Composite active polypeptide composition with weight-losing effect and preparation method of composite active polypeptide composition

By genetically engineering the design of the NT analog peptide ELP3 and combining it with other peptides, the problems of existing weight loss products with large side effects and short-lasting effects have been solved, achieving a safe and efficient weight loss effect, significantly reducing body weight and improving blood lipid metabolism.

CN120733009AActive Publication Date: 2025-10-03TIANJIN YOUJIN BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511220884.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-29
Publication Date
2025-10-03
Estimated Expiration
2045-08-29

AI Technical Summary

Technical Problem

Existing weight loss products have serious side effects and short-lasting effects, and polypeptide weight loss drugs lack stability and biological activity in the body, making them difficult to be effectively used for weight loss.

Method used

The NT analog peptide ELP3 was designed through genetic engineering and compounded with mulberry leaf peptide, bitter melon peptide, sea cucumber peptide and oyster peptide. The amino acid sequence was efficiently expressed and optimized using genetically engineered strains, and the composite active peptide composition was prepared by combining enzymatic hydrolysis and purification processes.

Benefits of technology

It achieves a safe, efficient and long-lasting weight loss effect, significantly suppresses appetite and fat synthesis, improves blood lipid metabolism, and reduces body weight. The polypeptide ingredients are widely available, low in cost and have good biocompatibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120733009A_ABST
    Figure CN120733009A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to a composite active polypeptide composition with a weight losing effect and a preparation method thereof. The composite active polypeptide composition comprises NT analogue polypeptide ELP3, mulberry leaf polypeptide, balsam pear polypeptide, sea cucumber polypeptide and oyster peptide; the amino acid sequence of the NT analogue polypeptide ELP3 is as shown in SEQ ID NO. 1. According to the present invention, the artificial peptide fragment AYYKSQWLVNGEGTP is added to the end of the wild type NT, such that the gastric acid secretion can be inhibited, and the activity of the alpha-amylase can be significantly inhibited; the NT analogue polypeptide ELP3 and various polypeptide components are matched to achieve a synergistic effect, so that the blood fat metabolism condition of obese mice can be effectively improved, and the fat weight of the mice is reduced; meanwhile, the food intake of the mice can be remarkably inhibited, so that the purpose of reducing the weight of the mice is achieved, and a good weight-losing effect is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a composite active polypeptide composition with weight loss efficacy and a preparation method thereof. Background Art

[0002] With changing lifestyles and increased intake of high-calorie foods, the number of obese people is rising year by year, becoming a serious health problem. Obesity not only negatively impacts one's appearance but is also closely linked to the development of numerous chronic diseases, such as cardiovascular disease, diabetes, hypertension, and certain types of cancer. This places a heavy burden on both individual health and the healthcare system.

[0003] A wide variety of weight loss products are currently available on the market, encompassing a variety of categories, including medications, health supplements, and specialty foods. However, these products have exposed numerous problems in their practical application. For example, while some weight loss medications can achieve short-term weight loss, they are often accompanied by serious side effects, such as adverse cardiovascular reactions and neurological disorders, posing potential threats to the user's health. Many weight loss supplements and foods also suffer from short-term effects. Once use is discontinued, weight rebound is likely to occur, making it difficult for dieters to maintain their ideal weight.

[0004] Peptides, a class of substances with diverse biological activities, have garnered widespread attention and in-depth research in the field of weight loss in recent years. Peptides from different sources each possess unique physiological functions, offering new insights and avenues for developing novel weight loss products. For example, some peptides can regulate the body's fat metabolism, promoting fat breakdown and consumption; others can act on the nervous system to suppress appetite and reduce food intake; and still others can increase energy expenditure and enhance metabolism. Therefore, by rationally combining multiple peptides with weight loss-related functions, it is possible to develop safe, effective, and long-lasting weight loss products.

[0005] Neurotensin (NT) is a 13-amino acid peptide hormone (ELYENKPRRPYIL) produced by intestinal endocrine cells. NT has multiple physiological functions in the gastrointestinal tract. By binding to G protein-coupled receptors (such as NTSR1), it activates intracellular signaling pathways such as mitogen-activated protein kinase (MAPK) and the WNT / β-catenin pathway, thereby promoting intestinal mucosal cell proliferation. NT also regulates gastrointestinal smooth muscle contraction, regulates gastrointestinal secretory activity, inhibits gastric acid secretion, and reduces appetite. These functions suggest that NT has potential therapeutic value in regulating energy metabolism and appetite. Related studies have shown that a fusion peptide of neurotensin and xenin (Ac-NT / XN-8-Gln) reduces body fat in mice with high-fat diet-induced obesity. These findings suggest that NT and its fusion peptide have great potential for the treatment of obesity. However, natural NT has several limitations in the body, such as rapid degradation and a short half-life, which shortens its biological activity and hinders its direct application. Furthermore, the blood-brain barrier (BBB) ​​effectively blocks its entry into the brain and its effects. These limitations significantly restrict NT's application in weight loss products. To overcome these limitations, genetic engineering has become a hot topic of research to modify NT analogs. Genetic engineering techniques can optimize the amino acid sequence of NT, for example, by altering certain amino acid residues susceptible to enzymatic degradation through site-directed mutagenesis or by introducing specific modifying groups to enhance the stability and bioactivity of NT analogs. These techniques also facilitate large-scale production and preparation, effectively addressing the issue of peptide sourcing.

