Aspergillus luchuensis strain and use thereof in production of protein food raw material
The preparation of protein food raw materials by fermenting soybean residue with Aspergillus ryukyu MW-1 solves the problem of insufficient research on the utilization of soybean residue by Aspergillus ryukyu in existing technologies, and realizes the efficient and safe acquisition of high-quality protein food raw materials with excellent processing characteristics and efficient protein recovery capabilities.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INST OF AGRO FOOD SCI & TECH CHINESE ACADEMY OF AGRI SCI
- Filing Date
- 2025-08-19
- Publication Date
- 2026-05-22
AI Technical Summary
Existing technologies lack sufficient research on the fermentation of soybean residue by Aspergillus ryukiai, and there is a lack of effective methods to safely and efficiently obtain high-quality protein food raw materials.
A strain of Aspergillus ryuko MW-1 was provided. Mycelia were obtained by culturing and filtering in PDA medium. Fresh soybean residue with a moisture content of 83% to 85% was added for fermentation. After freeze-drying, protein food raw materials were prepared. Protein powder was prepared by high-pressure homogenization, pH adjustment, centrifugation and other steps.
Aspergillus ryukiaense MW-1 can efficiently utilize soybean residue protein, significantly improve protein degradation capacity, degrade insoluble dietary fiber, reduce natural mycotoxin contamination, and ferment soybean residue has excellent processing characteristics, making it suitable for the food industry and improving protein recovery efficiency and processing characteristics.
Smart Images

Figure CN120737981B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of microbial fermentation and food, specifically to a strain of Aspergillus ryuki and its use in the production of protein food ingredients. Background Technology
[0002] Protein is an essential nutrient for both humans and animals. Dietary protein is digested and broken down into amino acids, which are then absorbed to synthesize the proteins needed by the body. Currently, most protein production comes from animal and plant farming; however, these sources suffer from problems such as excessive resource consumption, susceptibility to environmental impacts, and significant environmental consequences.
[0003] Fungal proteins have attracted significant attention due to their unique nutritional properties and efficient production process, which is independent of traditional agriculture and weather conditions. Fungal protein production has a significantly lower environmental impact than conventional meat production, with a carbon footprint 10 times lower than beef and 4 times lower than chicken. Furthermore, fungi can transform various industrial and agricultural wastes into valuable protein compounds. This makes fungal protein a promising new source of nutrition.
[0004] In recent years, Aspergillus fungi have become a research hotspot due to their strong cellulose degradation capabilities. Aspergillus exhibits strong tolerance and a diverse enzyme system, enabling it to adapt to various industrial production environments and is widely used for degrading cellulose-rich raw materials, particularly in agricultural waste utilization, biomass degradation, and food fermentation. Among them, *Aspergillus ryuki*, a GRAS-certified strain by the US FDA, has been used in various traditional fermented foods, such as Chinese Pu-erh tea.
[0005] The long-term safe use of *Aspergillus ryukyu* in food fermentation further confirms its safety for human health. *Aspergillus ryukyu* secretes a variety of food-grade enzymes, including cellulase, amylase, and thermostable pectinase. These enzymes effectively break down plant cellulose and starch, providing strong support for the development of plant-based proteins. Furthermore, the physiological activities of *Aspergillus ryukyu* offer multiple benefits in food fermentation, such as preventing microbial contamination and enhancing aroma and flavor. *Aspergillus ryukyu* also possesses antibacterial and antioxidant properties, which are crucial for improving food quality and extending shelf life.
[0006] Fermented soybean residue technology can transform low-value waste into high-protein resources, combining economic efficiency, environmental friendliness, and functionality.
[0007] However, current research on Aspergillus ryukyu fermentation using soybean residue is insufficient. Therefore, it is necessary to develop a strain of Aspergillus ryukyu suitable for fermenting soybean residue to produce protein food raw materials, so as to further enrich alternative protein resources. Summary of the Invention
[0008] The technical problem to be solved by this invention is how to use Aspergillus ryuki to ferment soybean residue in order to safely and efficiently obtain high-quality protein food raw materials.
[0009] Accordingly, the technical solution adopted by the present invention to solve its technical problem is, in the first aspect, to provide a strain of Aspergillus ryukyu ( Aspergillus luchuensis )MW-1, this Aspergillus ryukyu was deposited on March 31, 2025 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO. 41859.
