Application of mulberroside A in preparation of medicine for preventing and treating Alzheimer's disease

Abstract

The invention belongs to the field of biological medicine, and discloses application of mulberroside A in preparation of a medicine for preventing and treating Alzheimer's disease, and behavioral detection, histological and biochemical detection, cell experiment and biochemical index detection are carried out based on a constructed animal model. It is determined that the medicine prepared from mulberroside A can improve the new and old object recognition ability, improve spatial memory and cognitive functions, reduce loss of hippocampus and cortical neurons, regulate hippocampus and cortical cholinergic metabolism, up-regulate the expression ability of BDNF and CREB of hippocampus and cortical, enhance the cholinergic system function of N2a / APP695 cells and reduce oxidative damage. The mulberroside A has a remarkable effect on treating and improving the Alzheimer disease, and is applied to preparation of the medicine for preventing and treating the Alzheimer disease.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to the use of mulberry glycoside A in the preparation of drugs for preventing and treating Alzheimer's disease. Background Art

[0002] Alzheimer's disease (AD) is a progressive neurodegenerative disorder characterized by progressive memory loss and cognitive impairment, posing a serious threat to the health and quality of life of the aging population worldwide. Its pathological mechanisms involve key pathways, including cholinergic pathway abnormalities, oxidative stress damage, and neuronal apoptosis. However, existing treatments (such as cholinesterase inhibitors and NMDA receptor antagonists) only alleviate symptoms but fail to halt disease progression. Therefore, the development of innovative drugs that target these core pathological mechanisms is urgently needed.

[0003] Natural products, owing to their structural diversity and bioactivity, have long been an important source of innovative drug development. Mulberroside A (MsA), a stilbene glycoside compound abundant in the root and branch bark of Morus alba L., has been reported to exhibit antioxidant, anti-inflammatory, and tyrosinase inhibitory activities. However, the role and molecular mechanisms of Mulberroside A in the pathological process of AD have not been systematically investigated, and its potential for the prevention and treatment of AD remains largely unexplored.

[0004] In response to the unmet clinical needs of AD and the medicinal development potential of mulberry glycoside A, the present invention explores the intervention effect of mulberry glycoside A on AD through in vitro and in vivo model systems, analyzes its neuroprotective mechanism of action, and provides theoretical support and experimental basis for the development of new natural anti-AD drugs. Summary of the Invention

[0005] To solve the above problems, the present invention provides the use of mulberry glycoside A in the preparation of a drug for preventing and treating Alzheimer's disease, which is achieved through the following technical solutions.

[0006] Application of mulberry glycoside A in the preparation of medicines for preventing and treating Alzheimer's disease.

[0007] In this application, an animal model was constructed to test the effect of mulberinoside A in the preparation of drugs for the prevention and treatment of Alzheimer's disease. Male ICR mice aged 4 to 6 weeks were used as experimental animals after adaptive breeding for 7 days and were randomly divided into a control group, a model group, a MsA group, and a positive group. The treatment of each group was as follows:

[0008] control group, oral administration of vehicle + intraperitoneal injection of normal saline;

[0009] Model group, oral administration of vehicle + intraperitoneal injection of SCOP, SCOP is scopolamine;

[0010] MsA group, oral administration of MsA + intraperitoneal injection of SCOP, MsA is mulberinoside A;

[0011] The positive group was given donepezil orally and SCOP was injected intraperitoneally.

[0012] In the above-mentioned animal model, scopolamine induced Alzheimer's disease (AD)-related pathological changes by interfering with the central cholinergic system, and the therapeutic effects of donepezil, a positive therapeutic drug for Alzheimer's disease, were compared with those of MsA.

[0013] As a further embodiment of the present invention, the drug prepared from the mulberry glycoside A is a drug capable of improving the ability to recognize new and old objects.

[0014] Conduct behavioral testing and evaluate the effect of the drug on improving the ability to recognize new and old objects through novel object recognition experiments.

[0015] As a further embodiment of the present invention, the drug prepared from the mulberinoside A is a drug capable of improving spatial memory and cognitive function.

[0016] Behavioral tests were performed and the Morris water maze test was used to evaluate the effect of the drug on improving spatial memory and cognitive function.