[0006] In addition, a variety of naturally derived peptides have also demonstrated significant weight loss benefits, acting synergistically through different physiological mechanisms to enhance overall weight loss outcomes. Specifically, mulberry leaf peptides can promote the increase of adiponectin, a protein closely associated with fat metabolism. Adiponectin activates β-oxidation, inhibits liver fat accumulation, and protects against oxidative stress, playing a positive role in preventing diet-induced obesity. Bitter melon peptides can regulate blood sugar and lipid levels, reducing fat synthesis and accumulation in the body by inhibiting the activity of key enzymes involved in fat synthesis. Sea cucumber peptides and oyster peptides, rich in various amino acids and bioactive substances, can promote metabolism, regulate signaling pathways related to fat metabolism, and promote fat breakdown and transport, thereby achieving weight loss results. Each of these peptides possesses unique physiological activities, and through synergistic action, they can significantly enhance weight loss outcomes. Therefore, by rationally combining multiple peptides with weight loss-related functions, it is hoped that safe, effective, and long-lasting weight loss products can be developed, providing more options and hope for those living with obesity.

[0007] Based on the above purpose, the present invention provides a composite active polypeptide composition with weight loss efficacy and a preparation method thereof. Summary of the Invention

[0008] In order to overcome the deficiencies of the prior art, one of the objectives of the present invention is to provide a composite active polypeptide composition with weight loss efficacy.

[0009] The second object of the present invention is to provide a method for preparing a composite active polypeptide composition having weight loss efficacy.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is: A composite active polypeptide composition with weight loss efficacy, comprising the following raw materials in parts by weight: 15-25 parts of a NT analog polypeptide ELP3, 10-18 parts of a mulberry leaf polypeptide, 9-14 parts of a bitter melon polypeptide, 5-8 parts of a sea cucumber peptide, and 3-5 parts of an oyster peptide; the amino acid sequence of the NT analog polypeptide ELP3 is shown in SEQ ID NO.1.

[0011] Furthermore, the composite active polypeptide composition comprises the following raw materials in parts by weight: 20 parts of NT analog polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter melon polypeptide, 7 parts of sea cucumber peptide, and 4 parts of oyster peptide.

[0012] Furthermore, the specific preparation steps of the NT analog polypeptide ELP3 are as follows: (1) Designing the amino acid sequence of the NT analog polypeptide ELP3, and reversely designing the nucleotide sequence encoding the NT analog polypeptide ELP3, connecting the nucleotide sequence encoding the NT analog polypeptide ELP3 with the vector to obtain a recombinant plasmid; (2) The recombinant plasmid obtained in step (1) was transferred into competent cells, induced by IPTG, and bacterial precipitates were obtained; (3) Separate and purify the bacterial precipitate obtained in step (2) to obtain the NT analog polypeptide ELP3.

[0013] Furthermore, the concentration of IPTG-induced expression in step (2) is 0.3-0.5 mmol / L, and the time of IPTG-induced expression is 5-10 h.

[0014] Furthermore, the specific operations of step (1) are: S1. Adding an artificial peptide AYYKSQWLVNGEGTP to the end of the amino acid sequence of wild-type NT to obtain the amino acid sequence of the NT analog polypeptide ELP3, as shown in SEQ ID NO.1; S2 Reversely design the gene sequence according to the amino acid sequence of the NT analog polypeptide ELP3, perform codon optimization, and obtain the nucleotide sequence encoding the NT analog polypeptide ELP3, as shown in SEQ ID NO.2; S3 Based on the nucleotide sequence obtained in step S2, upstream and downstream primers are designed to amplify the corresponding nucleotide sequence of the NT analog polypeptide ELP3, and the nucleotide sequence of the NT analog polypeptide ELP3 amplified by the primers is connected to the pET30a vector to construct a recombinant plasmid.

[0015] Furthermore, the upstream primer sequence of step S3 is shown as SEQ ID NO.3; the downstream primer sequence is shown as SEQ ID NO.4.

[0016] Furthermore, the preparation method of the mulberry leaf polypeptide is as follows: mulberry leaves are made into mulberry leaf powder, sodium bisulfite and water are added, heated at 55-65°C for 1-3 hours, and filtered to obtain a mulberry leaf coarse filtrate; the usage ratio of the mulberry leaf powder, sodium bisulfite and water is 10g:1g:(90-110)mL; then enzymatic hydrolysis is performed at 40-60°C for 20-40min; then heating at 90-100°C for 10-15min, centrifuging and taking the supernatant to obtain a protein peptide liquid; filtering, concentrating, and freeze-drying to obtain the mulberry leaf polypeptide.

[0017] Furthermore, the preparation method of the bitter melon polypeptide is as follows: fresh bitter melon is prepared into bitter melon powder, 10-14 times the weight of water is added, and the mixture is heated in a water bath at 50-60°C for 4-6 hours, and filtered to obtain a bitter melon protein liquid; followed by enzymatic hydrolysis at 40-50°C for 2-4 hours; after enzymatic hydrolysis, the mixture is inactivated in a water bath at 80-100°C for 1-2 hours, and cooled to room temperature to obtain a crude bitter melon polypeptide; and the mixture is filtered, concentrated, and freeze-dried to obtain the bitter melon polypeptide.

