transforming MSS / pMMR tumors into MSI-H / dMMR tumors. Studies have reported that knocking out the MSH2 gene can activate the STING signaling pathway, thereby promoting the expression of Ccl5 and Cxcl10 genes, increasing T cell infiltration, and inhibiting tumor growth. This study shows MSH2 Gene deletion can significantly promote immune recognition of tumor cells and is a valuable target for tumor cell vaccine modification. However, there are currently no reports of knocking out MSH2 in tumor cells and using it to prepare tumor cell vaccines. Summary of the Invention

[0005] The technical problem to be solved by the present invention is that PMMR tumor cells have low immunogenicity and are difficult to activate the body's anti-tumor immunity after being prepared into tumor cell vaccines.

[0006] The technical solution of the present invention to solve the above technical problems is: to provide a gRNA for knocking out the mouse MSH2 gene, including a gRNA1 with a nucleotide sequence as shown in SEQ ID NO: 2 and a gRNA2 with a nucleotide sequence as shown in SEQ ID NO: 3.

[0007] In a second aspect, the present invention provides a gRNA for knocking out the MSH2 gene in human tumor cells, comprising a gRNA3 with a nucleotide sequence as shown in SEQ ID NO: 5 and a gRNA4 with a nucleotide sequence as shown in SEQ ID NO: 6.

[0008] In a third aspect, the present invention provides a method for knocking out the MSH2 gene. The method comprises the following steps: a. Obtain the MSH2 gene sequence from the mouse or human genome, and design a mouse gRNA sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 3, or a human gRNA sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 6; b. Select the pSpCas9(BB)-2A-GFP (PX458) vector, digest it with the BbsⅠ restriction site, phosphorylate and anneal the gRNA sequence, and then ligate and transform it to obtain a Cas9 gene knockout vector containing the MSH2 gene targeting gRNA sequence; c. Transfect tumor cells with the Cas9 gene knockout vector containing the MSH2 gene targeting gRNA sequence described in step b to obtain cells in which the MSH2 gene is knocked out.

[0009] In a fourth aspect, the present invention provides an MSH2 gene knockout cell directly prepared by the above-mentioned method for knocking out the MSH2 gene.

[0010] In a fifth aspect, the present invention provides a use of cells with an MSH2 gene knockout in the preparation of a cellular vaccine for preventing or treating tumors.

[0011] In the use of the MSH2 gene-knockout cells in the preparation of a cellular vaccine for the prevention or treatment of tumors, the tumor is a tumor containing the MSH2 gene. Preferably, the tumor containing the MSH2 gene includes colorectal cancer, gastroesophageal adenocarcinoma, or endometrial cancer. More preferably, the tumor is colorectal cancer.

[0012] The use of the MSH2 gene-knockout cells in the preparation of a cell vaccine for the prevention or treatment of tumors is a universal cell vaccine. The cell vaccine of the present invention, because it presents a relatively rich array of antigens, encompassing a complete spectrum of tumor antigens with shared antigens, can achieve cell line therapy for primary tumors. An MSH2-knockout tumor cell vaccine prepared from colorectal cancer CT26 cells significantly inhibited the subcutaneous growth of breast cancer 4T1 tumors after treatment, inducing a good broad-spectrum anti-tumor effect.

[0013] A sixth aspect of the present invention provides a method for preparing a universal cell vaccine using cells in which the MSH2 gene has been knocked out. The method comprises the following steps: irradiating the MSH2 gene-knockout cells with 5-100 Gy of X-rays. When the irradiated cells fail to form tumors in normal mice, the cell vaccine is prepared.

[0014] In a seventh aspect, the present invention provides a tumor cell vaccine, which is directly prepared by the above-mentioned method for preparing a universal cell vaccine by cells with knockout of the MSH2 gene.

[0015] Among them, in the above tumor cell vaccine, the therapeutic concentration of the cell vaccine is 1×10 6 / Only.