[0017] As a further embodiment of the present invention, the drug prepared from the mulberinoside A is a drug capable of reducing the loss of hippocampal and cortical neurons.

[0018] As a further embodiment of the present invention, the drug prepared from the mulberinoside A is a drug capable of regulating cholinergic metabolism in the hippocampus and cortex.

[0019] As a further embodiment of the present invention, the drug prepared from the mulberinoside A is a drug capable of upregulating the expression of BDNF and CREB in the hippocampus and cortex.

[0020] As a further embodiment of the present invention, the drug prepared from the mulberinoside A is a drug capable of enhancing the cholinergic system function of N2a / APP695 cells and reducing oxidative damage.

[0021] As a further embodiment of the present invention, the mulberinoside A can be administered alone or in combination with one or more other therapeutic agents.

[0022] The following tests were also performed in this application.

[0023] Histological and biochemical tests: specifically including:

[0024] Nissl staining analysis of hippocampal and cortical tissues;

[0025] Immunohistochemical localization of BDNF in hippocampal tissue;

[0026] qRT-PCR detection of BDNF and CREB in hippocampal and cortical tissues;

[0027] Cell experiments: N2a / APP695swe cells stably expressing the human APP695swe mutant were used as experimental cells. Experimental and control groups were divided into experimental and control groups. The experimental group was treated with MsA dissolved in PBS, while the control group was treated with an equal volume of PBS. Cell viability and oxidative stress levels were then measured in both experimental and control groups.

[0028] Biochemical indicators were detected in N2a / APP695swe cells, hippocampus and cortex tissues.

[0029] The above tests can evaluate the effects of drugs in regulating cholinergic metabolism in the hippocampus and cortex, upregulating the expression of BDNF and CREB in the hippocampus and cortex, strengthening the cholinergic system function of N2a / APP695 cells and reducing oxidative damage.

[0030] The beneficial effects of the present invention are that, in response to the clinical dilemma of existing Alzheimer's disease (AD) treatments, which have a single target, can only alleviate some symptoms and have many side effects, the present invention is based on the multi-target regulatory properties of the highly water-soluble and safe natural product mulberroside A (MsA), aiming to address the following key issues by intervening in the AD pathological cascade:

[0031] 1. Breaking through the limitations of single-target therapy, it simultaneously corrects abnormal cholinergic neurotransmission (inhibiting AChE / BChE activity and increasing acetylcholine levels), oxidative stress damage (clearing ROS and repairing neuronal oxidative damage), and upregulates the levels of the neurotrophic factor BDNF and the transcription factor CREB;

[0032] 2. Achieve disease-modifying intervention for AD (rather than just symptomatic treatment), improve cognitive function and delay disease progression by regulating pathological processes, and provide a new strategy for the prevention and treatment of AD. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solution of the present invention, the following is a brief introduction to the drawings required for use in the description of the specific implementation methods. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1 : Flowchart of the animal model construction and schematic diagram of the behavioral testing results;

[0035] Figure 2: Schematic diagram showing that mulberoside A reduces neuronal loss in the hippocampus and cortex of scopolamine-treated mice;

[0036] Figure 3 : Schematic diagram of the effect of mulberryside A on the cholinergic metabolism in the hippocampus and cortex of scopolamine-treated mice;

[0037] Figure 4 : Schematic diagram showing that mulberin A upregulates the expression of BDNF and CREB in the hippocampus and cortex of scopolamine-treated mice;

[0038] Figure 5 : Schematic diagram of how mulberinoside A enhances the cholinergic system function and reduces oxidative damage in N2a / APP695 cells. DETAILED DESCRIPTION

[0039] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0040] The effect of using mulberinoside A in preparing drugs for preventing and treating Alzheimer's disease is evaluated below.

[0041] First, an animal model was constructed. Male ICR mice aged 4 to 6 weeks were used as experimental animals after being adaptively raised for 7 days. They were randomly divided into a control group, a model group, a MsA group, and a positive group. The treatment of each group was as follows:

[0042] control group, oral administration of vehicle + intraperitoneal injection of normal saline;

[0043] Model group, oral administration of vehicle + intraperitoneal injection of SCOP, SCOP is scopolamine;

[0044] MsA group, oral administration of MsA + intraperitoneal injection of SCOP, MsA is mulberinoside A;

[0045] The positive group was given donepezil orally and SCOP was injected intraperitoneally.

