Application of cerebral hemorrhage related marker Hmmr gene

Through in vivo imaging using the third-generation RUSH confocal microscope and the two-photon synthetic aperture microscope 2pSAM, it was discovered that the Hmmr gene is associated with cerebral hemorrhage. The development of the Hmmr gene as a marker has solved the difficulties in the diagnosis and treatment of cerebral hemorrhage and provided new molecular diagnostic tools and treatment options.

CN120719014AActive Publication Date: 2025-09-30TSINGHUA UNIVERSITY
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511206609.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-27
Publication Date
2025-09-30
Estimated Expiration
2045-08-27

AI Technical Summary

Technical Problem

Existing technologies lack effective animal models and imaging platforms, making it difficult to observe the natural evolution of cerebral hemorrhage in the subarachnoid space or inside and outside the dura mater. There is also a lack of efficient treatment options for cerebral hemorrhage, leading to difficulties in diagnosis and treatment.

Method used

Using the third-generation RUSH confocal microscope and the two-photon synthetic aperture microscope 2pSAM for in vivo imaging, combined with backlight imaging strategy, it was found that the Hmmr gene and its positive cells are related to the absorption and repair process of intracerebral hemorrhage hematoma. The Hmmr gene is developed as a marker for cerebral hemorrhage for diagnosis, monitoring and treatment.

Benefits of technology

It has achieved efficient diagnosis, monitoring and treatment response evaluation of cerebral hemorrhage, provided new molecular diagnostic tools, and supported the development and screening of therapeutic drugs for cerebral hemorrhage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120719014A_ABST
    Figure CN120719014A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of markers, in particular to application of a cerebral hemorrhage related marker Hmmr gene. A new marker Hmmr related to cerebral hemorrhage is found through screening, diagnosis, monitoring, treatment response evaluation and prognosis judgment of cerebral hemorrhage can be achieved through the marker, and meanwhile the marker can serve as a target spot of cerebral hemorrhage treatment chemical drugs and biological drugs and is used for screening and developing cerebral hemorrhage treatment drugs. The invention provides a novel molecular diagnosis tool for cerebral hemorrhage, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of markers, and in particular to the application of Hmmr gene, a marker related to cerebral hemorrhage. Background Art

[0002] With the acceleration of industrialization, cerebral hemorrhage caused by traffic accidents and trauma has become a global public health focus: high incidence, high mortality and disability rates, heavy burden of long-term care for survivors, and the unclear mechanism of hematoma clearance seriously restricts the development of efficient and low-cost treatment options.

[0003] The brain is covered by three layers of meninges: the dura mater, the arachnoid mater, and the pia mater. The pia mater, along with blood vessels, forms the choroid plexus and secretes cerebrospinal fluid. The meninges serve as the brain's "exoskeleton" and are rich in immune cells and fibroblasts, which maintain central immune homeostasis. The brain accounts for only 2–3% of body weight but consumes over 20% of the body's energy, making it extremely dependent on blood supply. If trauma or pathology ruptures intracranial blood vessels, blood can flow into the meningeal space, immediately threatening neurological function and life. Types of intracerebral hemorrhage include subarachnoid hemorrhage (SAH) and dura-related hemorrhage.

[0004] Previous studies have demonstrated that red blood cells in SAH can be phagocytosed or drained to deep cervical lymph nodes by microglia. However, in vivo, single-cell resolution, and full-scale observation of the entire process has long been lacking. The reasons are: 1. The lack of an animal model that truly simulates the disease. Traditional models (autologous blood intraventricular injection and collagenase induction) cannot reproduce the natural evolution of hematomas within the subarachnoid space or within or outside the dura mater. 2. The lack of a large-field-of-view, high-resolution, and long-duration imaging platform that covers centimeter-scale wounds. Existing CT / MRI systems struggle to balance spatial, temporal, and cellular scales. To address this, the inventors, along with their co-mentor, Academician Dai Qionghai's team, focused on developing the third-generation RUSH confocal microscope (6 × 4.2 mm² imaging area, single-cell resolution, 4 Hz imaging frequency) and the two-photon synthetic aperture microscope (2pSAM). Furthermore, they employed an innovative backlight imaging strategy, achieving, for the first time, continuous three-week in vivo tracking of the entire wound surface at the single-cell level in a mouse model of spontaneous meningeal hemorrhage induced by mechanical injury. Experiments have revealed that within 24 hours of hemorrhage, the wound surface is enveloped by a previously unseen layer of tissue. This tissue continuously contracts at a rhythmic rate of 1-3 Hz, breaking centimeter-sized blood clots into microemboli approximately 10 µm in size through continuous deformation and traction, significantly accelerating the disintegration and clearance of hematomas. The inventors named it Mesher (Meningeal space hemorrhage repairer), which translates to "grid tissue" in Chinese. This discovery provides a novel approach to uncovering the physiological mechanisms of meningeal space hemorrhage clearance and developing therapies that promote endogenous repair.

