MSH2 gene knockout tumor cell vaccine, its preparation method and uses
By knocking out the MSH2 gene in mouse and human tumor cells, cellular vaccines were prepared, solving the problem of low immunogenicity of PMMR tumor cells and achieving broad-spectrum treatment and immune memory effects against tumors such as colorectal cancer.
Patent Information
- Application Number
- CN202511168963.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-20
- Publication Date
- 2025-12-02
- Estimated Expiration
- 2045-08-20
AI Technical Summary
PMMR tumor cells have low immunogenicity, making it difficult to activate the body's anti-tumor immunity after being prepared into tumor cell vaccines.
By designing specific gRNAs to knock out the MSH2 gene in mouse and human tumor cells, a Cas9 gene knockout vector was constructed, which was then transfected into tumor cells to obtain MSH2-knockout cells, which were then prepared into a cell vaccine by X-ray irradiation.
The prepared cell vaccine has good preventive or therapeutic effects on primary colorectal cancer, has broad-spectrum anti-tumor immune memory effect, significantly inhibits the growth of allogeneic or xenogeneic tumors, and improves the antigen presentation ability of tumor cells.
Smart Images

Figure CN120714014B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of tumor vaccine development technology, specifically relating to a tumor cell vaccine with MSH2 gene knockout, its preparation method, and its uses. Background Technology
[0002] Colorectal cancer is a serious malignant disease that severely threatens national health, urgently requiring the development of effective treatments. In recent years, immunotherapy, represented by immune checkpoint antibodies, has shown significant efficacy in colorectal cancer with DNA mismatch repair deficiency / microsatellite instability (dMMR / MSI-H). However, approximately 85% of colorectal cancers are clinically normal DNA mismatch repair (MSS / pMMR). These patients exhibit low anti-tumor immune responses, weak tumor antigen recognition and clearance capabilities, and low T-cell infiltration within the tumor. Immunotherapy fails to activate effective anti-tumor immunity, preventing them from benefiting from PD-1 antibody therapy and other immunotherapies. Therefore, new immunotherapy strategies are needed clinically to activate patients' anti-tumor immunity and improve the efficacy of immunotherapy.
[0003] Therapeutic cancer vaccines can promote tumor antigen presentation, induce specific anti-tumor immune responses, inhibit tumor growth, improve the efficacy of immunotherapy, and establish lasting anti-tumor memory. Current therapeutic cancer vaccines mainly include tumor neoantigen vaccines (neoantigen peptide vaccines and mRNA vaccines) and tumor cell vaccines. Tumor neoantigen vaccines can effectively promote tumor antigen recognition and inhibit tumor growth, showing great potential for clinical application. However, due to the high heterogeneity of tumor tissues, the prediction, screening, and validation of neoantigens pose significant challenges, are time-consuming, and are very expensive, with poor inter-individual applicability. In contrast, tumor cell vaccines can directly present the complete tumor antigen spectrum, including shared antigens, tumor neoantigens, and tumor-associated antigens, to the immune system simultaneously, activating T cells and exerting anti-tumor effects, exhibiting better therapeutic universality than tumor neoantigen vaccines. However, traditionally prepared inactivated tumor cell vaccines have poor immunogenicity, cannot effectively activate anti-tumor immunity, and have poor efficacy; therefore, new immunotherapy strategies need to be developed to improve the therapeutic efficacy of tumor cell vaccines.
[0004] MSH2 (DNA mismatch repair protein) MSH2MSH2 (a DNA mismatch repair protein) is an important component of the DNA mismatch repair system (MMR), which also includes MLH1, PMS2, and MSH6. During DNA damage repair, MSH2 and MSH6 molecules bind to form the heterodimer MutSα, which then binds to the DNA mismatch site and recruits the heterodimer MutLα formed by MLH1 and PMS2. Finally, they form the MutSα-mutlα complex, which then recruits Exo1 to cleave the mismatch sequence and activates downstream pathways, initiating DNA repair. MSH2 gene deletion prevents the DNA mismatch repair system from binding to DNA sequences, thus transforming MSS / pMMR tumors into MSI-H / dMMR tumors. Studies have reported that knocking out the MSH2 gene can activate the STING signaling pathway, thereby promoting the expression of Ccl5 and Cxcl10 genes, increasing T cell infiltration, and inhibiting tumor growth. This study shows... MSH2 Gene deletion can significantly enhance immune recognition by tumor cells, making it a valuable target for tumor cell vaccine modification. However, there are currently no reports on using MSH2 knockout in tumor cells for the preparation of tumor cell vaccines. Summary of the Invention
[0005] The technical problem to be solved by this invention is that PMMR tumor cells have low immunogenicity, making it difficult to activate the body's anti-tumor immunity after being prepared into tumor cell vaccines.