[0046] The number of ICR mice in each group was eight; the adaptive breeding conditions were: 12-h light-dark cycle, 23±2℃, free access to food and water; the injection dose of SCOP was 1 mg / kg / d; the gavage dose of MsA was 30 mg / kg / d; the gavage dose of donepezil was 3 mg / kg / d; the ICR mice in the model group were treated for 29 to 42 days; the mice in the MsA group and the positive group were treated for 8 to 28 days.

[0047] The pharmacological activity of mulberoside A (MsA) was evaluated using a scopolamine (SCOP)-induced ICR mouse cognitive impairment model, as follows: In the study of Alzheimer's disease (AD), scopolamine is often used to simulate the abnormal cholinergic neurotransmission in AD patients, thereby constructing an animal model of cognitive impairment.

[0048] The ICR mice used in this application were purchased from the Biological Model Center of Nanjing University. Scopolamine (SCOP) was provided by Aladdin, CAS number: 6533-68-2; mulberinoside A (MsA) was provided by Aladdin, CAS number: 102841-42-9, with a purity exceeding 98%; and donepezil was provided by Targetmol, CAS number: 120011-70-3.

[0049] The experimental process is shown in Figure 1 Middle A.

[0050] Ethical compliance: The experiment was approved by the Health Science Animal Welfare Committee of Zhoukou Normal University (approval number ZKNU-20240132, January 3, 2024) and followed the ethical standards for laboratory animals.

[0051] 2. Then, each group of ICR mice was subjected to novel object recognition test and Morris water maze test to evaluate the restorative effect of MsA on cognitive dysfunction in ICR mice.

[0052] The method of the novel object recognition experiment is as follows:

[0053] Installation: 40cm×40cm×40cm open field;

[0054] process:

[0055] Training period: Two cubes with an edge length of 4 cm were provided and exploratory behavior was recorded for 10 minutes;

[0056] Testing phase: 24 hours after the completion of the training phase, one of the cubes was replaced with a cylinder with a diameter of 4 cm and a height of 4 cm. The exploration time N of the novel object and the exploration time F of the familiar object were recorded within 5 to 10 minutes. The recognition index N / (N+F) and the discrimination index (NF) / (N+F) were calculated.

[0057] After each experiment, the apparatus was cleaned with 75% ethanol to eliminate odor interference.

[0058] like Figure 1 As shown in BF, compared with the control group:

[0059] The 5-min and 10-min exploration time of mice in the model group was significantly reduced (P<0.05), indicating that recognition memory was impaired.

[0060] The defect was reversed in mice treated with MsA, with exploration time significantly increasing at both time points.

[0061] The mice treated in the positive group showed significant effects only at 10 min, with no statistical difference at 5 min;

[0062] In addition, the 10-min discrimination index of mice treated with MsA and the positive group was significantly improved (compared with the model group, P < 0.05), indicating that mulberry glycoside A can improve the ability to recognize new and old objects.

[0063] The method of Morris water maze test is as follows:

[0064] Apparatus: A circular pool equipped with a DMS-2 tracking system and a built-in hidden platform. The circular pool in this application was provided by the Chinese Academy of Medical Sciences.

[0065] process:

[0066] Acclimation period: On the first day, the animals entered the water from the third quadrant and swam freely for 60 seconds. If they failed to find the platform, they were manually guided and stayed for 10 seconds.

[0067] Training period: Days 1 to 5, the animals were randomly placed into the water from different quadrants every day, and the escape latency was recorded;

[0068] Probe period: On the 6th day, the platform was removed and the animals entered the water from the contralateral quadrant. The time spent in the target quadrant, the number of platform crossings, and the movement distance were recorded within 60 seconds. The data were analyzed using DMS-2 software.

[0069] During the 5-day training period, the escape latency of the MsA group was significantly shortened over time (P<0.05). The results of the probe period showed that the number of platform crossings, target quadrant residence time, and movement distance of the MsA group were significantly higher than those of the model group (P<0.05), indicating that spatial memory and cognitive function were improved. Figure 1 Chinese GK).