[0005] The Hmmr gene (Hyaluronan-mediated motility receptor, also known as RHAMM, Receptor for Hyaluronan-Mediated Motility) is a key gene encoding a hyaluronan (HA)-mediated cell motility receptor. Prior art CN 115851952 A discloses that this gene can be used as a biomarker for the prognosis of head and neck squamous cell carcinoma, and CN 106119405 A discloses that this gene, in combination with other genes, can be used as a prognostic marker for lung cancer. Summary of the Invention

[0006] By performing single-cell sequencing on a mechanically injured mouse model of intracerebral hemorrhage and creating Hmmr-EGFP transgenic mice, and then verifying the mechanical injury hemorrhage model with in vivo animal imaging, the researchers discovered that the Hmmr gene and its positive cells are closely related to the absorption and repair of hematomas after intracerebral hemorrhage. Specifically, after an intracerebral hemorrhage, Hmmr gene expression and the number of positive cells increased significantly, while Hmmr-positive cells disappeared after hematoma absorption. Furthermore, Hmmr-positive cells were detected in samples removed from human subdural hemorrhage surgery, with a significant increase in their number compared to a normal control group.

[0007] Based on this, the Hmmr gene or its positive cells can be used as markers for the diagnosis, monitoring, treatment response assessment, and prognosis of cerebral hemorrhage, and can also serve as targets for chemical drugs and biological drugs to treat cerebral hemorrhage. Therefore, the following technical solution is proposed.

[0008] In a first aspect, the present invention provides use of a reagent for detecting Hmmr gene or its positive cells in preparing a product; the product is used for diagnosing cerebral hemorrhage.

[0009] In a second aspect, the present invention provides use of a reagent for detecting Hmmr gene or its positive cells in preparing a product; the product is used for monitoring cerebral hemorrhage.

[0010] In a third aspect, the present invention provides use of a reagent for detecting Hmmr genes or Hmmr-positive cells thereof in preparing a product; the product is used to evaluate the therapeutic response of a drug for treating cerebral hemorrhage.

[0011] In a fourth aspect, the present invention provides use of a reagent for detecting Hmmr gene or its positive cells in preparing a product; the product is used for the prognosis of cerebral hemorrhage.

[0012] In some embodiments, the product includes: a chip, a test paper, a drug, a formulation, a reagent, a kit, or a high-throughput screening platform.

[0013] In some embodiments, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells increases with the amount of cerebral hemorrhage.

[0014] In some embodiments, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells increases in an organism with cerebral hemorrhage compared to a healthy organism; as the hematoma is absorbed, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells decreases to the level of a healthy organism.

[0015] In some embodiments, the reagent is a reagent for detecting the Hmmr gene or its positive cells in a subject or a sample from a subject.

[0016] In a specific implementation process, the reagents include but are not limited to reagents for detecting the expression level of the Hmmr gene or the number of Hmmr gene-positive cells by RT-PCR, real-time quantitative PCR, immunoassay (such as ELISA, RIA, multiple immunoassay, immunofluorescence assay, protein blot, or dot blot assay), flow cytometry, in situ hybridization or chip technology.

[0017] In some embodiments, the sample is a blood sample.

[0018] In a fifth aspect, the present invention provides the use of Hmmr genes or positive cells thereof in the diagnosis, monitoring, treatment response evaluation or prognosis of cerebral hemorrhage.

[0019] In some embodiments, the present invention provides a method for diagnosing, monitoring, evaluating treatment response or judging prognosis of cerebral hemorrhage, comprising: detecting the expression level or activity of the Hmmr gene or Hmmr protein in a subject or a sample from the subject.

[0020] In some embodiments, when the expression level or activity of the Hmmr gene or Hmmr protein in the subject or in a sample from the subject is higher than the expression level or activity of the Hmmr gene or Hmmr protein in a healthy organism, it indicates that the subject has experienced cerebral hemorrhage or has an increased risk of cerebral hemorrhage, or has a poor treatment response or a poor prognosis.