[0018] Furthermore, the preparation method of the sea cucumber peptide is as follows: fresh sea cucumbers are washed, quickly frozen at -80°C for 20-30 minutes, and then 10-14 times the weight of water is added to obtain sea cucumber slurry; enzymatic hydrolysis is carried out at 40-60°C and pH 7-8 for 3-5 hours, and then the enzyme is inactivated by water bath at 85-90°C for 10-20 minutes. After the enzyme is inactivated, the supernatant is collected by centrifugation, filtered, concentrated, and freeze-dried to obtain the sea cucumber peptide; The preparation method of the oyster peptide comprises the following steps: preparing shell-less oysters into oyster meat homogenate, then performing enzymatic hydrolysis at 40-50° C. for 3-5 hours, and then performing centrifugation, filtering, and freeze-drying to obtain the oyster peptide.

[0019] Among them, mulberry leaf, as a traditional Chinese medicinal material, is rich in various bioactive ingredients, among which mulberry leaf polypeptides have shown a significant effect in regulating lipid metabolism. Studies have found that mulberry leaf polypeptides can promote the increase of adiponectin, a protein closely related to fat metabolism. Adiponectin can activate the β-oxidation process, inhibit the accumulation of liver fat, and resist the body's oxidative stress, which has positive significance in preventing diet-induced obesity. In addition, mulberry leaf polypeptides can also regulate protein metabolism, reduce the breakdown of muscle protein, maintain the body's nitrogen balance, and help maintain muscle mass during weight loss and avoid muscle loss caused by weight loss.

[0020] Bitter melon peptides also possess a variety of beneficial physiological functions. They can regulate blood sugar and lipid levels, inhibiting the activity of key enzymes involved in fat synthesis, thereby reducing the synthesis and accumulation of fat in the body. Furthermore, bitter melon peptides have insulin-like effects, promoting cellular uptake and utilization of glucose and increasing the body's sensitivity to insulin, thereby indirectly affecting fat metabolism.

[0021] Sea cucumber peptides and oyster peptides are rich in various amino acids and bioactive substances. These ingredients not only enhance the body's immunity and resistance, but also promote metabolism and maintain normal physiological functions. During the weight loss process, a good metabolism helps to promptly remove metabolic waste from the body and maintain a stable internal environment. At the same time, sea cucumber peptides and oyster peptides may promote the decomposition and transport of fat by regulating signaling pathways related to fat metabolism, thereby supporting weight loss.

[0022] The preparation method of the composite active polypeptide composition with weight loss effect described above specifically comprises the following steps: weighing NT analog polypeptide ELP3, mulberry leaf polypeptide, bitter melon polypeptide, sea cucumber peptide, and oyster peptide according to the above-mentioned weight parts, stirring and mixing them evenly, and obtaining the composite active polypeptide composition.

[0023] Compared with the prior art, the beneficial effects of the present invention are mainly: 1. Genetic Engineering Production of the NT Analog ELP3: By constructing genetically engineered strains (such as Escherichia coli) and utilizing induced expression and efficient fermentation processes, this approach overcomes the bottlenecks of chemical synthesis, which often face low yields, high costs, and the generation of harmful impurities. Genetic engineering production ensures high batch-to-batch consistency, providing a reliable foundation for preclinical research, clinical trials, and future large-scale drug applications for the treatment of metabolic diseases such as obesity. This process is controllable and easily scalable, making it a key technological path toward industrial application. Furthermore, during amino acid sequence design, the artificial peptide AYYKSQWLVNGEGTP was added to the end of the natural NT sequence to produce the NT analog peptide ELP3. The introduction of specific groups enhances the stability and biological activity of the NT analog. Genetic engineering achieves efficient expression and stability of the NT analog ELP3, demonstrating its ability to inhibit gastric acid secretion and significantly inhibit α-amylase activity.

[0024] 2. Synergistic Weight Loss: This invention scientifically combines a genetically engineered neurotensin (NT) analogue, ELP3, with mulberry leaf peptides, bitter melon peptides, sea cucumber peptides, and oyster peptides, resulting in significant synergy between the various peptide components. Neurotensin (NT) analogs modulate neurotransmitter systems, precisely influencing appetite and energy balance. They act on relevant neural pathways in the brain, inhibiting the transmission of appetite signals and reducing food intake while regulating the expression of genes involved in energy metabolism and increasing energy expenditure. Mulberry leaf peptides promote increased secretion of adiponectin, which activates beta-oxidation in adipocytes, accelerating the breakdown and use of fat while inhibiting the synthesis and accumulation of fat in the liver, regulating lipid metabolism at multiple levels. Bitter melon peptides regulate blood sugar and lipid levels, inhibiting the activity of key enzymes involved in fat synthesis, reducing fat synthesis in the body while promoting fat breakdown and transport. Sea cucumber peptides and oyster peptides are rich in various amino acids and bioactive substances. They can improve the body's metabolic level and enhance the body's absorption and utilization efficiency of nutrients. At the same time, they may promote the decomposition and consumption of fat by regulating signal pathways related to fat metabolism. These peptide components work together to regulate nerves, metabolism, fat synthesis and decomposition, and other aspects. They can effectively improve the blood lipid metabolism of obese mice and reduce the fat weight of mice. At the same time, they can significantly inhibit the amount of food intake of mice, thereby achieving the purpose of reducing the weight of mice, significantly enhancing the weight loss effect, and providing a more effective weight loss solution for obese people.