[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a gRNA for knocking out the mouse MSH2 gene is provided, comprising gRNA1 with nucleotide sequence as shown in SEQ ID NO:2 and gRNA2 with nucleotide sequence as shown in SEQ ID NO:3.
[0007] In a second aspect, the present invention provides a gRNA for knocking out the MSH2 gene in human tumor cells, comprising gRNA3 with a nucleotide sequence as shown in SEQ ID NO:5 and gRNA4 with a nucleotide sequence as shown in SEQ ID NO:6.
[0008] In a third aspect, the present invention provides a method for knocking out the MSH2 gene. The method includes the following steps:
[0009] a. Obtain the MSH2 gene sequence from the mouse or human genome and design a mouse gRNA sequence as shown in SEQ ID NO:2 or SEQ ID NO:3, or a human gRNA sequence as shown in SEQ ID NO:5 or SEQ ID NO:6;
[0010] b. Select the pSpCas9(BB)-2A-GFP (PX458) vector, digest its BbsⅠ restriction site, phosphorylate and anneal the gRNA sequence, and then ligate and transform to obtain a Cas9 gene knockout vector containing the MSH2 gene target gRNA sequence.
[0011] c. Transfect tumor cells with the Cas9 gene knockout vector containing the MSH2 gene-targeting gRNA sequence described in step b to obtain cells with the MSH2 gene knocked out.
[0012] In a fourth aspect, the present invention provides a cell with the MSH2 gene knocked out, which is directly prepared by the above-described method for knocking out the MSH2 gene.
[0013] In a fifth aspect, the present invention provides the use of cells with the MSH2 gene knocked out in the preparation of cell vaccines for the prevention or treatment of tumors.
[0014] In the use of cells with the MSH2 gene knocked out in the preparation of cell vaccines for the prevention or treatment of tumors, the tumor is a tumor containing the MSH2 gene. Preferably, the tumor containing the MSH2 gene includes colorectal cancer, gastroesophageal adenocarcinoma, or endometrial cancer. More preferably, the tumor is colorectal cancer.
[0015] In the use of the aforementioned MSH2 gene knockout cells in the preparation of cell vaccines for the prevention or treatment of tumors, the cell vaccine is a universal cell vaccine. The cell vaccine of this invention, due to its rich presentation of antigens and inclusion of a complete tumor antigen spectrum sharing antigens, can thus achieve cell line therapy for primary tumors. The MSH2 knockout tumor cell vaccine prepared from colorectal cancer tumor cells CT26 can significantly inhibit the subcutaneous growth of breast cancer tumor 4T1 after treatment, inducing a good broad-spectrum anti-tumor effect.
[0016] In a sixth aspect, this invention provides a method for preparing a universal cell vaccine using cells with the MSH2 gene knocked out. The method includes the following steps: irradiating the cells with the MSH2 gene knocked out with 5-100 Gy of X-rays; when the irradiated cells fail to form tumors in normal mice, it indicates that the cell vaccine has been successfully prepared.
[0017] In a seventh aspect, the present invention provides a tumor cell vaccine, which is directly prepared from the above-described method for preparing a universal cell vaccine using cells with the MSH2 gene knocked out.
[0018] In the aforementioned tumor cell vaccine, the therapeutic concentration of the cell vaccine is 1×10⁻⁶. 6 / Only.