[0021] In some embodiments, when the expression level or activity of the Hmmr gene or Hmmr protein in a subject or a sample from the subject is comparable to the expression level or activity of the Hmmr gene or Hmmr protein in a healthy organism, it indicates that the subject has not suffered from cerebral hemorrhage or has a lower risk of cerebral hemorrhage, or has a good treatment response or a good prognosis.

[0022] In a sixth aspect, the present invention provides use of a regulator of Hmmr gene or Hmmr protein expression or activity in the treatment of cerebral hemorrhage.

[0023] Since the Hmmr gene or protein of the present invention can serve as a target for chemical drugs and biological drugs for treating cerebral hemorrhage, its related regulators can treat cerebral hemorrhage by targeting the Hmmr gene or protein.

[0024] In a seventh aspect, the present invention provides use of a regulator of Hmmr gene or Hmmr protein expression or activity in the preparation of a medicament for treating cerebral hemorrhage.

[0025] In some embodiments, the modulator of Hmmr gene or Hmmr protein expression or activity comprises an inhibitor or antagonist.

[0026] In specific implementations, inhibitors and / or antagonists refer to any substance that can reduce the expression of a nucleic acid encoding Hmmr, reduce the level of an Hmmr protein, or inhibit the activity of an Hmmr. For example, a substance that reduces the activity of an Hmmr protein, reduces the stability of an Hmmr gene or protein, downregulates the expression of an Hmmr, reduces the effective duration of an Hmmr protein, or inhibits the transcription and translation of an Hmmr.

[0027] Preferably, the inhibitor or antagonist includes but is not limited to: nucleic acid inhibitors, protein inhibitors, proteolytic enzymes, protein binding molecules; and combinations thereof.

[0028] Among them, the nucleic acid inhibitor is selected from: interfering molecules that use Hmmr or its transcript as the target sequence and can inhibit Hmmr gene expression or gene transcription, including: shRNA (small hairpin RNA), small interfering RNA (siRNA), dsRNA, microRNA, or a construct that can express or form the shRNA, small interfering RNA, dsRNA, microRNA.

[0029] Among them, the protein binding molecule is selected from: substances that specifically bind to Hmmr proteins, such as antibodies or ligands that can inhibit the activity of Hmmr proteins; competitors for Hmmr ligand binding sites, including Hmmr receptors and their ligand binding fragments, soluble truncated Hmmr receptors, soluble Hmmr receptor fusion proteins, such as Hmmr fusion proteins containing the Fc portion of IgG immunoglobulins, ligand fusion proteins; peptidomimetics; peptide inhibitors; small molecule compounds; and combinations thereof.

[0030] In an eighth aspect, the present invention provides a composition, a medicament, a preparation or a therapeutic kit comprising a regulator of Hmmr gene or Hmmr protein expression or activity.

[0031] In some embodiments, the composition, drug, preparation or treatment kit further comprises other drugs for treating cerebral hemorrhage.

[0032] In some embodiments, the composition, medicament, formulation or therapeutic kit further comprises one or more pharmaceutically acceptable excipients, vehicles, carriers and / or vehicles.

[0033] In a ninth aspect, the present invention provides a kit for diagnosing, monitoring, evaluating treatment response or judging prognosis of cerebral hemorrhage, which contains a reagent for detecting the expression or activity of the Hmmr gene or Hmmr protein.

[0034] In a tenth aspect, the present invention provides a method for screening candidate drugs for treating cerebral hemorrhage, comprising: treating a system expressing or containing Hmmr gene or Hmmr protein with a substance to be screened, and detecting the expression level or activity of the Hmmr gene or Hmmr protein in the system before and after treatment.

[0035] Preferably, the expression level or activity of the Hmmr gene or Hmmr protein in the system after treatment is lower than the expression level or activity of the Hmmr gene or Hmmr protein in the system before treatment, indicating that the substance to be screened is a candidate drug for treating cerebral hemorrhage.

[0036] Preferably, the system includes (but is not limited to): a cell system, a subcellular system, a solution system, a tissue system, an organ system or an animal system.

[0037] Preferably, the candidate drugs include (but are not limited to): interfering molecules, nucleic acid inhibitors, and small molecule compounds designed for the Hmmr gene or its upstream or downstream genes.