[0010] A second aspect of the present invention provides the use of Aspergillus ryukyuensis MW-1 in the production of protein food raw materials from fermented soybean residue.
[0011] In some implementation schemes, the soybean residue is fresh soybean residue with a moisture content of 83% to 85%.
[0012] A third aspect of the present invention provides the use of Aspergillus ryukyuensis MW-1 in the treatment of insoluble dietary fiber food by-products.
[0013] A fourth aspect of this invention provides a method for preparing a protein food ingredient, comprising the following steps:
[0014] Aspergillus ryuko MW-1 was cultured in PDA medium and mycelium was obtained by filtration with sterile gauze. The mycelium was added to soybean residue medium for fermentation and then freeze-dried to obtain protein food raw material.
[0015] In some implementation schemes, the ratio of fresh soybean residue to distilled water in the soybean residue culture medium is 1:3.5-4.5.
[0016] In some implementation schemes, the moisture content of fresh soybean residue is 83% to 85%.
[0017] In some implementations, the fermentation conditions are 26°C to 30°C, 100 rpm to 200 rpm, and fermentation for 2 to 5 days.
[0018] The fifth aspect of this invention provides a method for preparing protein powder, comprising the following steps:
[0019] Aspergillus ryuki MW-1 was cultured in PDA medium and mycelium was obtained by filtration through sterile gauze. The mycelium was added to soybean residue medium for fermentation and then freeze-dried to obtain protein food raw material. The protein food raw material was mixed with distilled water and subjected to high-pressure homogenization. The pH of the high-pressure homogenized protein food raw material solution was adjusted with alkaline solution, stirred at room temperature, centrifuged, and the lower precipitate was discarded to obtain supernatant. The pH of the supernatant was adjusted with acid solution, allowed to stand at room temperature, centrifuged, the pH of the lower precipitate was adjusted with alkaline solution, and spray-dried to obtain protein powder.
[0020] In some implementation schemes, the ratio of protein food ingredients to distilled water is 1:8-12.
[0021] In some implementations, the high-pressure homogenization conditions are 80 MPa to 100 MPa and 2 L / h to 4 L / h.
[0022] In some implementations, the alkaline solution is a KOH solution.
[0023] In some implementations, the acid solution is an HCl solution.
[0024] In some implementations, the pH of the protein food ingredient solution that has been homogenized under high pressure is adjusted to 7.5 to 9.5 using an alkaline solution, and stirred at room temperature for 30 to 90 minutes.
[0025] In some implementations, the pH of the protein food ingredient solution that has been homogenized under high pressure is adjusted to 8.9 to 9.1 using an alkaline solution, and then stirred at room temperature for 55 to 65 minutes.
[0026] In some implementations, the pH of the supernatant is adjusted to 4 to 5 using an acid solution, and then allowed to stand at room temperature for 1 to 3 hours.
[0027] In some implementations, an alkaline solution is used to adjust the pH of the lower precipitate to 6.5 to 7.5.
[0028] The beneficial effect of this invention is that it provides a strain of Aspergillus ryuko MW-1 with excellent fermentation characteristics of soybean residue and protein production capacity.
[0029] Specifically, it has the following beneficial effects:
[0030] (1) During the fermentation process, strain MW-1 can efficiently utilize soybean residue protein and effectively accumulate mycelial protein, and has a high protein degradation capacity.
[0031] (2) The strain MW-1 can efficiently utilize insoluble dietary fiber as the main carbon source and promote the accumulation of soluble components. It has excellent ability to process food by-products with high insoluble dietary fiber, which is conducive to the transformation of waste into valuable resources.
[0032] (3) During the fermentation process, the levels of penicillin, aflatoxin, ochratoxin and fumonisin all met the limits set by the World Health Organization, highlighting their potential for use in the food industry.
[0033] (4) Fermented soybean residue has the potential to serve as a prebiotic substrate;
[0034] (5) The fermented soybean residue obtained has significant and excellent processing characteristics, such as water holding capacity, oil holding capacity, hydration characteristics and high emulsification texture.
[0035] (6) High-pressure homogenization-assisted alkaline method was used to extract protein components from Aspergillus ryukiaense, which further significantly improved the protein recovery efficiency and processing characteristics. Attached Figure Description
[0036] Figure 1 This is a colony morphology diagram of Aspergillus ryukoensis MW-1.