[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0020] This invention screened for gRNAs that knocked out the MSH2 gene, constructed a vector for knocking out the MSH2 gene, and further obtained tumor cells with the MSH2 gene knocked out. These tumor cells were then processed into a cell vaccine through a special irradiation process. The results showed that this cell vaccine had good efficacy in both prevention and treatment of primary colorectal cancer, exhibiting broad-spectrum anti-tumor immune memory effects. This invention also further verified that knocking out the MSH2 gene in human pMMR tumor cells can also promote antigen presentation in tumor cells. This invention develops a novel universal cell vaccine, providing a new approach for gene therapy of tumors. Attached Figure Description
[0021] Figure 1 The diagram shows the construction of a mouse tumor cell line with MSH2 knockout; (A) Western blot (WB) shows the knockout of MSH2 protein in CT26 tumor cells; (B) shows the immunohistochemical staining results of CT26 tumor cells with MSH2 protein knockout forming tumors in nude mice.
[0022] Figure 2 The diagram shows the preparation and treatment strategy of the MSH2 knockout tumor cell vaccine; (A) is a flowchart of the subcutaneous inoculation experiment of the tumor cell vaccine; (B) shows mice under different irradiation doses. Msh2 - / - Subcutaneous tumorigenesis of tumor cells; (C) CT26 at different treatment doses Msh2 - / - A diagram illustrating the therapeutic effects of tumor cell vaccines.
[0023] Figure 3 The following diagram shows the therapeutic effect of MSH2 knockout tumor cell vaccine on primary colorectal cancer; (A) Schematic diagram of modeling process and treatment strategy for AOM+DSS primary colorectal cancer; (B) Colonoscopy observation results during CT26 MSH2 knockout tumor cell vaccine treatment; (C) Statistical graph of tumor area and number of tumors in primary colorectal cancer treated with cell vaccine.
[0024] Figure 4 The diagram shows that MSH2 knockout tumor cell vaccine treatment can produce a broad-spectrum anti-tumor immune memory effect; (A) shows the immunoprotective effect of CT26 MSH2 knockout tumor cell vaccine in a prophylactic experiment; (B) shows the experimental results of rechallenging with 4T1 tumor cells after complete tumor regression following CT26 MSH2 knockout tumor cell vaccine treatment; (C) shows the biosafety evaluation diagram after CT26 MSH2 knockout tumor cell vaccine treatment.
[0025] Figure 5The diagram shows the construction of human MSH2 knockout tumor cells; (A) the expression changes of antigen presentation-related proteins TAP1 and TAP2 in CT26 MSH2 knockout tumor cells; (B) the expression changes of antigen presentation-related proteins TAP1 and TAP2 in SW480 MSH2 knockout human colorectal cancer tumor cells. Detailed Implementation
[0026] This invention utilizes gene editing techniques to knock out the MSH2 gene, a key member of the DNA mismatch repair gene family in pMMR colorectal cancer cells. After irradiation, a tumor cell vaccine exhibiting the dMMR phenotype is prepared. This therapeutic cell vaccine significantly inhibits the growth of pMMR tumors and primary colorectal cancer tumors; it also induces broad-spectrum anti-tumor immune memory, inhibiting rechallenge inoculation with allogeneic or xenogeneic tumors. Finally, based on gene editing techniques to knock out the MSH2 protein in human tumor cells, we found that knocking out this gene upregulates the expression of antigen-presenting genes TAP1 and TAP2, consistent with results observed in mouse tumors. This suggests that this tumor cell vaccine may also have good therapeutic effects in human tumor treatment, providing a new possibility for gene therapy of human tumors, especially colorectal cancer.
[0027] The present invention will be described in detail below with reference to specific embodiments and accompanying drawings. In the following embodiments, unless otherwise specified, the experimental conditions are conventional conditions known to those skilled in the art.
[0028] Example 1: Construction of MSH2 gene knockout mouse tumor cells
[0029] The specific steps are as follows:
[0030] 1. Construction of CRISPR-Cas9 targeting vector: CRISPR-Cas9 gene knockout vector for MSH2 protein:
[0031] We obtained the MSH2 sequence of the mouse genome using NCBI (https: / / www.ncbi.nlm.nih.gov / ). Subsequently, based on the first exon sequence of this gene (ATGGCGGTGCAGCCTAAG GAGACGCTGCAGTTGGAAGGCGCGGCCGAGGCGGGCTTCGTGCGCTTCTTTGAGGGCATGCCGGAGAAGCCGAGCACCACGGTGCGCCTCTTCGACCGCGGCGACTTTTACACGGCGCACGGAGAGGACGCGCTGCTGGCGGCCCGCGAGGTGTTCAAGACCCAGGGCGTGATCAAGTACATGGGGCCGGCAG) (SEQ ID NO:1), we obtained the gRNA sequence using the online gRNA design tool website http: / / crispr.dbcls.jp / and designed the gRNA sequence based on the first exon of the MSH2 gene.