[0025] 3 Advantages of the preparation method: The preparation method of each polypeptide in the present invention is simple and efficient. The raw materials are widely available. Mulberry leaves, bitter melons, sea cucumbers, oysters, etc. are abundant in nature, easy to obtain, and relatively low in cost, providing a solid material basis for large-scale industrial production. During the preparation process, by optimizing the enzymatic hydrolysis conditions and purification process, high-purity and high-activity polypeptide products can be accurately obtained. For example, in the preparation process of mulberry leaf polypeptide, by precisely controlling the enzymatic hydrolysis temperature, pH value and time, and selecting a suitable protease, the extraction rate and purity of the mulberry leaf polypeptide can be effectively improved, and its biological activity can be ensured. This optimized preparation method not only improves production efficiency and reduces production costs, but also ensures the quality and efficacy stability of the composite active polypeptide composition, which is conducive to the large-scale promotion and application of the product.

[0026] 4. High safety: Compared with traditional weight loss products, the composite active polypeptide composition of the present invention has significant safety advantages. Polypeptides are naturally occurring substances in organisms, have good biocompatibility in the human body, are easily absorbed and metabolized by the human body, and will not accumulate in the body to produce toxicity. At the same time, the polypeptide components used in the present invention are all derived from natural biological materials or prepared through genetic engineering technology, and do not contain harmful chemical synthetic substances, thus avoiding the serious side effects that may be caused by traditional weight loss products, such as adverse reactions of the cardiovascular system, liver and kidney function damage, etc. Therefore, the composite active polypeptide composition of the present invention provides a safe and reliable weight loss option for obese people, which can achieve the goal of weight loss while protecting the user's health to the greatest extent. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 is the inhibition rate of NT and ELP3 peptide on α-amylase; Figure 2 This is a graph showing the effects of different composite active peptide compositions on the feeding of obese mice; Figure 3 The figure shows the effects of different composite active peptide compositions on the body weight of obese mice; Figure 4 This is a graph showing the effects of different composite active polypeptide compositions on the fat weight content of obese mice. DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be further described below in conjunction with specific embodiments. However, it should be understood by those skilled in the art that the following examples are only intended to illustrate the present invention and should not be construed as limiting the present invention. Specific conditions not specified in the examples are to be followed according to conventional conditions or the conditions recommended by the manufacturer. All reagents or instruments used, unless otherwise specified, are conventional products obtained from commercial channels.

[0029] The preparation method of the mulberry leaf polypeptide used in the embodiment of the present invention is as follows: (1) Wash, dry, crush and sieve fresh mulberry leaves to obtain mulberry leaf powder; (2) Sodium bisulfite and purified water were added to the mulberry leaf powder obtained in step (1), the pH value was adjusted to 8, and the mixture was heated at 60°C for 2 hours, and filtered to obtain a mulberry leaf crude filtrate; the dosage ratio of the mulberry leaf powder, sodium bisulfite and purified water was 10 g:1 g:100 mL; (3) The crude filtrate of mulberry leaves was hydrolyzed with a composite protease at a weight ratio of 30:1 at 50°C and a pH value of 7 for 30 minutes, wherein the weight ratio of alkaline protease to pectinase in the composite protease was 3:1; the mixture was then heated at 95°C for 12 minutes, and the supernatant was centrifuged to obtain a protein peptide liquid; the mulberry leaf polypeptide was obtained by filtration, concentration, and freeze-drying.

[0030] The specific preparation method of the Momordica charantia polypeptide used in the embodiment of the present invention is as follows: (1) Wash, dry, crush and sieve fresh bitter melon to obtain bitter melon powder; (2) adding 12 times the weight of water to the bitter melon powder obtained in step (1), adjusting the pH to 8, heating in a water bath at 55° C. for 5 h, and filtering to obtain a bitter melon protein solution; (3) The pH value of the bitter melon protein solution obtained in step (2) was adjusted to 7.0, and then a composite enzyme solution was added and enzymatically hydrolyzed at 50°C for 4 hours; the amount of the composite enzyme added was 2% of the volume of the bitter melon protein solution; the weight ratio of alkaline protease to flavor protease in the composite enzyme was 2:1; after enzymatic hydrolysis, the solution was inactivated in a 90°C water bath for 2 hours, cooled to room temperature, allowed to stand and precipitate impurities, and insoluble matter was removed to obtain clarified bitter melon crude polypeptide; (4) The crude bitter melon polypeptide obtained in step (3) is passed through an ultrafiltration filter with a membrane pore size of 10 kDa, and the filtrate is collected; the filtrate is concentrated and freeze-dried to obtain the bitter melon polypeptide.

[0031] The specific preparation method of the sea cucumber peptide used in the embodiment of the present invention is as follows: (1) Clean the mud and sand in the intestine of fresh sea cucumber, freeze it at -80℃ for 25min, slice it and grind it, add 12 times its weight of water to dilute it, and obtain sea cucumber slurry; (2) The sea cucumber serum and the composite protease were enzymatically hydrolyzed at 50°C and pH 8 in a weight ratio of 12:1 for 4 hours to obtain a sea cucumber hydrolyzate; the weight ratio of papain, alkaline protease and flavor protease in the composite protease was 1:4:2; (3) The sea cucumber hydrolyzate obtained in step (2) is inactivated by water bathing at 85°C for 15 minutes. The inactivated sea cucumber hydrolyzate is separated by a centrifuge, the supernatant is collected for high-temperature sterilization, and the filtrate is collected by an ultrafiltration filter with a membrane pore size of 10KDa; the filtrate is concentrated and freeze-dried to obtain sea cucumber peptides.