[0016] Compared with the prior art, the present invention has the following beneficial effects: The present invention screened for gRNA that knocks out the MSH2 gene, constructed a vector for knocking out the MSH2 gene, and further obtained tumor cells with the MSH2 gene knocked out. The tumor cells were then prepared into a cell vaccine through a special irradiation process. It was found that this cell vaccine has a good effect on the prevention or treatment of primary colorectal cancer, and has a broad-spectrum anti-tumor immune memory effect. The present invention further verified that knocking out the MSH2 gene in human pMMR tumor cells can also promote tumor cell antigen presentation. The present invention has developed a new universal cell vaccine, providing a new approach for gene therapy of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Figure 3 shows the construction of an MSH2-knockout mouse tumor cell line. (A) Western blot analysis shows the knockout of MSH2 protein in CT26 tumor cells. (B) Immunohistochemical staining of MSH2-knockout CT26 tumor cells forming tumors in nude mice.

[0018] Figure 2 The figure shows the preparation and treatment strategy of MSH2 knockout tumor cell vaccine; (A) is the experimental flow chart of subcutaneous inoculation of tumor cell vaccine; (B) is the experimental flow chart of mice under different irradiation doses. Msh2 - / - Subcutaneous tumor formation of tumor cells; (C) CT26 at different treatment doses Msh2 - / - A diagram showing the therapeutic effects of tumor cell vaccines.

[0019] Figure 3 Shown are the therapeutic effects of MSH2 knockout tumor cell vaccine on primary colorectal cancer; (A) Schematic diagram of the modeling process and treatment strategy for AOM+DSS primary colorectal cancer; (B) Colonoscopic observation results during CT26 MSH2 knockout tumor cell vaccine treatment; (C) Statistical graph of tumor area and tumor number in cell vaccine-treated primary colorectal cancer.

[0020] Figure 4 The figure shows that MSH2 knockout tumor cell vaccine treatment can produce a broad-spectrum anti-tumor immune memory effect; (A) shows the immune protection effect of the CT26 MSH2 knockout tumor cell vaccine in a preventive experiment; (B) shows the experimental results of re-challenging with 4T1 tumor cells after the tumor completely regressed after treatment with the CT26 MSH2 knockout tumor cell vaccine; (C) shows the biosafety evaluation diagram after treatment with the CT26 MSH2 knockout tumor cell vaccine.

[0021] Figure 5Figure 2 shows the construction of human MSH2 knockout tumor cells; (A) Expression changes of antigen presentation-related proteins TAP1 and TAP2 in CT26 MSH2 knockout tumor cells; (B) Expression changes of antigen presentation-related proteins TAP1 and TAP2 in SW480 MSH2 knockout cells, human colorectal cancer tumor cells. DETAILED DESCRIPTION

[0022] This study utilizes gene editing to knock out MSH2, a key member of the DNA mismatch repair gene family, in pMMR-type colon cancer cells. After irradiation, this therapeutic cell vaccine was developed into a dMMR-phenotype tumor vaccine. This vaccine was found to significantly inhibit the growth of pMMR tumors and primary colorectal cancers. It also induced broad-spectrum anti-tumor immune memory, inhibiting re-challenge with allogeneic or xenograft tumors. Finally, using gene editing to knock out the MSH2 protein in human tumor cells, we found that knocking out this gene upregulated the expression of the antigen-presenting genes TAP1 and TAP2, consistent with results observed in mouse tumors. This suggests that this tumor cell vaccine may also have a promising therapeutic effect in the treatment of human tumors, providing a new possibility for gene therapy of human tumors, particularly colorectal cancer.

[0023] The present invention will be described in detail below through specific embodiments in conjunction with the accompanying drawings. In the following examples, any experimental conditions not specified are based on conventional conditions well known to those skilled in the art.