[0032] Mice obtained through screening in this application Msh2 The gene gRNA sequence information is as follows:
[0033] Mouse -Msh2- gRNA1: GCGGTCGAAGAGGCGCACCG (SEQ ID NO: 2);
[0034] Mouse- Msh2 -gRNA2: GCACGGAGAGGACGCGCTGC (SEQ ID NO: 3).
[0035] After obtaining the gRNA, the pSpCas9(BB)-2A-GFP (PX458) was first digested at the BbsI restriction site. The gRNA sequence was then phosphorylated and annealed. Following ligation and transformation, a Cas9 gene knockout vector containing the MSH2 gene-targeting gRNA sequence was obtained. Finally, 50 μL (20 ng / μL) of plasmid was isolated, and forward first-generation sequencing was performed using U6-F universal primers to verify the ligation of the gRNA sequence.
[0036] 2. Plasmid infection and cell selection:
[0037] (1) The mouse CT26 tumor cells to be treated were pre-seeded in 6-well plates, with a cell count of 5 × 10⁶ cells / well. 5 / well, and after observing the cells the next day to confirm that they are in good condition, subsequent experiments can be carried out.
[0038] (2) Plasmid transfection was performed using the Lipo3000 transfection reagent method. Two sterile 1.5ml EP tubes were prepared. In the first EP tube, 600ul of Opti-MEM medium and 48ul of Lipo3000 transfection reagent were added and mixed thoroughly to prepare transfection reagent A. In the other EP tube, 600ul of Opti-MEM medium was added, along with 24ug of the Cas9 gene knockout vector containing the MSH2 gene-targeting gRNA sequence and 48ul of P300 reagent, and mixed thoroughly to prepare transfection reagent B. Finally, transfection reagent A was mixed with B and incubated at room temperature for 15min to prepare transfection reagent C.
[0039] (3) Add transfection reagent C to the cell supernatant in the 6-well plate, add 200 μL to each well, mix thoroughly, and then put it back into the cell culture incubator for culture.
[0040] (4) Since the pSpCas9(BB)-2A-GFP (PX458) plasmid has an EGFP tag, the proportion of EGFP-positive tumor cells in the 6-well plate was observed using an inverted fluorescence microscope after 48 hours. When the presence of cells that significantly express EGFP can be seen under the microscope and the proportion of EGFP-positive tumor cells is greater than 70%, the next step can be carried out.
[0041] 3. Fluorescence sorting and monoclonal plating of MSH2 gene knockout tumor cells:
[0042] (1) When more than 70% of the tumor cells in the 6-well plate significantly expressed EGFP green fluorescent protein, we will use trypsin to digest the collected transfected tumor cells, prepare a cell suspension, and then use a BD FACS Aria Fusionflow cytometer to aseptically sort the EGFP strongly positive tumor cells.
[0043] (2) After the cells were sorted, the sorted EGFP positive tumor cells were centrifuged at 1200 rpm for 3 min using a 4-degree centrifuge. The supernatant was then discarded and the cells were resuspended in 10 ml of sterile PBS. The cells were then centrifuged again at 1200 rpm for 3 min until the cells were washed with PBS three times.
[0044] (3) Count the EGFP-positive tumor cells and adjust their cell concentration to 10 cells / ml. Then, spread the cells evenly in a 96-well plate at a concentration of 100 μl / well.
[0045] (4) After the cells are added to the 96-well plate, the wells with single cells in the 96-well plate are identified by microscopic observation. After the single cells are generated to form a monoclonal cell, gene knockout is performed to verify the result.