[0032] The specific preparation method of the oyster peptide used in the embodiment of the present invention is as follows: (1) The shell-less oysters were steamed under high pressure, the internal organs were removed and the mixture was homogenized. 10% active dry yeast by weight of the oyster meat, 5% arabinose by weight of the oyster meat, and 6% β-cyclodextrin by weight of the oyster meat were added. The mixture was deodorized under high pressure at 65°C and 350 MPa for 25 min to obtain oyster meat homogenate. (2) adding a composite protease to the oyster meat homogenate obtained in step (1), and performing enzymatic hydrolysis at 45°C and a pH value of 7.0 for 4 hours to obtain a mixed solution; the amount of the composite protease added is 5% of the weight of the oyster meat; and the weight ratio of alkaline protease to flavor protease in the composite protease is 2:1; (3) The mixed solution obtained in step (2) is separated by a centrifuge, the supernatant is collected, and the filtrate is collected by an ultrafiltration filter with a membrane pore size of 10KDa; and the oyster peptide is obtained by freeze-drying.

[0033] The method for preparing the NT analog polypeptide ELP3 used in the embodiments of the present invention specifically comprises the following steps: (1) An artificial peptide segment AYYKSQWLVNGEGTP was added to the end of the amino acid sequence of the wild-type NT to obtain the amino acid sequence SEQ ID NO.1 of the NT analog polypeptide ELP3; the gene sequence was reversely designed based on the amino acid sequence SEQ ID NO.1 of the NT analog polypeptide ELP3, and the corresponding base sequence was codon-optimized according to the codon preference of Escherichia coli for expressing heterologous proteins to obtain the nucleotide sequence SEQ ID NO.2 encoding the NT analog polypeptide ELP3.

[0034] SEQ ID NO.1: ELYENKPRRPYILAYYKSQWLVNGEGTP; SEQ ID NO.2: GAGCTGTACGAAAACAAACCGCGTCGTCCGTACATCCTGGCTTACTACAAATCCCAGTGGCTGGTTAACGGTGAAGGTACCCG.

[0035] (2) Based on the obtained nucleotide sequence SEQ ID NO.2 encoding the NT analog polypeptide ELP3, upstream and downstream primers for amplifying the corresponding nucleotide sequence of the NT analog polypeptide ELP3 were designed. The upstream primer sequence is shown in SEQ ID NO.3, which is CATATGGAGCTGTACGAAAACAA, containing the Nde I restriction enzyme site CATATG; the downstream primer sequence is shown in SEQ ID NO.4, which is AAGCTTGGGGTACCTTCACCGTTA, containing the Hind III restriction enzyme site AAGCTT; using the nucleotide sequence SEQ ID NO.2 of the NT analog polypeptide ELP3 as a template, the NT analog polypeptide ELP3 gene was amplified by PCR, and the target fragment was purified by a gel recovery kit.

[0036] (3) The plasmid pET30a was double-digested with restriction endonucleases Nde I and Hind III. The double-digestion reaction system is shown in Table 1. The NT analog polypeptide ELP3 gene fragment recovered after amplification was ligated with the target fragment of the expression vector pET30a using T4 DNA ligase. The T4 DNA ligase reaction system is shown in Table 2. The constructed recombinant plasmid pET30a-ELP3 was transformed into E. coli DH5α competent cells and cultured on LB plates containing 100 μg / mL kanamycin. Monoclonal colonies were picked for bacterial liquid PCR identification, and the plasmid was extracted for sequencing identification to obtain the recombinant plasmid pET30a-ELP3.

[0037] Table 1 Double enzyme digestion reaction system Table 2 T4 DNA ligase reaction system (4) The recombinant plasmid pET30a-ELP3 constructed in step (3) was transformed into E. coli BL21 (DE3) competent cells, spread on LB plates containing 100 μg / mL kanamycin, and incubated inverted at 37°C overnight to obtain a recombinant strain named pET30a-ELP3 / BL21.

[0038] (5) Select positive monoclonal colonies and inoculate them into LB culture medium containing 100 μg / mL kanamycin. Cultivate with shaking at 37°C overnight. Then add 0.4 mmol / L IPTG to induce the expression of NT analog peptide ELP3 for 7 hours to obtain bacterial precipitates. Purify the NT analog peptide ELP3 by affinity chromatography to obtain NT analog peptide ELP3.

[0039] Example 1 A composite active polypeptide composition with weight loss efficacy, comprising the following raw materials in parts by weight: 20 parts of NT analog polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter melon polypeptide, 7 parts of sea cucumber peptide, and 4 parts of oyster peptide.

[0040] This embodiment also provides a method for preparing a composite active polypeptide composition with weight loss efficacy, which specifically comprises the following steps: weighing 20 parts of NT analog polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter melon polypeptide, 7 parts of sea cucumber peptide, and 4 parts of oyster peptide according to the following weight parts, stirring and mixing evenly to obtain.