[0024] Example 1 Construction of MSH2 gene knockout mouse tumor cells The specific operations are as follows: 1. Construction of CRISPR-Cas9 targeting vector CRISPR-Cas9 gene knockout vector for MSH2 protein: The mouse genomic MSH2 sequence was obtained using NCBI (https: / / www.ncbi.nlm.nih.gov / ). Subsequently, we used the online gRNA design tool website http: / / crispr.dbcls.jp / to obtain the gRNA sequence based on the first exon sequence of the gene (ATGGCGGTGCAGCCTAAG GAGACGCTGCAGTTGGAAGGCGCGGCCGAGGCGGGCTTCGTGCGCTTCTTTGAGGGCATGCCGGAGAAGCCGAGCACCACGGTGCGCCTCTTCGACCGCGGCGACTTTTACACGGCGCACGGAGAGGACGCGCTGCTGGCGGCCCGCGAGGTGTTCAAGACCCAGGGCGTGATCAAGTACATGGGGCCGGCAG) (SEQ ID NO: 1) and designed the gRNA sequence based on the first exon of the MSH2 gene.

[0025] This application obtained mice through screening Msh2 The gene gRNA sequence information is as follows: Mouse -Msh2- gRNA1: GCGGTCGAAGAGGCGCACCG (SEQ ID NO: 2); Mouse- Msh2 -gRNA2: GCACGGAGAGGACGCGCTGC (SEQ ID NO: 3).

[0026] After obtaining the gRNA, the BbsⅠ restriction site of pSpCas9(BB)-2A-GFP (PX458) was digested. The gRNA sequence was then phosphorylated and annealed. Through ligation and transformation, a Cas9 knockout vector containing the MSH2-targeting gRNA sequence was generated. Finally, 50 μl of plasmid (20 ng / μl) was isolated and forward sequencing was performed using the U6-F universal primer to verify the gRNA sequence connectivity.

[0027] 2. Plasmid infection and cell screening: (1) The mouse CT26 tumor cells to be treated were plated in a 6-well plate in advance, with a cell number of 5×10 5 / well, and subsequent experiments can be carried out after observing the cells on the next day to confirm that they are in good condition.

[0028] (2) Plasmid transfection was performed using the lipo3000 transfection reagent method. Two sterilized 1.5 ml EP tubes were prepared. 600 ul of Opti-MEM medium and 48 ul of Lipo3000 transfection reagent were added to the first EP tube and mixed evenly to form transfection reagent A. 600 ul of Opti-MEM medium was added to the other EP tube, and 24 ug of the Cas9 gene knockout vector containing the MSH2 gene targeting gRNA sequence and 48 ul of P300 reagent were added and mixed evenly to form transfection reagent B. Finally, transfection reagent A was mixed with B and allowed to stand at room temperature for 15 minutes to prepare transfection reagent C.

[0029] (3) Add transfection reagent C to the cell supernatant in the 6-well plate, add 200ul to each well, mix thoroughly, and return to the cell culture incubator for culture.

[0030] (4) Since the pSpCas9(BB)-2A-GFP (PX458) plasmid has an EGFP tag, the proportion of EGFP-positive tumor cells in the 6-well plate was observed using an inverted fluorescence microscope after 48 hours. When the presence of cells that significantly express EGFP can be seen under the microscope and the proportion of EGFP-positive tumor cells is greater than 70%, the next step can be performed.

[0031] 3. Fluorescence sorting and monoclonal plating of MSH2 gene knockout tumor cells: (1) When more than 70% of the tumor cells in the 6-well plate significantly express EGFP green fluorescent protein, we will use trypsin to digest the collected transfected tumor cells, prepare a cell suspension, and then use the BD FACS Aria Fusionflow cytometer flow sorter to sterile sort the EGFP-positive tumor cells; (2) After cell sorting, the EGFP-positive tumor cells were centrifuged at 1200 rpm for 3 min in a 4-degree centrifuge. The supernatant was discarded and resuspended in 10 ml of sterile PBS. The cells were then centrifuged again at 1200 rpm for 3 min until the cells were washed three times with PBS. (3) Count the EGFP-positive tumor cells and adjust their cell concentration to 10 cells / ml. Then, evenly plate the cells in a 96-well plate at a volume of 100 μl / well. (4) After adding the cells to the 96-well plate, observe under a microscope to identify the wells in the 96-well plate that contain single cells, and wait for the single cells to form monoclones before performing gene knockout verification.