[0046] 4. Validation of MSH2 gene knockout in tumor cells:
[0047] (1) After obtaining MSH2 gene knockout tumor cells, we first collected the MSH2 gene knockout tumor cells, prepared protein samples according to standard procedures, and then verified the changes in MSH2 protein levels using Western blotting experiments. The results are as follows: Figure 1 As shown in Figure A, compared to control CT26 cells, the modified tumor cells showed a significant loss of MSH2 protein expression.
[0048] (2) After in vitro experiments confirmed the significant loss of MSH2 protein, we used CT26 Msh2 - / - Cells at 5 × 10 6 CT26 cells were subcutaneously injected into nude-BALB / c mice at a concentration of 100 μL per mouse. Another group of nude-BALB / c mice was injected with the same concentration of CT26 cells as a control. Subcutaneous tumor tissue was collected from the nude mice after 15 days and immunohistochemically stained with MSH2 antibody. Results are as follows: Figure 1 As shown in Figure B, it can be seen that in the mouse in vivo environment, compared to CT26 cells, CT26... Msh2 - / - The cells still showed a significant deficiency of the MSH2 protein.
[0049] In summary, this experiment successfully constructed MSH2 knockout tumor cells.
[0050] Example 2: Preparation of MSH2 knockout tumor cell vaccine
[0051] 1. Experimentally explore CT26 Msh2 - / - The optimal safe irradiation dose for tumor cells, and the specific operating procedures are as follows: Figure 2 As shown in A, the specific operating steps are as follows:
[0052] (1) We collected CT26 Msh2 - / - Tumor cells, their concentration adjusted to 1×10 7 / ml.
[0053] (2) Subsequently, 0Gy irradiation group, 5Gy irradiation group, 10Gy irradiation group and 15Gy irradiation group were set in the 0-20 Gy gradient. Then, the irradiated tumor cells were subcutaneously inoculated into normal Balb / c mice, with 100ul inoculated into each mouse.
[0054] (3) Tumor growth was observed over a long period, and the tumor growth of each group of mice was statistically analyzed after one year. The irradiation dose of mice without tumor growth was used as the dose for preparing tumor cell vaccines. In this experiment, CT26 mice were irradiated at doses above 5 Gy. Msh2 - / - Subcutaneous inoculation of tumor cells did not result in significant tumorigenesis, such as Figure 2 As shown in B. Therefore, this experiment ultimately used 5 Gy as the optimal irradiation dose for subsequent research experiments, while the control CT26 cells were still prepared using the standard 60 Gy.
[0055] 2. Explore CT26 through experiments Msh2 - / - Optimal therapeutic dose for tumor cells
[0056] (1) First we collect CT26 Msh2 - / - Tumor cells, and the therapeutic dose for tumor cells was adjusted to 2.5 × 10⁻⁶. 5 5 × 10 cells / animal 5 1 cell / each and 1×10 6 Cells / animal were then subjected to 5 Gy X-ray irradiation to prepare CT26. Msh2 - / - Tumor cell vaccine.
[0057] (2) Forty 6-week-old BALB / c mice were prepared, and then subcutaneous tumors were inoculated into the right side of the mice using the CT26 wild-type cell line at a concentration of 5 × 10⁻⁶. 5 Cell / animal
[0058] (3) Four days after inoculation, tumor-bearing mice were randomly divided into four groups of 10 mice each: PBS treatment group, PBS treatment group, and PBS treatment group. 5 5 × 10 cells / treatment group 5 1 cell / each treatment group and 1×10 6 We administered CT26 to mice in each cell / mouse treatment group, and then, based on the group name, administered different concentrations of CT26 to each group of mice. Msh2 - / - Mice were vaccinated with tumor cell vaccine on the left side. After treatment, mice were tagged with ear tags and then treated twice more, on days 7 and 10.
[0059] (4) The tumor volume was measured every 3 days after subcutaneous tumor inoculation in mice. Tumor volume (mm) 3 = (length × width) 2 ) / 2, in the PBS treatment group, the tumor volume was greater than 2000 mm. 3 The statistical analysis was stopped at that time, and the differences in treatment effects among the various treatment groups were compared.