[0070] 3. Histological and biochemical tests were performed on each group of ICR mice:

[0071] Nissl staining analysis of hippocampal and cortical tissues;

[0072] Immunohistochemical localization of BDNF in hippocampal tissue;

[0073] qRT-PCR detection of BDNF and CREB in hippocampal and cortical tissues.

[0074] The different detection methods are as follows:

[0075] Nissl staining analysis of hippocampus and cortex tissue:

[0076] Procedure: Coronal sections of the hippocampus and cortex were prepared, dewaxed, and stained with Nissl stain at room temperature for 10 minutes. The sections were then dehydrated, cleared with xylene, and mounted with neutral resin.

[0077] Observation: Focus on the CA1, CA3, DG regions of the hippocampus and the cortex under a light microscope to quantify the number of healthy neurons.

[0078] Nissl staining solution was provided by Servicebio, with the number C0117.

[0079] Immunohistochemical localization of BDNF in hippocampus tissue:

[0080] Procedure: (1) Prepare hippocampal BDNF sections and dewax and rehydrate; (2) Block endogenous peroxidase in the sections with 3% H2O2; (3) Perform antigen retrieval on the sections with citrate buffer (pH 6.0); (4) Block the sections with 5% goat serum; (5) Incubate the sections with rabbit anti-BDNF primary antibody at 4°C overnight; (6) Incubate the sections with biotinylated secondary antibody for 30 minutes; (7) Develop the sections with ABC kit + DAB;

[0081] Observation: The CA3 and DG regions of the hippocampus were observed using an Olympus microscope and imaged using a Canon camera to quantify the number of BDNF-positive neurons.

[0082] Rabbit anti-BDNF primary antibody is a combination of rabbit anti-BDNF and primary antibody. The antibody was provided by Servicebio, number GB11559, and was diluted 200 times. Biotinylated secondary antibody is a combination of biotin and secondary antibody.

[0083] qRT-PCR detection of BDNF and CREB in hippocampal and cortical tissues: The secondary antibody was provided by Vector, with the number AB_2687893, and was diluted 400-fold before use; the ABC kit was provided by Vector, with the number AB_2336382.

[0084] Procedure: (1) Total RNA was extracted from mouse hippocampus and cortex tissues using Trizol reagent. The RNA concentration was determined using a NanoDrop spectrophotometer and the integrity was verified by 1.5% agarose gel electrophoresis. (2) 1 μg of RNA was synthesized into cDNA using a reverse transcription kit. (3) SYBR Green Realtime PCR Master Mix was used as the reaction system and amplified using the LightCycler system. GAPD was used as the internal reference. The reaction procedure was 95°C pre-denaturation for 3 min, 95°C denaturation for 10 s, and 60°C extension for 30 s, for 40 cycles. The relative mRNA expression level was calculated using the 2-ΔΔCt method (three replicates per group, repeated three times).

[0085] Observation: Quantitative transcription levels of BDNF and CREB in the hippocampus and cortex were performed to analyze the regulatory effects of morulin A on neurotrophic signaling pathways.

[0086] The qualified standard of RNA concentration is: OD 260 / OD 280 ;1.8~2.0.

[0087] The primer sequences for BDNF are:

[0088] F / CGACGACATCACTGGCTGACAC;

[0089] R / GAGGCTCCAAAGGCACTTGACTG.

[0090] The primer sequences for CREB are:

[0091] F / CTGAAGAAGCAGCACGGAAGAGAG;

[0092] R / TTCAAGCACTGCCACTCTGTTCTC.

[0093] 4. Cell experiments used N2a / APP695swe cells stably expressing the human APP695swe mutant (donated by Professor Zhang Yunwu of Xiamen University) as experimental cells, and divided them into experimental and control groups. The experimental group was treated with MsA dissolved in PBS for drug treatment, and the control group was treated with an equal volume of PBS as the experimental group. Then, cell viability and cell oxidative stress levels were detected in the experimental and control groups, respectively.

[0094] The experimental cells were cultured in high-glucose DMEM medium at 37°C in a 5% CO2 saturated humidity incubator. When the cell confluence reached 80%, the medium was changed every 2-3 days.