[0041] Example 2 A composite active polypeptide composition with weight loss efficacy comprises the following raw materials in parts by weight: 15 parts of NT analog polypeptide ELP3, 10 parts of mulberry leaf polypeptide, 9 parts of bitter melon polypeptide, 5 parts of sea cucumber peptide, and 3 parts of oyster peptide.

[0042] This embodiment also provides a method for preparing a composite active polypeptide composition with weight loss efficacy, which specifically comprises the following steps: weighing 15 parts of NT analog polypeptide ELP3, 10 parts of mulberry leaf polypeptide, 9 parts of bitter melon polypeptide, 5 parts of sea cucumber peptide, and 3 parts of oyster peptide according to the following weight parts, stirring and mixing evenly to obtain the composition.

[0043] Example 3 A composite active polypeptide composition with weight loss efficacy comprises the following raw materials in parts by weight: 25 parts of NT analog polypeptide ELP3, 18 parts of mulberry leaf polypeptide, 14 parts of bitter melon polypeptide, 8 parts of sea cucumber peptide, and 5 parts of oyster peptide.

[0044] This embodiment also provides a method for preparing a composite active polypeptide composition with weight loss efficacy, which specifically comprises the following steps: weighing 25 parts of NT analog polypeptide ELP3, 18 parts of mulberry leaf polypeptide, 14 parts of bitter melon polypeptide, 8 parts of sea cucumber peptide, and 5 parts of oyster peptide according to the following weight parts, stirring and mixing them evenly to obtain the composition.

[0045] Comparative Example 1 The difference between Comparative Example 1 and Example 1 is that the NT analog polypeptide ELP3 is omitted from the ingredients of the composite active polypeptide composition with weight loss efficacy, and the rest are the same as Example 1.

[0046] Comparative Example 2 The difference between Comparative Example 2 and Example 1 is that the NT analog polypeptide ELP3 in the composite active polypeptide composition with weight loss efficacy is replaced with a wild-type NT polypeptide; the rest is the same as Example 1.

[0047] The method for preparing the wild-type NT polypeptide is as follows: the amino acid sequence SEQ ID NO. 1 of the NT analog polypeptide ELP3 in step (1) of the preparation method of the NT analog polypeptide ELP3 used in the example is replaced with the amino acid sequence ELYENKPRRPYIL of the wild-type NT polypeptide to prepare the wild-type NT polypeptide.

[0048] Test Example 1 Inhibition rate of NT analog peptide ELP3 on α-amylase: In order to determine the inhibition rate of NT analog peptide ELP3 prepared in Example 1 and wild-type NT peptide prepared in Comparative Example 2 on α-amylase, we conducted the following experiment. 1U / mL α-amylase solution, 1% (w / w) starch solution, 10mg / mL NT analog peptide ELP3 solution, and 10mg / mL wild-type NT peptide solution were prepared using PBS buffer with a pH of 7.0 and a concentration of 20mmol / L. 10μL of 1U / mL α-amylase solution was added to a centrifuge tube. 20μL of NT analog peptide ELP3 solution, 20μL of wild-type NT solution, and 20μL of PBS were added to each centrifuge tube, respectively. The tubes were labeled as NT analog peptide ELP3 group, wild-type NT group, and control group, respectively. The centrifuge tubes were placed on a shaker at 37°C for 15 minutes to allow the peptide to fully contact the α-amylase. Then, add 500 μL of 1% (w / w) starch solution to each centrifuge tube. Continue the reaction on a shaker at 37°C for 5 minutes. Finally, add 500 μL of the reaction stop solution, DNS, and incubate in a boiling water bath for 15 minutes. After the reaction is completed, cool to room temperature and measure the absorbance (A) of each well at 540 nm using a microplate reader. Calculate the α-amylase inhibition rate of the NT analog peptide ELP3 and wild-type NT solutions based on the control (enzyme activity 100%).

[0049] The results are as follows Figure 1 The figure shows the inhibition rates of different peptides against α-amylase. As can be seen from the figure, wild-type NT has a moderate inhibitory effect on α-amylase, with an inhibitory activity of 61%. The NT analog peptide ELP3 prepared in the present invention exhibits the most significant inhibitory effect, with an inhibitory activity of approximately 77%. This indicates that by adding the artificial peptide segment AYYKSQWLVNGEGTP to the end of wild-type NT, a specific group modification has been introduced, thereby improving the stability and activity of the NT analog and enhancing its inhibitory activity against α-amylase. By reducing starch digestion and absorption, the NT analog peptide ELP3 can effectively reduce energy intake, maintain stable blood sugar levels, and thus achieve weight loss.

[0050] Test Example 2 Pharmacodynamic evaluation of the composite active peptide composition using an obese mouse model: The following is an effect test of a composite active polypeptide composition with weight loss efficacy prepared in Examples 1-3 and Comparative Examples 1-2: (1) One hundred four-week-old male C57 mice were selected for the experiment and fed a high-fat diet for six weeks. Sixty mice weighing more than 35 grams were screened and randomly divided into six groups (Example 1 Group, Example 2 Group, Example 3 Group, Comparative Example 1 Group, Comparative Example 2 Group, and Model Group), with 10 mice in each group. In addition, ten four-week-old male C57 mice were selected and fed a normal diet for six weeks to serve as the normal control group.