[0060] Experimental results are as follows Figure 2 As shown in C, using 1×10 6 The treatment concentration of 1 × 10⁵ cells / animal achieved the best therapeutic effect. Therefore, in subsequent experiments, we used a concentration of 1 × 10⁵ cells / animal.6 Experiments were conducted at therapeutic concentrations per cell / animal.
[0061] Example 3: Therapeutic effect of MSH2 knockout tumor cell vaccine in mouse primary tumor model
[0062] To investigate the therapeutic effect of MSH2 knockout tumor cell vaccine in a primary colorectal cancer model, we first established a mouse primary colorectal cancer model using AOM+DSS. After colonoscopy revealed precancerous lesions in the mouse intestines, we administered subcutaneous MSH2 knockout tumor cell vaccine treatment and collected the results. The specific treatment procedure is as follows:
[0063] (1) Purchase 6-week-old BALB / c mice to construct an AOM+DSS primary colorectal cancer tumor model. First, inject the carcinogenic chemical mutagen Azoxymethane (AOM) into the mice intraperitoneally at a dose of 10 mg / kg. Then, in the 1st, 4th and 7th weeks, feed the mice water containing 2% Dextran sodium sulphate (DSS) for one week each time. During the model construction process, the tumor formation of the mice is observed every week using a small animal colonoscope.
[0064] (2) After the tumors were observed, the mice were randomly divided into the PBS group, the CT26 cell vaccine treatment group, and the CT26 group. Msh2 - / - Cellular vaccine treatment group, 15 animals in each group.
[0065] (3) Subsequently, PBS solution and CT26 tumor cell vaccine (1×10⁻⁶) were used respectively. 6 (cells / animal) and CT26 Msh2 - / - Tumor cell vaccine (1×10) 6 The mice were treated with subcutaneous injections of 1 cell per mouse, once every 4 days, for a total of 3 times a month. The growth of intestinal tumors in the mice was observed using colonoscopy after each treatment.
[0066] (4) After 6 treatments, the treatment experiment was stopped, and the mice were sacrificed in the 11th week. The colon tissue was dissected, and the length of the colon and rectum, the surface area of the tumor and the number of tumor nodules in each group of mice were counted.
[0067] Experimental results are as follows Figure 3 As shown: According to Figure 3 The tumor modeling and treatment process shown in A, and the colonoscopy observation results are as follows: Figure 3 As shown in Figure B, at day 30, the intestinal lesions of mice in all three groups had the same level of precancerous lesions. With subsequent treatment, at day 58, compared to the PBS group and the CT26 cell vaccine treatment group, CT26... Msh2 - / - The mice in the tumor cell vaccine treatment group had smaller primary tumor tissue areas in their intestines. At 75 days, we statistically analyzed the tumor growth status of the mice's intestines, and the results are as follows: Figure 3 C shows that CT26 is visible. Msh2 - / - The tumor cell vaccine treatment group significantly inhibited the growth of primary tumors in the mouse intestine. In conclusion, CT26... Msh2 - / - Tumor cell vaccines have broad-spectrum anti-tumor therapeutic effects.
[0068] Example 4: Broad-spectrum antitumor effect of MSH2 knockout tumor cell vaccine in vaccine protection experiment
[0069] To investigate the therapeutic efficacy of MSH2 knockout tumor cell vaccines in a primary colorectal cancer model, we conducted allogeneic tumor vaccine protection experiments and xenograft rechallenge experiments on mice with completely regressed tumors, and evaluated the safety of vaccine-induced anti-tumor immunity. The specific experimental procedure is as follows:
[0070] 1. Tumor prophylaxis experiment of MSH2 gene knockout tumor cell vaccine:
[0071] (1) Twenty 6-week-old BALB / c mice were prepared and divided into PBS treatment group and CT26 group. Msh2 - / - Cellular vaccine treatment group, 10 animals in each group.
[0072] (2) In the PBS treatment group compared with CT26 Msh2 - / - Mice in the cell vaccine treatment group were subcutaneously inoculated with 100 μl of PBS and 100 μl of CT26 on the left side, respectively. Msh2 - / - The patient received a cell vaccine, followed by treatment every other week for a total of three treatments.