[0095] The high-glucose DMEM medium included 10% FBS, 100 U / mL penicillin, 100 μg / mL streptomycin and 200 μg / mL G418.

[0096] The different detection methods are as follows:

[0097] Cell viability assay: (1) N2a / APP695swe cells were taken and 1×10 4Cells were seeded into 96-well plates at 100 μL / well and incubated overnight at 37°C and 5% CO2 to adhere to the plate; (2) the medium was replaced with high-glucose DMEM medium containing different concentrations of MsA or PBS, and the cells were incubated for 24 h. The medium was replaced with MsA at concentrations of 1 μM, 5 μM, 10 μM, 25 μM, 50 μM, or 100 μM; (3) the medium was discarded, the cells were washed twice with PBS, 100 μL high-glucose DMEM medium plus 10 μL CCK-8 reagent was added to each well, and the CCK-8 reagent was provided by Solarbio, catalog number: CA1210, and the cells were incubated at 37°C for 1 h; (4) the absorbance at 450 nm was measured with an enzyme reader, and the relative cell viability was calculated.

[0098] Cellular oxidative stress level detection includes:

[0099] Malondialdehyde levels were detected using the Solarbio MDA kit (BC0025) and quantified using a microplate reader.

[0100] Reactive oxygen species levels were detected using the Beyotime ROS kit (S0033, fluorescent probe DCFH-DA). Cells were seeded on confocal plates and treated with MsA (25, 50 μM) or PBS for 24 h. The cells were then loaded with the probe (10 μM, incubated at 37°C in the dark for 30 min) and washed three times with PBS. Images were taken using a Zeiss LSM80 confocal microscope (excitation 488 nm, emission 525 nm), and relative fluorescence intensity was quantified using ImageJ software.

[0101] 5. Biochemical indicators were tested on N2a / APP695swe cells, hippocampus and cortical tissues.

[0102] Biochemical index tests include acetylcholine level, acetylcholinesterase activity, and butyrylcholinesterase activity.

[0103] The comprehensive analysis results of histological and biochemical tests, cell experiments and biochemical index tests are as follows:

[0104] 1. Mulberoside A reduces neuronal loss in the hippocampus and cortex of scopolamine-treated mice

[0105] The neuronal integrity of key brain regions (hippocampal CA1, CA3, DG and cortex) was assessed by Nissl staining. The results showed that compared with the control group, the number of Nissl-positive neurons in the above-mentioned regions in the model group was significantly reduced (Figure A), indicating obvious neuronal loss. In the MsA group, the number of Nissl-positive neurons in CA1, CA3, DG and cortical regions was significantly increased compared with the model group, indicating improved neuronal survival. The positive group also showed a similar trend, with the number of Nissl-positive neurons significantly increased compared with the model group. Quantitative analysis further verified the above results ( Figure 2 (center, B–E).

[0106] 2. Mulberoside A regulates cholinergic metabolism in the hippocampus and cortex of scopolamine-treated mice

[0107] Scopolamine (SCOP), a competitive antagonist of muscarinic acetylcholine receptors, can induce systemic cholinergic impairment through receptor blockade. To clarify the regulatory effects of mulberryside A (MsA) on cholinergic homeostasis, we measured acetylcholine (ACh) metabolism-related indicators (activities of the hydrolases AChE and BChE, and neurotransmitter levels) in the hippocampus and cortex. The results are as follows:

[0108] Hippocampal tissue (AC in the figure): Compared with the control group, the AChE and BChE activities in the model group were significantly increased, and the ACh level was significantly decreased, suggesting cholinergic dysfunction; MsA treatment can significantly attenuate the SCOP-induced increase in AChE and BChE activities and partially restore the hippocampal ACh level, showing a protective regulatory effect on cholinergic neurotransmission.

[0109] Cortical tissue ( Figure 3 Middle DF): The results were consistent with those in the hippocampus. The activities of AChE and BChE in the cortex of the model group were increased, and the ACh level was significantly decreased. MsA treatment significantly inhibited the increase in AChE and BChE activities and significantly reversed the decrease in ACh level, with the effect comparable to that of the positive group.