[0032] 4. Verification of MSH2 gene knockout tumor cells: (1) After obtaining MSH2 gene knockout tumor cells, we first collected MSH2 gene knockout tumor cells, prepared protein samples according to standard procedures, and then verified the changes in MSH2 protein levels by Western Blot experiments. The results are as follows Figure 1 As shown in A, it can be seen that compared with the control CT26 cells, the expression of MSH2 protein in the transformed tumor cells is significantly decreased.

[0033] (2) After the in vitro experiments confirmed the significant loss of MSH2 protein, we CT26 Msh2 - / - The cells were 5×10 6 The concentration of CT26 cells was subcutaneously inoculated into nude-BALB / c mice, 100 μl per mouse. The same concentration of CT26 cells was inoculated into another group of nude-BALB / c mice as a control. After 15 days, the subcutaneous tumor tissues of the nude mice were collected and immunohistochemically stained with MSH2 antibody. The results are shown in Figure 2. Figure 1 As shown in B, it can be seen that in the mouse body environment, compared with CT26 cells, CT26 Msh2 - / - The cells still significantly lacked MSH2 protein.

[0034] In summary, this experiment successfully constructed MSH2 knockout tumor cells.

[0035] Example 2 Preparation of MSH2 Knockout Tumor Cell Vaccine 1. Explore CT26 Msh2 through experiments - / - The optimal safe radiation dose for tumor cells, the specific operation process is as follows Figure 2 As shown in A, the specific steps are as follows: (1) We collected CT26 Msh2 - / - Tumor cells were adjusted to a concentration of 1×10 7 / ml.

[0036] (2) Subsequently, 0 Gy irradiation group, 5 Gy irradiation group, 10 Gy irradiation group and 15 Gy irradiation group were set in the 0-20 Gy gradient, and then the irradiated tumor cells were inoculated subcutaneously into normal Balb / c mice, with 100 μl inoculated per mouse.

[0037] (3) Observe the tumor growth in a long term and make statistics on the tumor growth of each group of mice after one year. The irradiation dose of the mice without tumor growth was used as the dose for preparing tumor cell vaccine. Msh2 - / - Subcutaneous inoculation of tumor cells did not result in significant tumor formation. Figure 2As shown in B. Therefore, this experiment ultimately used 5 Gy as the optimal irradiation dose for subsequent research experiments, and the control CT26 cells were still prepared with the standard 60 Gy.

[0038] 2. Explore CT26 through experiments Msh2 - / - Optimal therapeutic dose for tumor cells (1) First we collect CT26 Msh2 - / - tumor cells, and the tumor cell treatment dose was adjusted to 2.5×10 5 cells / mouse, 5×10 5 cells / mouse and 1×10 6 cells / cell, and then irradiated with 5Gy of X-rays to prepare CT26 Msh2 - / - Tumor cell vaccines.

[0039] (2) 40 6-week-old BALB / c mice were prepared and then subcutaneously inoculated with CT26 wild-type cell lines on the right side of the mice at a concentration of 5×10 5 Cells / cells.

[0040] (3) Four days after inoculation, the tumor-bearing mice were randomly divided into four groups, with 10 mice in each group, including the PBS treatment group, the 2.5×10 5 cells / treatment group, 5×10 5 cells / treatment group and 1×10 6 cells / treatment group, and then we used different concentrations of CT26 for each group of mice based on the group name. Msh2 - / - The tumor cell vaccine was administered to the left side of the body. Mice were ear-tagged after treatment and then treated twice more on days 7 and 10.

[0041] (4) The tumor volume (mm) was measured every 3 days after the subcutaneous tumor was inoculated in mice. 3 ) = (length × width 2 ) / 2, the tumor volume in the PBS treatment group was greater than 2000 mm 3 Stop the statistics and compare the treatment effects of each treatment group.