[0073] (3) After three treatments, subcutaneous tumors were inoculated into the right side of the mice using the CT26 cell line at a concentration of 5 × 10⁻⁶ cells. 5 1 cell / animal; tumor volume was measured every 3 days after inoculation, and in the PBS treatment group, the tumor volume was greater than 2000 mmHg. 3 CT26 was stopped and analyzed at that time. Msh2 - / - The tumor-preventive effects of cell vaccines.
[0074] 2. Xenograft tumor re-challenge experiment:
[0075] (1) When using CT26 Msh2 - / -If the CT26 tumor in the right subcutaneous tissue completely regresses after the cell vaccine treatment experiment, and there is no tumor recurrence within 2 months of feeding, we will use CT26 tumor-regressed mice to conduct a tumor re-challenge experiment.
[0076] (2) We collected mice with complete remission of CT26 tumors after treatment as the experimental group (CT26 tumor-free mice group) and age-matched mice that were not inoculated with tumor cells as the control group (Naïve mice group); subsequently, we subcutaneously inoculated both groups of mice with 4T1 cell line at a concentration of 5 × 10⁻⁶. 5 Cell / animal
[0077] (3) Tumor volume was measured in mice every 3 days after inoculation. Tumor volume in the Naïve mice group was greater than 2000 mm. 3 The growth of 4T1 tumor cells was statistically analyzed and stopped at a certain point.
[0078] 3. Safety evaluation of the therapeutic effect of cell vaccine:
[0079] (1) Purchase 20 6-week-old BALB / c mice and feed them at a rate of 5 × 10⁶ mice per 1000 mice. 5 CT26 cells were subcutaneously injected into the right side of mice at a dose of 10 cells / mouse. Four days later, mice were randomly divided into two groups of 10 mice each: a PBS group and a CT26 group. Msh2 - / - Vaccine treatment group.
[0080] (2)CT26 Msh2 - / - Mice in the vaccine treatment group were treated according to the above-mentioned cell vaccine treatment strategy, followed by CT26 inoculation, and the tumor volume of mice was measured every 3 days.
[0081] (3) When the tumor size in the PBS group was greater than 2000 mm 3 , and CT26 Msh2 - / - When the tumor volume in the vaccine treatment group was significantly lower than that in the PBS group, compared with the PBS group and CT26 Msh2 - / - Mice in the vaccine treatment group were euthanized, and tissues from the heart, liver, spleen, lungs, and kidneys were removed, fixed, sectioned, and stained with H&E.
[0082] (4) After the H&E sections are prepared, observe and photograph them under a microscope, and examine CT26. Msh2 - / - Physiological evaluation of organ outcomes in the tumor cell vaccine treatment group.
[0083] Experimental results are as follows Figure 4 As shown: In a tumor prophylaxis trial, compared to the PBS group, CT26... Msh2 - / - Vaccines can significantly prevent the occurrence and development of CT26 tumors. Figure 4 A). In the xenograft tumor rechallenge experiment, compared with the subcutaneous growth of 4T1 tumors in naïve mice, the growth of 4T1 tumors in the CT26 tumor complete regression group was significantly inhibited. This indicates that CT26 Msh2 - / - Vaccine-induced antitumor immune protection has a broad spectrum ( Figure 4 B). In the safety evaluation results, we can find that, compared with the PBS group, CT26 Msh2 - / - No significant inflammation or tissue damage was observed in the heart, liver, spleen, lungs, and kidneys of the mice in the vaccine treatment group. Figure 4 C). In summary, MSH2 knockout tumor cell vaccines can induce broad-spectrum anti-tumor immune protection and have good biocompatibility.
[0084] Example 5: Knockout of Human pMMR Tumor Cells MSH2 The gene can achieve antigen presentation enhancement consistent with murine tumor cells.