[0038] Preferably, the Hmmr gene-positive cells of the present invention include fibroblasts, myofibroblasts or macrophages.

[0039] Compared with the prior art, the present invention has the following beneficial effects: This study has identified a novel marker associated with cerebral hemorrhage, Hmmr, which can be used for diagnosis, monitoring, treatment response assessment, and prognosis assessment of cerebral hemorrhage. Furthermore, this marker can serve as a target for chemical and biological drugs for the treatment of cerebral hemorrhage, enabling the screening and development of therapeutic drugs. This study provides a new molecular diagnostic tool for cerebral hemorrhage and holds broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The results of single-cell sequencing and immunofluorescence experiments are shown. A shows the cell types of different clusters; B shows the tSNE clustering of different cells; C shows the expression of Hmmr; D shows the immunofluorescence staining verification result, which shows that the Hmmr signal increases after hemorrhage; E shows the quantitative analysis of fluorescence intensity; NT is the control group, n = 3 mice; MSH is the model group, n = 3 mice; P< 0.05.

[0041] Figure 2 is the ROC analysis curve of Hmmr expression.

[0042] Figure 3 The results are the validation results of Hmmr distribution in human subdural hematoma samples; A is the U-MAP cluster diagram showing the clustering of the normal healthy group HC (n=2), 14 dph (n=2), 30 dph (n=2) and 60 dph (n=2); B is the distribution of Hmmr in all sample clusters (n=8); C is the display of Hmmr gene expression in each sample; HC represents the healthy control group, and dph represents the number of days after hemorrhage. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of embodiments of the present invention, rather than all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. In the embodiments provided in this specification, those without specifying specific techniques or conditions are described in accordance with the techniques or conditions described in the literature in this area, or are carried out according to product specifications. Reagents or instruments used are not specified by manufacturer and are conventional products that can be purchased through regular channels.

[0044] Example 1 Screening of markers related to cerebral hemorrhage This example uses a mouse cerebral hemorrhage model to screen for cerebral hemorrhage-related markers, and the steps are as follows: 1. Cranial windows were implanted in standard B6 mice at 6-8 weeks of age. A syringe was used to slightly injure the cerebral vessels, causing spontaneous bleeding after the cranial window implantation, simulating the bleeding process after clinical brain injury. Successful modeling was considered when the bleeding covered at least 30% of the cranial window area. Mice were divided into three groups: a control group (also known as the untreated, normal, or NT group) and three mice in the model group (also known as the hematoma or MSH group).

[0045] 2. Single-cell sequencing of successfully modeled mice was used to compare the normal and model groups, and genes with high expression in the model group were screened. Candidate genes were verified by immunofluorescence.

[0046] 3. After the candidate gene is verified, Hmmr-EGFP transgenic mice are produced, which are fluorescently labeled. The method for producing Hmmr-EGFP transgenic mice is as follows: Using CRISPR / Cas-mediated gene knock-in technology, (1) the TAG stop codon of the pclaf gene was replaced with the "3xEAAAK-EGFP-P2A-CreERT2" expression cassette. (2) When constructing the donor vector, the BAC clone RP23-177B17 was used as a template, and homology arms were generated by PCR technology. (3) To prepare genetically engineered mice, Cas9 protein, gRNA, and the donor vector were co-injected into fertilized eggs. (4) The born pups were preliminarily genotyped by PCR and subsequently confirmed by sequencing analysis.

[0047] The gRNA sequence is: AGATGCAACTTCAAGAATCATGG 4. Generate a transgenic mouse model according to the method in step 1, and perform two-photon and wide-field microscopic imaging using the third-generation RUSH imaging system RUSHconfocal to observe the relationship between the hematoma absorption process and the candidate gene.

[0048] The screening results of single-cell sequencing and immunofluorescence experiments are as follows Figure 1 As shown, by comparing the single-cell sequencing results of mice in the model group and the control group, it was found that the Hmmr signal was specifically concentrated in the cell population that increased after hemorrhage. The results of immunofluorescence experiments showed that the Hmmr signal in the model group was significantly increased compared with the control group (P < 0.05).