[0037] Figure 2 This is a phylogenetic tree diagram of Aspergillus ryukoensis MW-1.
[0038] Figure 3 The graph shows the changes in nutrient composition during the fermentation of soybean residue by Aspergillus ryukoi MW-1. Among them, A represents the results of mycelial weight measurement; B represents the results of total protein content and soybean residue protein measurement; C represents the results of soluble protein, polypeptide and amino acid nitrogen measurement; and D represents the results of insoluble dietary fiber and soluble dietary fiber measurement.
[0039] Figure 4 This diagram shows the changes in mycotoxins during the fermentation of soybean residue by Aspergillus ryukoi MW-1.
[0040] Figure 5 The graph shows the probiotic characteristics of soybean residue fermented by Aspergillus ryukyu MW-1; where A represents the change in viable cell count during the culture process; B represents the change in pH value during the culture process; and C represents the change in lactic acid content during the culture process.
[0041] Figure 6 The graph shows the results of mycelial weight determination after fermentation of Aspergillus ryukoi MW-1 and commercially available strains.
[0042] Figure 7 Figure showing the recovery efficiency of soybean residue protein produced by different methods using Aspergillus ryukyu MW-1 fermentation.
[0043] Figure 8 Figure 1 shows the processing characteristics of fermented soybean residue protein produced by Aspergillus ryukyu MW-1 using different methods; where A represents the solubility of the protein; B represents the water-holding capacity of the protein; C represents the oil-holding capacity of the protein; D represents the emulsifying ability of the protein; and E represents the foaming properties of the protein. Detailed Implementation
[0044] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood in the technical field to which this invention pertains. The following definitions are supplementary to those definitions in the art and relate to this invention, but are not extrapolated to any relevant or unrelated situation, such as any conventionally used patent or application. While any methods and materials similar to or equivalent to those described herein may be used in practical testing of the invention, the materials and methods described herein are preferred. Therefore, the terminology used herein is intended to describe specific embodiments only and is not intended to limit the invention.
[0045] In this document, the terms "one or more" and "at least one" are used interchangeably.
[0046] In this document, the terms "one or more" and "at least one" are used interchangeably.
[0047] The terms “including,” “comprising,” or “having”, when used before a step or element, indicate the addition of a further step or element, which is optional and not excluded.
[0048] As mentioned above, in order to better produce proteins and further enrich alternative protein resources, the inventors isolated a strain of Aspergillus ryukyu and completed this invention.
[0049] This invention first provides a strain of Aspergillus ryukuri ( Aspergillus luchuensis )MW-1, this Aspergillus ryukyu was deposited on March 31, 2025 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO. 41859.
[0050] A second aspect of the present invention provides the use of Aspergillus ryukyuensis MW-1 in the production of protein food raw materials from fermented soybean residue.
[0051] In this article, "protein food raw materials", "protein fermented soybean residue raw materials" and "fermented soybean residue" can be used interchangeably.
[0052] The Aspergillus ryukyuensis MW-1 of this invention can efficiently utilize soybean residue protein and effectively accumulate mycelial protein during the fermentation of soybean residue, exhibiting highly efficient protein degradation capabilities; it also possesses excellent water-holding capacity, oil-holding capacity, and emulsifying ability; and it does not cause contamination by natural mycotoxins; therefore, it is a good potential food resource raw material.
[0053] Based on the significant advantages of Aspergillus ryukyu MW-1 in fermented soybean residue, this invention provides a method for preparing a protein food ingredient, comprising the following steps:
[0054] Aspergillus ryuko MW-1 was cultured in PDA medium and mycelium was obtained by filtration with sterile gauze. The mycelium was added to soybean residue medium for fermentation and then freeze-dried to obtain protein food raw material.
[0055] In some implementations, the ratio (w / v) of fresh soybean residue to distilled water in the soybean residue culture medium is 1:3.5-4.5. Exemplary examples include ratios of 1:3.5, 1:4, and 1:4.5.
[0056] In some implementation schemes, the soybean residue is fresh soybean residue with a moisture content of 83% to 85%. Therefore, soybean residue with a moisture content of 83% to 85% is typically a byproduct of fresh processing, without drying, resulting in less loss of nutrients and better preservation of its natural structure and biological activity, providing a high-quality raw material for subsequent fermentation. Within this moisture content range, the soybean residue does not require additional water for conditioning and can be used directly for fermentation, simplifying the process and improving fermentation efficiency.