[0042] The experimental results are as follows Figure 2 As shown in C, using 1×10 6 The treatment concentration group with 1×10 cells / cell achieved the best therapeutic effect. Therefore, in subsequent experiments, we used 1×10 6 The experiments were carried out with a treatment concentration of 10 cells / mouse.

[0043] Example 3 Therapeutic Effect of MSH2 Knockout Tumor Cell Vaccine in Mouse Primary Tumor Model To investigate the therapeutic efficacy of an MSH2-knockout tumor cell vaccine in a primary colorectal cancer model, we first established a mouse primary colorectal cancer model using AOM+DSS. After colonoscopy revealed precancerous lesions in the mouse intestine, we administered the subcutaneous MSH2-knockout tumor cell vaccine to the mice and collected the treatment results. The specific treatment process is as follows: (1) Six-week-old BALB / c mice were purchased and an AOM+DSS primary colorectal cancer tumor model was constructed. The mice were first intraperitoneally injected with the carcinogenic chemical mutagen Azoxymethane (AOM) at a dose of 10 mg / kg. Subsequently, the mice were fed with water containing 2% Dextran sodium sulphate (DSS) for one week at the first, fourth, and seventh weeks. During the model construction process, the tumor formation of the mice was observed using a small animal colonoscopy every other week.

[0044] (2) After tumors appeared, the mice were randomly divided into PBS group, CT26 cell vaccine treatment group and CT26 Msh2 - / - Cell vaccine treatment group, 15 rats in each group.

[0045] (3) Then, PBS solution and CT26 tumor cell vaccine (1×10 6 cells / mouse) and CT26 Msh2 - / - Tumor cell vaccine (1×10 6 The mice were treated with subcutaneous injection of 100 cells / mouse. The treatment was conducted once every 4 days and 3 times a month. The growth of intestinal tumors in mice was observed by colonoscopy during each treatment.

[0046] (4) The treatment experiment was stopped after 6 treatments, and the mice were killed at the 11th week. The colon tissue was removed and the colorectal length, tumor surface area and number of tumor nodules of each group of mice were counted.

[0047] The experimental results are as follows Figure 3 As shown: According to Figure 3 The tumor modeling and treatment process shown in A, and the colonoscopy results are as follows Figure 3 As shown in B: On the 30th day, the intestinal precancerous lesions of the three groups of mice were the same. With the subsequent treatment, on the 58th day, compared with the PBS group and the CT26 cell vaccine treatment group, the CT26 Msh2 - / - The primary tumor tissue area in the intestine of mice treated with tumor cell vaccine was smaller. At 75 days, we counted the tumor growth in the intestine of mice and found the following results: Figure 3 C shows CT26 Msh2 - / - The tumor cell vaccine treatment group can significantly inhibit the growth of primary tumors in the intestines of mice. Msh2 - / - Tumor cell vaccines have a broad-spectrum anti-tumor therapeutic effect.

[0048] Example 4 Broad-spectrum anti-tumor effect of MSH2 knockout tumor cell vaccine in vaccine protection experiment To investigate the therapeutic efficacy of an MSH2-knockout tumor cell vaccine in a primary colorectal cancer model, we conducted vaccine protection experiments with the same tumor type, as well as xenograft rechallenging experiments in mice with complete tumor regression, and evaluated the safety of vaccine-induced anti-tumor immunity. The specific experimental procedures are as follows: 1. Tumor prevention experiment of MSH2 gene knockout tumor cell vaccine: (1) Prepare 20 6-week-old BALB / c mice and divide them into PBS treatment group and CT26 group. Msh2 - / - Cell vaccine treatment group, 10 mice in each group.

[0049] (2) In the PBS treatment group and CT26 Msh2 - / - The left side of the mice in the cell vaccine treatment group were subcutaneously inoculated with 100 μl of PBS and 100 μl of CT26. Msh2 - / - Cell vaccine, followed by treatment every other week for a total of three treatments.

[0050] (3) After three treatments, CT26 cells were used to subcutaneously inoculate tumors on the right side of the mice at a concentration of 5×10 5 cells / mouse; the tumor volume was measured every 3 days after inoculation. In the PBS treatment group, the tumor volume was greater than 2000 mm 3 Stop statistics and analyze CT26 Msh2 - / - Tumor preventive effect of cell vaccines.