[0051] (2) Groups 1, 2, 3, 1, and 2 were gavaged with the corresponding composite active polypeptide composition at a dose of 0.5 mg / kg / d, once in the morning and once in the evening, and fed with normal feed. The model group and the normal control group were gavaged with an equal amount of physiological saline.

[0052] (3) From the beginning of drug administration, each group recorded the initial food intake, and checked the remaining food every 3-5 days, and continued to add new mouse food and record it. By the end of 10 weeks of drug administration, the total food intake of the mice was recorded and a cumulative food intake curve was drawn. The results are shown in the figure. Figure 2 shown.

[0053] The results are as follows Figure 2 、 Figure 3 As shown in the figure, they are the results of the effects of different peptides on the food intake and body weight of obese mice. Figure 2 、 Figure 3 It can be seen that compared with Comparative Example 1 and Comparative Example 2, the composite active polypeptide composition with weight loss efficacy prepared in Examples 1-3 of the present invention can significantly inhibit the food intake of mice, thereby significantly reducing the weight of obese mice.

[0054] (4) After 11 weeks of administration, mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (50 mg / kg) and inhaled anesthetic isoflurane to ensure slow and steady breathing. MRI was performed to monitor body fat content and calculate fat weight.

[0055] The results are as follows Figure 4 The figure shows the effects of different composite active peptide compositions on the fat content of obese mice. Figure 4 It can be seen that compared with Comparative Example 1 and Comparative Example 2, the composite active polypeptide composition with weight loss efficacy prepared in Examples 1-3 of the present invention can significantly reduce the fat weight of obese mice and restore it to normal levels, thereby achieving the purpose of weight loss.

[0056] (5) After 11 weeks of administration, blood was collected from the eye sockets of obese mice and serum was collected statically. The levels of high-density lipoprotein (HDL), triglyceride (TG), and low-density lipoprotein (LDL) in the serum of obese mice were detected using kits.

[0057] Table 3 shows the effects of different peptides on serum indicators of obese mice The results are shown in Table 3, which are the effects of different composite active polypeptide compositions on the levels of high-density lipoprotein (HDL), triglycerides (TG), and low-density lipoprotein (LDL) in the serum of obese mice. As can be seen from the table, compared with the comparative example 1 and comparative example 2 groups, the composite active polypeptide compositions with weight loss efficacy prepared in Examples 1-3 of the present invention can significantly increase the level of high-density lipoprotein (HDL) in the serum of obese mice, reduce the level of triglycerides (TG) and low-density lipoprotein (LDL) in the serum of obese mice, and restore them to normal levels. These changes indicate that the composite active polypeptide compositions prepared by the present invention can effectively improve the blood lipid metabolism of obese mice, showing good weight loss and cardiovascular protection effects.

[0058] In summary, the NT analog peptide ELP3 can effectively reduce energy intake and maintain stable blood sugar levels by reducing starch digestion and absorption, thereby achieving a weight loss effect. Mulberry leaf peptide can promote the increase of adiponectin, activate the β-oxidation process, inhibit the accumulation of liver fat, and resist the body's oxidative stress, which is of positive significance for preventing diet-induced obesity. Bitter melon peptide can regulate blood sugar and blood lipid levels, and by inhibiting the activity of key enzymes in fat synthesis, it reduces the synthesis and accumulation of fat in the body. Sea cucumber peptide and oyster peptide are rich in various amino acids and bioactive substances, which can promote metabolism, regulate signaling pathways related to fat metabolism, and promote the decomposition and transport of fat, thereby achieving a weight loss effect. The NT analog peptide ELP3, in combination with mulberry leaf peptide, bitter melon peptide, sea cucumber peptide, and oyster peptide, exerts a synergistic effect, effectively improving the blood lipid metabolism of obese mice and reducing their fat content. At the same time, it can significantly inhibit the mice's food intake, thereby achieving the goal of reducing their weight, showing a good weight loss effect. Furthermore, the polypeptides in the composite active polypeptide composition of the present invention have good biocompatibility in the human body, are green and non-toxic, comply with food safety, and have broad application prospects.

[0059] Finally, it should be noted that the above embodiments are intended only to illustrate the technical solutions of the present invention and are not intended to limit the same. The basic principles and main features of the present invention have been described above using specific implementation schemes. Modifications or substitutions may be made based on the present invention, but such modifications or substitutions do not detract from the essence of the corresponding technical solutions from the scope of protection claimed by the present invention.

Claims

1. A composite active polypeptide composition having weight loss efficacy, characterized in that: The composite active polypeptide composition comprises the following raw materials in parts by weight: 15-25 parts of NT analog polypeptide ELP3, 10-18 parts of mulberry leaf polypeptide, 9-14 parts of bitter melon polypeptide, 5-8 parts of sea cucumber peptide, and 3-5 parts of oyster peptide; the amino acid sequence of the NT analog polypeptide ELP3 is shown in SEQ ID NO.

1.

2. The composite active polypeptide composition with weight loss efficacy according to claim 1, characterized in that: The composite active polypeptide composition comprises the following raw materials in parts by weight: 20 parts of NT analog polypeptide ELP3, 14 parts of mulberry leaf polypeptide, 12 parts of bitter melon polypeptide, 7 parts of sea cucumber peptide, and 4 parts of oyster peptide.