[0057] In some implementations, the fermentation conditions are 26°C to 30°C, 100 rpm to 200 rpm, and fermentation for 2 to 5 days. For example, the fermentation temperature can be 26°C, 27°C, 28°C, 29°C, or 30°C; the rotation speed can be 100 rpm, 140 rpm, 170 rpm, or 200 rpm; and the fermentation time can be 2 days, 3 days, 4 days, or 5 days.
[0058] In one specific implementation plan, the fermentation conditions are 28°C, 200 rpm, and 5 days.
[0059] This invention also provides the use of Aspergillus ryukyuensis MW-1 in the treatment of food by-products containing insoluble dietary fiber. MW-1 can efficiently degrade insoluble dietary fiber and promote the accumulation of soluble components, fully demonstrating its industrial application potential in the treatment of food by-products containing high levels of insoluble dietary fiber.
[0060] Furthermore, the food raw material obtained from fermenting soybean residue with Aspergillus ryukyu MW-1 can be further used to produce protein products. Based on this, the present invention provides a method for preparing protein powder, comprising the following steps:
[0061] The protein food raw material prepared according to the aforementioned method is mixed with distilled water and subjected to high-pressure homogenization. The pH of the high-pressure homogenized protein food raw material solution is adjusted with an alkaline solution, stirred at room temperature, centrifuged, and the lower precipitate is discarded to obtain the supernatant. The pH of the supernatant is adjusted with an acid solution, allowed to stand at room temperature, centrifuged, the pH of the lower precipitate is adjusted with an alkaline solution, and spray-dried to obtain protein powder.
[0062] The protein powder prepared according to the method of the present invention has good water-holding capacity and can be well used as an ideal texture modifier for meat analogues and plant-based cheeses.
[0063] The protein powder prepared according to the method of the present invention has good foaming ability and is suitable for use in baking leavening agents and other applications that require rapid foaming.
[0064] The protein powder prepared according to the method of the present invention also has good emulsifying properties, which can significantly enhance the oil-water interface adsorption capacity of proteins and the emulsion formation efficiency.
[0065] In some implementation schemes, the protein food raw material is fermented soybean residue.
[0066] In some implementations, the ratio (w / v) of fermented soybean residue to distilled water is 1:8-12. For example, the ratios of protein food ingredients to distilled water are 1:8, 1:9, 1:10, 1:11, and 1:12.
[0067] In some implementations, the high-pressure homogenization conditions are 80 MPa to 100 MPa and 2 L / h to 4 L / h. For example, the high-pressure homogenization conditions can be 80 MPa, 90 MPa, 100 MPa; 2 L / h, 3 L / h, 4 L / h.
[0068] In one specific implementation scheme, the high-pressure homogenization conditions are 90 MPa and 3 L / h.
[0069] In some embodiments, the pH of the high-pressure homogenized protein food ingredient solution is adjusted to 7.5 to 9.5 using an alkaline solution, and then stirred at room temperature for 30 to 90 minutes. Exemplarily, the pH of the high-pressure homogenized protein food ingredient solution is adjusted to 7.5, 8, 8.5, 9, or 9.5 using an alkaline solution, and then stirred at room temperature for 30, 40, 50, 60, 70, 80, or 90 minutes.
[0070] In one specific implementation, the pH of the protein food raw material solution that has undergone high-pressure homogenization is adjusted to 9.0 using an alkaline solution, and then stirred at room temperature for 60 minutes.
[0071] In some implementations, the centrifugation conditions are 4°C, 5000 rpm to 10000 rpm, and 15 to 45 minutes.
[0072] In one specific implementation, the centrifugation conditions are 4°C, 8000 rpm, and 30 minutes.
[0073] In other implementations, the protein food ingredient may be mixed with n-hexane.
[0074] In some implementations, the mixing ratio (w / v) of the protein food ingredient to n-hexane is 1:3-5. Examples include mixing ratios of 1:3, 1:4, and 1:5 for the protein food ingredient and n-hexane.