[0051] 2. Re-challenge experiment of xenogeneic tumors: (1) When using CT26 Msh2 - / - After the cell vaccine treatment experiment is carried out and the right subcutaneous CT26 tumor completely disappears, if the tumor does not recur within 2 months of feeding, we will use the CT26 tumor-regressed mice for tumor re-challenge experiments.

[0052] (2) We collected mice with completely resolved CT26 tumors after treatment as the experimental group (CT26 tumor-free mice group) and collected mice of the same age that were not inoculated with tumor cells as the control group (naïve mice group); then, we subcutaneously inoculated the two groups of mice with 4T1 cell lines at a concentration of 5×10 5 Cells / cells.

[0053] (3) The tumor volume of mice was counted every 3 days after inoculation. In the naïve mice, the tumor volume was greater than 2000 mm 3 The growth of 4T1 tumor cells was counted and analyzed at the same time.

[0054] 3. Safety evaluation of cell vaccine therapeutic effects: (1) Purchase 20 6-week-old BALB / c mice and sample them at a rate of 5×10 5 CT26 cells were inoculated subcutaneously on the right side of the mice at a dose of 10 cells / mouse. Four days later, the mice were randomly divided into two groups, PBS group and CT26 group. Msh2 - / - Vaccine treatment group.

[0055] (2) CT26 Msh2 - / - The mice in the vaccine treatment group were treated according to the above-mentioned cell vaccine treatment strategy, and then the tumor volume of the mice was counted every 3 days starting with CT26 vaccination.

[0056] (3) When the tumor size in the PBS group was larger than 2000 mm 3 , and CT26 Msh2 - / - When the tumor volume of the vaccine treatment group was significantly lower than that of the PBS group, the tumor volume of the PBS group and CT26 Msh2 - / - Mice in the vaccine treatment group were euthanized, and the heart, liver, spleen, lung, and kidney tissues were removed for fixation, sectioning, and H&E staining.

[0057] (4) After the H&E sections were prepared, they were observed and photographed under a microscope, and the CT26 Msh2 - / - Organ outcomes in the tumor cell vaccine treatment group were physiologically evaluated.

[0058] The experimental results are as follows Figure 4 Shown: In the tumor prevention experiment, compared with the PBS group. Msh2 - / - The vaccine can significantly prevent the occurrence and development of CT26 tumors ( Figure 4A). In the xenogeneic tumor re-challenge experiment, compared with the subcutaneous growth of 4T1 tumors in naïve mice, the growth of 4T1 tumors in the CT26 tumor complete regression group was significantly inhibited. Msh2 - / - Vaccine-induced anti-tumor immune protection is broad-spectrum ( Figure 4 B). In the safety evaluation results, we can find that compared with the PBS group, CT26 Msh2 - / - There was no obvious inflammation or tissue damage in the heart, liver, spleen, lung, and kidney tissues of mice in the vaccine treatment group ( Figure 4 C). In summary, the MSH2 knockout tumor cell vaccine can induce broad-spectrum anti-tumor immune protection and has good biosafety.

[0059] Example 5 Knockout of human pMMR tumor cells MSH2 Genes can enhance antigen presentation consistent with mouse tumor cells 1. Human MSH2 Construction of gene-deficient tumor cells To knock out the MSH2 We selected SW480 cells for related experiments. The plasmid construction, cell transfection, cell sorting and monoclonal screening methods were consistent with the construction methods of mouse MSH2-deficient tumor cells, and finally obtained SW480 MSH2 - / - Tumor cells. We are based on human MSH2 The gRNA sequence is designed based on the nucleotide sequence of the first exon of the human MSH2 The nucleotide sequence of the first exon of the gene is designated as SEQ ID NO: 4, and the specific nucleotide sequence is: ATGGCGGTGCAGCCGAAGGAGACGCTGCAGTTGGAGAGCGCGGCCGAGGTCGGCTTCGTGCGCTTCTTTCAGGGCATGCCGGAGAAGCCGACCACCACAGTGCGCCTTTTCGACCGGGGCGACTTCTATACGGCGCACGGCGAGGACGCGCTGCTGGCCGCCCGGGAGGTGTTCAAGACCCAGGGGGTGATCAAGTACATGGGGCCGGCAG.