[0085] 1. Human resources MSH2 Construction of gene-deleted tumor cells
[0086] To knock out human tumor cells MSH2 For gene-related experiments, we selected SW480 cells. The plasmid construction, cell transfection, cell sorting, and monoclonal screening methods were consistent with those used for constructing mouse MSH2-deficient tumor cells, ultimately yielding SW480 cells. MSH2 - / - Tumor cells. We are based on human-derived... MSH2 The nucleotide sequence of the first exon of the gene was used to design the gRNA sequence, which is of human origin. MSH2 The nucleotide sequence of the first exon of the gene is named SEQ ID NO:4, and the specific nucleotide sequence is: ATGGCGGTGCAGCCGAAGGAGACGCTGCAGTTGGAGAGCGCGGCCGAGGTCGGCTTCGTGCGCTTCTTTCAGGGCATGCCGGAGAAGCCGACCACCACAGTGCGCCTTTTCGACCGGGGCGACTTCTATACGGCGCACGGCGAGGACGCGCTGCTGGCCGCCCGGGAGGTGTTCAAGACCCAGGGGGTGATCAAGTACATGGGGCCGGCAG.
[0087] The specific sequence information of the gRNA sequence is as follows:
[0088] Human- MSH2 -gRNA1:CCACAGTGCGCCTTTTCGAC (SEQ ID NO:5);
[0089] Human- MSH2 -gRNA2:GAAGCGCACGAAGCCGACCT (SEQ ID NO: 6).
[0090] 2. Western blot was used to verify the expression of the key antigen presentation proteins TAP1 and TAP2.
[0091] After obtaining SW480 MSH2 - / - After collecting tumor cells, we will collect CT26. Msh2 - / - SW480 and SW480 MSH2 - / - Cells were used to prepare Western blotting (WB) samples according to the standard WB protein sample preparation procedure. Subsequently, WB experiments were conducted to investigate the relationship between CT26 and CT26. Msh2 - / - Between SW480 and SW480 MSH2 - / - The differences in TAP1 and TAP2 protein expression were observed between the individuals. The experimental results are as follows:
[0092] To investigate whether knocking out the MSH2 gene in human pMMR tumor cells could enhance their immunogenicity, we redesigned a gRNA sequence targeting the human MSH2 gene and obtained MSH2-knockout SW480 tumor cells through gene editing. Subsequently, Western blotting experiments confirmed that MSH2 knockout in CT26 cells promoted the expression of antigen-presenting related proteins TAP1 and TAP2. Figure 5 A), and knocking out MSH2 with SW480 also yielded consistent results. Figure 5 B). The above results demonstrate that knocking out MSH2 in human pMMR tumor cells can also promote antigen presentation in tumor cells, consistent with the effect of knocking out MSH2 in murine pMMR tumor cells.
[0093] In summary, this application provides a method for preparing tumor cell vaccines by knocking out the MSH2 gene. The vaccines prepared by knocking out the MSH2 gene in mice have good effects on the prevention or treatment of mouse tumors. Furthermore, knocking out the MSH2 gene in human tumor cells can also promote antigen presentation in tumor cells, which is consistent with the effect of knocking out the MSH2 gene in mouse pMMR tumor cells. It is predicted that a better anti-tumor effect can be achieved.
Claims
1. The use of gRNA knocked out of the mouse MSH2 gene, gRNA knocked out of the human tumor cell MSH2 gene, or colorectal cancer cells knocked out of the MSH2 gene in the preparation of cell vaccines for the prevention or treatment of tumors; wherein the gRNA knocked out of the mouse MSH2 gene is gRNA1 with a nucleotide sequence as shown in SEQ ID NO:2 and gRNA2 with a nucleotide sequence as shown in SEQ ID NO:3; the gRNA knocked out of the human tumor cell MSH2 gene is gRNA3 with a nucleotide sequence as shown in SEQ ID NO:5 and gRNA4 with a nucleotide sequence as shown in SEQ ID NO:6; wherein the tumor to be prevented or treated is a tumor containing the MSH2 gene, and the tumor containing the MSH2 gene is colorectal cancer.
2. A method for preparing a colorectal cancer cell vaccine from colon cancer cells with the MSH2 gene knocked out, characterized in that, Includes the following steps: Colon cancer cells with the MSH2 gene knocked out were irradiated with 5-100 Gy of X-rays. When the irradiated cells could not form tumors in normal mice, it indicated that the cell vaccine had been successfully prepared.
3. A colorectal cancer tumor cell vaccine, characterized in that: It is prepared directly from the method for preparing colorectal cancer cell vaccine from colon cancer cells with the MSH2 gene knocked out as described in claim 2.