[0075] In some embodiments, the mixture of protein food ingredients and n-hexane is stirred at room temperature for 20 to 60 minutes, centrifuged at 3000 to 4500 rpm for 15 to 30 minutes to remove n-hexane, and the stirring and centrifugation steps are repeated until the n-hexane liquid is clear and transparent.
[0076] For example, the stirring time is 20 minutes, 30 minutes, 40 minutes, 50 minutes, and 60 minutes. The centrifugation speed is 3000 rpm, 3500 rpm, 4000 rpm, and 4500 rpm. The centrifugation time is 15 minutes, 20 minutes, 25 minutes, and 30 minutes.
[0077] In one specific implementation, the ratio of protein food ingredients to hexamethylenetetramine is 1:3, the stirring time is 30 minutes at room temperature, and the mixture is centrifuged at 4500 rpm for 30 minutes.
[0078] In some implementations, the alkaline solution is a KOH solution.
[0079] In some implementations, the acid solution is an HCl solution.
[0080] In some implementations, the pH of the supernatant is adjusted to 4 to 5, and the solution is allowed to stand at room temperature for 1 to 3 hours.
[0081] In one specific implementation, the pH of the supernatant is adjusted to 4.5.
[0082] In some implementations, the pH of the lower precipitate is adjusted to 6.5 to 7.5.
[0083] In one specific implementation, the pH of the lower precipitate is adjusted to 7.
[0084] The following describes preferred embodiments of the present invention, but the present invention is not limited to these preferred embodiments. It should be noted that any modifications and improvements made by those skilled in the art based on this inventive concept are within the scope of protection of the present invention. All reagents used, unless otherwise specified, are commercially available conventional products.
[0085] Example 1: Purification and Identification of Microbial Strains
[0086] method:
[0087] The strain MW-1, isolated from the yeast, was inoculated into PDA liquid medium and activated for 24 hours. 1 mL of the bacterial culture was then transferred to a 1.5 mL sterile centrifuge tube, and the genome was extracted using Plant Zol (TransGen kit). Simultaneously, colony morphology was photographed using a fully automated colony counter (Smatercounter) under natural light at a magnification of 4×.
[0088] The extracted genomic DNA was used to amplify the fungal ITS region using the universal fungal primers ITS1 (SEQ ID NO:1; 5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (SEQ ID NO:2; 5'-TCCTCCGCTTATTGATATGC-3'). The PCR conditions were as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 20 s, 50℃ annealing for 30 s, 60℃ extension for 3 min, for 30 cycles.
[0089] The PCR amplification products were detected by 3% agarose gel electrophoresis and sent to Beijing Ruiboxingke Biotechnology Co., Ltd. for ITS sequencing.
[0090] Log in to the NCBI website, perform BLAST homology analysis and comparison between the MW-1 ITS sequencing results and relevant information in the website's database, identify the bacterial species and construct a phylogenetic tree.
[0091] Results: The colony morphology of MW-1 was as follows Figure 1 As shown.
[0092] Sequencing results showed that the ITS sequence of MW-1 was:
[0093] CCTTCCGGTAGGGGGAACCTGCGGAAGGATCATTACCGAGTGCGGGTCCTTTGGGCCCAACCTCCCATCCGTGTCTATTATACCCTGTTGCTTCGGCGGGCCCGCCGCTTGTCGGCCGCCGGGGGGGCGCCTTTGCCCCCCGGGCCCGTGC CCGCCGGAGACCCCAACACGAACACTGTCTGAAAGCGTGCAGTCTGAGTTGATTGAATGCAATCAGTTAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAACTAATGTGAATTGCAGAATTC AGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCTCTCCGGGGGGACGGGCCCGAAAGGCAGCGGCGGC ACCGCGTCCGATCCTCGAGCGTATGGGGCTTTGTCACATGCTCTGTAGGATTGGCCGGCGCCTGCCGACGTTTTTCCAACCATTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGGCGGAGGAA (SEQ ID NO:3).
[0094] The results of constructing the phylogenetic tree of MW-1 are as follows Figure 2 As shown; from Figure 2 It can be seen that MW-1 is Aspergillus ryukyuensis.
[0095] Example 2: Fermentation of soybean residue by Aspergillus ryukyu MW-1 to produce protein food raw materials
[0096] The MW-1 strain was streaked onto PDA solid medium and incubated at 28°C for 48 hours. Subsequently, the mycelium was picked and activated in PDA liquid medium, incubated at 28°C and 200 rpm for 48 hours. The liquid culture was filtered through sterile gauze to obtain the mycelial inoculum.