3. A composite active polypeptide composition with weight loss efficacy according to claim 1 or 2, characterized in that: The specific preparation steps of the NT analog polypeptide ELP3 are as follows: (1) Designing the amino acid sequence of the NT analog polypeptide ELP3, and reversely designing the nucleotide sequence encoding the NT analog polypeptide ELP3, connecting the nucleotide sequence encoding the NT analog polypeptide ELP3 with the vector to obtain a recombinant plasmid; (2) The recombinant plasmid obtained in step (1) was transferred into competent cells, induced by IPTG, and bacterial precipitates were obtained; (3) Separate and purify the bacterial precipitate obtained in step (2) to obtain the NT analog polypeptide ELP3.

4. The composite active polypeptide composition with weight loss efficacy according to claim 3, characterized in that: The concentration of IPTG-induced expression in step (2) is 0.3-0.5 mmol / L, and the time of IPTG-induced expression is 5-10 h.

5. The composite active polypeptide composition with weight loss efficacy according to claim 3, characterized in that: The specific operations of step (1) are: S1. Adding an artificial peptide AYYKSQWLVNGEGTP to the end of the amino acid sequence of wild-type NT to obtain the amino acid sequence of the NT analog polypeptide ELP3, as shown in SEQ ID NO.1; S2 Reversely design the gene sequence according to the amino acid sequence of the NT analog polypeptide ELP3, perform codon optimization, and obtain the nucleotide sequence encoding the NT analog polypeptide ELP3, as shown in SEQ ID NO.2; S3 Based on the nucleotide sequence obtained in step S2, upstream and downstream primers are designed to amplify the corresponding nucleotide sequence of the NT analog polypeptide ELP3, and the nucleotide sequence of the NT analog polypeptide ELP3 amplified by the primers is connected to the pET30a vector to construct a recombinant plasmid.

6. The composite active polypeptide composition with weight loss efficacy according to claim 5, characterized in that: The upstream primer sequence of step S3 is shown as SEQ ID NO.3; the downstream primer sequence is shown as SEQ ID NO.

4.

7. The composite active polypeptide composition with weight loss efficacy according to claim 1, characterized in that: The preparation method of the mulberry leaf polypeptide comprises the following steps: preparing mulberry leaves into mulberry leaf powder, adding sodium bisulfite and water, heating at 55-65°C for 1-3 hours, and filtering to obtain a mulberry leaf coarse filtrate; the usage ratio of the mulberry leaf powder, sodium bisulfite and water is 10g:1g:(90-110)mL; subsequently, performing enzymatic hydrolysis at 40-60°C for 20-40 minutes; then heating at 90-100°C for 10-15 minutes, centrifuging and obtaining a supernatant to obtain a protein peptide liquid; and filtering, concentrating and freeze-drying to obtain the mulberry leaf polypeptide.

8. The composite active polypeptide composition with weight loss efficacy according to claim 1, characterized in that: The preparation method of the bitter melon polypeptide comprises the following steps: preparing bitter melon powder from fresh bitter melon, adding 10-14 times the weight of water, heating in a water bath at 50-60° C. for 4-6 hours, and filtering to obtain a bitter melon protein liquid; then performing enzymatic hydrolysis at 40-50° C. for 2-4 hours; after enzymatic hydrolysis, performing inactivation in a water bath at 80-100° C. for 1-2 hours, and cooling to room temperature to obtain a crude bitter melon polypeptide; and filtering, concentrating, and freeze-drying to obtain the bitter melon polypeptide.

9. The composite active polypeptide composition with weight loss efficacy according to claim 1, characterized in that: The preparation method of the sea cucumber peptide comprises the following steps: washing fresh sea cucumbers, quick-freezing them at -80°C for 20-30 minutes, adding 10-14 times the weight of water to obtain sea cucumber slurry; performing enzymatic hydrolysis at 40-60°C and a pH value of 7-8 for 3-5 hours, then inactivating the enzyme in a water bath at 85-90°C for 10-20 minutes, collecting the supernatant by centrifugation, filtering, concentrating, and freeze-drying to obtain the sea cucumber peptide; The preparation method of the oyster peptide comprises the following steps: preparing shell-less oysters into oyster meat homogenate, then performing enzymatic hydrolysis at 40-50° C. for 3-5 hours, and then performing centrifugation, filtering, and freeze-drying to obtain the oyster peptide.

10. The method for preparing a composite active polypeptide composition having weight loss efficacy according to any one of claims 1 to 9, characterized in that: The specific steps include: weighing NT analog polypeptide ELP3, mulberry leaf polypeptide, bitter melon polypeptide, sea cucumber peptide, and oyster peptide according to the weight parts, stirring and mixing them evenly, and obtaining the product.

Citation Information

Patent Citations

  • Therapeutic peptides and methods of use thereof

    CN107847554A

  • Preparation method of solid beverage containing sea cucumber peptide, urechis unicinctus peptide and oyster peptide

    CN113826907A

  • Method for preparation of capsule of seacucumberpeptide

    KR1020070105714A

  • Short and d-amino acid-containing polypeptides for therapeutic conjugates and uses thereof

    US20160263236A1

  • Neurotensin Variants And Tagged Proteins Comprising Neurotensin Or Sortilin Propeptide

    US20240318157A1