[0049] Example 2 This example performed a specificity-sensitivity (ROC) analysis on the cerebral hemorrhage-related marker Hmmr screened in Example 1. Specifically, ROC analysis was performed on the Hmmr gene expression levels in 3 control group mice (13 immunofluorescence images) and 3 model group mice (14 immunofluorescence images). The ROC curve is shown in Figure 2. Figure 2 As shown in the results, the receiver operating characteristic (ROC) 95% confidence interval (CI) ranged from 0.5206 to 0.9410, with a P < 0.05 and an area under the curve (AUC) of 0.7038. Furthermore, the sensitivity reached a maximum of 92.6%, while the specificity was 64.29% at 100%. This result demonstrates that Hmmr protein expression is highly specific in mouse samples with intracerebral hemorrhage. Using Hmmr to diagnose intracerebral hemorrhage demonstrates strong specificity and sensitivity.

[0050] Example 3 In this example, human samples were used to validate the cerebral hemorrhage-related marker Hmmr. The following steps were used: Meningeal tissue was obtained from two healthy individuals (control group, HC) and six patients with subdural hemorrhage at Yijishan Hospital, Wannan Medical College. The bleeding occurred at 14 days (dph), 30 days (dph), and 60 days (dph) after the onset of hemorrhage (two patients each). All experiments were conducted with the approval of the Yijishan Hospital Ethics Committee (Approval No. 2024-186). Single-cell sequencing was performed to analyze the expression of the Hmmr gene in different clinical samples, and the temporal changes in these samples were analyzed.

[0051] The experimental results are as follows Figure 3 The results showed that the mean relative expression of the Hmmr gene in the healthy control group was 0.0175, while in the hemorrhagic disease group, the mean relative expression of the Hmmr gene was 0.1372. Further analysis revealed that Hmmr gene expression in human samples exhibited a temporal distribution consistent with hematoma absorption. Specifically, Hmmr gene expression levels were extremely low in normal human meningeal tissue, reaching a peak fourteen days after hemorrhage, then gradually decreasing after thirty days. After sixty days, Hmmr gene expression levels approached those in normal human meningeal tissue. These results indicate that Hmmr gene expression exhibits consistent temporal changes with the development, progression, and absorption of hematomas following intracerebral hemorrhage, suggesting that Hmmr can serve as a marker for intracerebral hemorrhage.

[0052] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. Use of a reagent for detecting Hmmr gene or its positive cells in the preparation of a product; the product is used for diagnosing cerebral hemorrhage.

2. Use of a reagent for detecting the Hmmr gene or its positive cells in the preparation of a product; the product is used to monitor cerebral hemorrhage.

3. Use of a reagent for detecting the Hmmr gene or its positive cells in the preparation of a product; the product is used to evaluate the therapeutic response of a drug for treating cerebral hemorrhage.

4. Use of a reagent for detecting the Hmmr gene or its positive cells in the preparation of a product; the product is used for the prognosis of cerebral hemorrhage.

5. The use according to any one of claims 1 to 4, characterized in that The products include: chips, test strips, drugs, preparations, reagents, kits or high-throughput screening platforms.

6. The use according to any one of claims 1 to 4, characterized in that The expression of Hmmr gene or the number of Hmmr gene positive cells increased with the increase of cerebral hemorrhage volume.

7. The use according to any one of claims 1 to 4, characterized in that Compared with healthy subjects, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells in subjects with cerebral hemorrhage increased; as the hematoma was absorbed, the expression level of the Hmmr gene or the number of Hmmr gene-positive cells decreased to the level of healthy subjects.

8. Use of a regulator of Hmmr gene or Hmmr protein expression or activity in the preparation of a medicament for treating cerebral hemorrhage.

9. A method for screening candidate drugs for treating cerebral hemorrhage, characterized in that: include: The system expressing or containing the Hmmr gene or Hmmr protein is treated with the substance to be screened, and the expression level or activity of the Hmmr gene or Hmmr protein in the system before and after the treatment is detected.

10. The method according to claim 9, characterized in that The expression level or activity of the Hmmr gene or Hmmr protein in the system after treatment is lower than the expression level or activity of the Hmmr gene or Hmmr protein in the system before treatment, indicating that the substance to be screened is a candidate drug for treating cerebral hemorrhage.

Citation Information

Patent Citations

  • Prognosis marker for lung cancer, method for anticipating lung cancer prognosis by using marker and application of marker

    CN106119405A

  • Biomarker for prognosis diagnosis of head and neck squamous cell carcinoma as well as screening method and application of biomarker

    CN115851952A

  • Blood exosome molecular marker and application thereof in preparation of liver cancer diagnosis product

    CN116121374A

  • Use of HMMR ligands

    CN119174811A

  • Liver cancer-specific biomarker

    US20210254174A1