[0097] 1.8g of mycelium (fresh weight) was inoculated into a soybean residue culture medium consisting of 15g of fresh soybean residue (83% moisture content, directly collected from Anhui Honghua Food Co., Ltd., in its original, untreated state) and 60 mL of distilled water. The medium was incubated at 28℃ and 200rpm for 5 days. Fermentation samples were collected on days 2, 3, 4, and 5, and immediately stored at -80℃. These samples were then freeze-dried for further analysis to obtain the corresponding protein food raw materials.
[0098] Example 3: Analysis of fermentation products of Aspergillus ryukyu MW-1
[0099] The nutrient content of the fermentation samples obtained at different time points in Example 2 was analyzed using the following methods.
[0100] (1) Mycelial weight determination:
[0101] Take two 5g samples evenly. Add 50mL of distilled water to one of the samples, wash the soybean residue, filter, obtain mycelium, freeze-dry, and measure the weight of the mycelium.
[0102] (2) Protein content determination:
[0103] Unfermented and fermented soybean residue samples were washed and filtered through gauze. The resulting mycelium was then freeze-dried; the remaining soybean residue in the filtrate was also freeze-dried. Subsequently, the protein content of the freeze-dried residual soybean residue and mycelium samples was determined according to the Kjeldahl method in GB 5009.5-2016 National Food Safety Standard for Determination of Protein in Food. The sum of soybean residue protein and mycelium protein is the total protein.
[0104] (3) Determination of amino acid, soluble protein, and polypeptide content:
[0105] According to the national food safety standard GB 5009.235-2016, "Determination of Amino Acid Nitrogen in Food", the amino acid nitrogen content in the sample was determined by formaldehyde titration.
[0106] Fermentation samples at different time points were centrifuged at 4°C and 10,000 rpm for 10 min to obtain supernatant. The content of soluble protein in the samples was determined using the Bradford Protein Detection Kit.
[0107] The fermentation sample was mixed with an equal volume of 20% trichloroacetic acid and centrifuged at 2000 rpm for 30 min. 1 mL of the supernatant was taken and mixed with 3 mL of biuret reagent A, and then 1 mL of biuret reagent B was added. After mixing evenly, the sample was detected at a wavelength of 540 nm. The content of peptides in the sample was calculated using the bovine serum albumin standard curve.
[0108] (4) Determination of dietary fiber content:
[0109] According to GB 5009.88-201 Determination of Dietary Fiber in Food, the content of soluble and insoluble dietary fiber in the sample was determined by enzyme gravimetric method.
[0110] The results of the above nutrient determination are as follows:
[0111] The results of mycelial quality determination are as follows: Figure 3 As shown in Figure A, it can be seen that the mycelial weight continuously increases during the fermentation process, rapidly rising to 48.5% at 48h.
[0112] The results of the determination of total protein content, soybean residue protein, and mycelial protein in the sample are as follows: Figure 3 As shown in Figure B, the total protein content in the sample first increased and then stabilized, reaching 26.23% after 120 hours of fermentation. Notably, the protein content in soybean residue continued to decrease, dropping from 17.49% to 6.73% after 120 hours. These results indicate that the mycelium can efficiently utilize soybean residue protein and effectively accumulate mycelial protein during fermentation.
[0113] The content of soluble proteins, peptides, and amino acid nitrogen in the sample is as follows: Figure 3 As shown in Figure C, the soluble protein content exhibited a trend of first increasing and then decreasing during fermentation. It significantly increased from 2.81 mg / g to 7.50 mg / g after 48 hours of fermentation, then decreased to 2.37 mg / g after 120 hours. This change in soluble protein content indicates the utilization of soybean residue protein by MW-1 fermentation. In the early stage of fermentation, protease degradation of insoluble proteins increased the soluble protein content by 166.9%, while in the later stage (48 to 120 hours), MW-1 utilized soluble proteins as a nitrogen source for cell growth, leading to a 68.4% decrease in its content. The peptide content peaked at 68.13 mg / g at 48 hours, then gradually decreased to 64.83 mg / g. The amino acid content increased from 1.22 mg / g at the beginning of fermentation to 6.11 mg / g at 96 hours. The significant increase in soluble protein and peptide levels in the early stage of fermentation indicates that MW-1 has a highly efficient protein degradation capacity in soybean residue fermentation.