[0110] 3. Mulberoside A upregulates BDNF and CREB expression in the hippocampus and cortex of scopolamine-treated mice

[0111] Immunohistochemical staining and qRT-PCR analysis were used to investigate the regulatory effect of mulberryside A (MsA) on neurotrophic factor-related molecules in the brains of scopolamine (SCOP)-treated mice. The results are as follows:

[0112] Immunohistochemistry ( Figure 4 Center AC): The number of BDNF-positive neurons in the CA3 and DG regions of the hippocampus was significantly decreased in the model group compared with the control group; after MsA treatment, the number of BDNF-positive neurons in the above regions was significantly increased compared with the SCOP group, and the effect was comparable to that of the positive group.

[0113] qRT-PCR detection:

[0114] Seahorse Figure 4 Middle D) and cortex ( Figure 4 In the middle E), SCOP treatment led to a significant downregulation of BDNF mRNA expression, while MsA treatment effectively reversed this trend, significantly increasing BDNF mRNA levels compared with the model group. As a key regulatory factor for BDNF transcription, CREB mRNA expression was significantly decreased in the hippocampus after SCOP treatment ( Figure 4 Middle F) and cortex ( Figure 4MsA intervention could significantly restore its mRNA expression levels in the two brain regions.

[0115] 4. Mulberoside A enhances the cholinergic system function of N2a / APP695 cells and reduces oxidative damage

[0116] Cell viability ( Figure 5 Middle A): CCK-8 assay showed that MsA at concentrations of 50 μM and below had no significant effect on cell viability, and only at 100 μM did the cell viability decrease.

[0117] Functions of the cholinergic system:

[0118] AChE activity ( Figure 5 Middle B): The expression of 25 and 50 μM MsA was significantly decreased, while there was no significant change at low concentrations;

[0119] BChE activity ( Figure 5 Middle C): The level of 10 and 25 μM MsA treatments significantly decreased, but there was no statistical difference at 50 μM;

[0120] ACh level ( Figure 5 Middle D): The expression of β-actin increased when treated with 25 and 50 μM MsA, but showed no significant change when treated with 10 μM MsA.

[0121] Oxidative damage:

[0122] MDA level ( Figure 5 Middle E): The level of 50 μM MsA treatment significantly decreased, while there was no significant change at 10 and 25 μM.

[0123] ROS levels ( Figure 5 (F and G) DCFH-DA fluorescence detection showed that the fluorescence intensity was significantly reduced after treatment with 50 μM MsA, and quantitative analysis confirmed that both 25 and 50 μM MsA significantly reduced ROS levels.

[0124] The preferred embodiments of the present invention disclosed above are intended only to help illustrate the present invention. These preferred embodiments do not exhaustively describe all details, nor do they limit the present invention to specific embodiments. Obviously, many modifications and variations are possible based on the contents of this specification. These embodiments are selected and described in detail in this specification to better explain the principles and practical applications of the present invention, thereby enabling those skilled in the art to better understand and utilize the present invention.

Claims

1. Application of mulberry glycoside A in the preparation of drugs for preventing and treating Alzheimer's disease.

2. The use according to claim 1, characterized in that The medicine prepared from the mulberinoside A is a medicine capable of improving the ability to recognize new and old objects.

3. The use according to claim 1, characterized in that The medicine prepared from the mulberinoside A is a medicine capable of improving spatial memory and cognitive function.

4. The use according to claim 1, characterized in that The medicine prepared from the mulberinoside A is a medicine capable of reducing the loss of hippocampal and cortical neurons.

5. The use according to claim 1, characterized in that The medicine prepared from the mulberinoside A is a medicine capable of regulating the cholinergic metabolism of the hippocampus and cortex.

6. The use according to claim 1, characterized in that The medicine prepared from the mulberinoside A is a medicine capable of upregulating the expression of BDNF and CREB in the hippocampus and cortex.

7. The use according to claim 1, characterized in that The medicine prepared from the mulberinoside A is a medicine capable of enhancing the cholinergic system function of N2a / APP695 cells and reducing oxidative damage.

8. The use according to claim 1, characterized in that The mulberiside A can be administered alone or in combination with one or more other therapeutic agents.

Images