[0060] The specific sequence information of the gRNA sequence is as follows: Human- MSH2 -gRNA1:CCACAGTGCGCCTTTTCGAC (SEQ ID NO:5); Human- MSH2 -gRNA2:GAAGCGCACGAAGCCGACCT (SEQ ID NO: 6).

[0061] 2. Western Blot Verification of the Expression of Key Antigen Presentation Proteins TAP1 and TAP2 After obtaining SW480 MSH2 - / - After tumor cells, we will collect CT26, CT26 Msh2 - / - , SW480 and SW480 MSH2 - / - Cells were prepared according to the WB standard protein sample preparation process, and then WB experiments were carried out to explore the relationship between CT26 and CT26. Msh2 - / - Between SW480 and SW480 MSH2 - / - The TAP1 and TAP2 protein expression differences between the two groups were observed. The experimental results are as follows: To investigate whether knocking out the MSH2 gene in human pMMR tumor cells could improve tumor cell immunogenicity, we redesigned the gRNA sequence targeting the human MSH2 gene and obtained MSH2 gene-knockout SW480 tumor cells through gene editing. Subsequently, through Western blot experiments, we confirmed that knocking out MSH2 in CT26 cells promoted the expression of antigen presentation-related proteins TAP1 and TAP2 ( Figure 5 A), and consistent results were obtained by knocking out MSH2 in SW480 ( Figure 5 B). The above results indicate that knocking out MSH2 in human pMMR tumor cells can also promote antigen presentation in tumor cells, which is consistent with the effect of knocking out MSH2 in mouse pMMR tumor cells.

[0062] In summary, the present application provides a method for preparing a tumor cell vaccine by knocking out the MSH2 gene. The vaccine prepared by knocking out the MSH2 gene in mice has a good effect on preventing or treating mouse tumors. After knocking out MSH2 in human tumor cells, it can also promote antigen presentation of tumor cells, which is consistent with the effect of knocking out the MSH2 gene in mouse pMMR tumor cells. It is predicted that it can achieve a good anti-tumor effect.

Claims

1. Use of a gRNA for knocking out the mouse MSH2 gene, a gRNA for knocking out the human tumor cell MSH2 gene, or a cell for knocking out the MSH2 gene in the preparation of a cellular vaccine for preventing or treating tumors; the gRNA for knocking out the mouse MSH2 gene comprises gRNA1 with a nucleotide sequence as shown in SEQ ID NO: 2 and gRNA2 with a nucleotide sequence as shown in SEQ ID NO: 3; the gRNA for knocking out the human tumor cell MSH2 gene comprises gRNA3 with a nucleotide sequence as shown in SEQ ID NO: 5 and gRNA4 with a nucleotide sequence as shown in SEQ ID NO:

6.

2. The use according to claim 1, characterized in that: The tumor is a tumor containing the MSH2 gene.

3. The use according to claim 1, characterized in that: The tumors containing the MSH2 gene include colorectal cancer, gastroesophageal adenocarcinoma or endometrial cancer.

4. A method for preparing a universal cell vaccine by knocking out the MSH2 gene, characterized in that: The following steps are involved: The cells with the MSH2 gene knocked out are irradiated with 5-100Gy of X-rays. When the irradiated cells fail to form tumors in normal mice, it means that the cell vaccine has been prepared.

5. A tumor cell vaccine, characterized in that: The vaccine is directly prepared by the method for preparing a universal cell vaccine by knocking out the MSH2 gene in claim 4.

6. The tumor cell vaccine according to claim 5, characterized in that: The therapeutic concentration of the cell vaccine is 1×10 6 / Only.

Images