[0114] The content of insoluble dietary fiber and soluble dietary fiber in the sample is as follows: Figure 3 As shown in Figure D, insoluble dietary fiber (IDF) gradually decreases, while soluble dietary fiber (SDF) first increases and then decreases. Specifically, after 48 hours of fermentation, IDF significantly decreased from 64.97% to 20.68%, while SDF increased from 2.37% to 16.53%. The significant degradation of dietary fiber by MW-1 confirms that this strain can efficiently utilize insoluble dietary fiber as its main carbon source.
[0115] Unwilling to be bound by theory, the inventors believe that the significant increase in SDF is mainly due to the metabolic activity of MW-1 breaking down cellulose and hemicellulose in soybean residue, with IDF partially degraded into monosaccharides, disaccharides, and oligosaccharides. As fermentation proceeds, SDF is further converted into reducing sugars, leading to an increase in reducing sugar content. MW-1's ability to efficiently degrade insoluble dietary fiber and promote the accumulation of soluble components fully demonstrates its industrial application potential in processing food byproducts with high insoluble dietary fiber content.
[0116] Example 4: Toxin content analysis during the fermentation process of Aspergillus ryuki MW-1
[0117] Aflatoxin, ochratoxin, fumonisin and penicillin in the samples were quantitatively analyzed using enzyme-linked immunosorbent assay kits (MM-0593O1, MM-1089O1, MM-1584O1, MM-95411O1). The kits were purchased from Jiangsu Enzyme Immunoassay Co., Ltd.
[0118] result:
[0119] Changes in the content of various fungal toxins during fermentation, as follows: Figure 4 As shown, the results indicate that during the MW-1 fermentation process, the levels of citric acid, aflatoxin, ochratoxin, and fumonisin did not exceed the limits set by the World Health Organization, ranging from 2.13-3.26%, 1.98-2.67%, 1.63-2.42%, and 2.00-2.89%, respectively. This demonstrates that the fermentation process did not cause contamination with natural mycotoxins, highlighting its potential as a food resource.
[0120] Example 5: Evaluation of the processing characteristics of fermented soybean residue by Aspergillus ryukyu MW-1
[0121] The processing characteristics of the samples were tested using the following methods:
[0122] Water-holding capacity of the sample: Accurately weigh 1g of sample, place it in a test tube, and record the mass. Then add 30mL of distilled water, and incubate the mixture at 37℃ and 150rpm for 4h. Weigh the test tube and the remaining material together, and calculate the mass difference before and after adsorption to determine the water-holding capacity.
[0123] Swelling capacity of the sample: 1 g of sample was diluted in 50 mL of deionized water and magnetically stirred for 24 hours. The volume of the sample was measured before and after diffusion, and the volume difference was calculated to determine the swelling capacity (SC).
[0124] Oil holding capacity of the sample: 1g of sample was mixed with 25mL of soybean oil, and the mixture was incubated on a shaker at 37℃ and 180rpm for 4h. The mass difference before and after adsorption was calculated to determine the oil holding capacity.
[0125] Emulsifying activity index: 1 mL of soybean oil and 9 mL of 10 mg / mL sample suspension were homogenized under 400 W ultrasound for 3 min. At 0 min and 10 min, 50 μL of the bottom emulsion was transferred to 100 mL of 1 mg / mL SDS solution. The absorbance of the sample was then measured at 500 nm using a microplate reader, with 1 mg / mL SDS solution as a blank control. The emulsifying activity index (EAI) and emulsifying stability index (ESI) were then calculated according to formulas (I) and (II), respectively:
[0126] EAI(m 2 / g)={(2×2.303) / [C×(1-φ)×104]}×A500×Dilution factor(I)
[0127] ESI (%) = 100 × A10 / A0 (II)
[0128] Where: A500 is the absorbance at 500nm at 0min; φ is the oil phase volume fraction (v / v) (φ=0.1); C is the protein concentration (0.001 in this example);
[0129] A0 and A10 are the absorbance values of the sample at 0 min and 10 min, respectively.
[0130] The measurement results are shown in Table 1 below:
[0131]
[0132] The water-holding and oil-holding capacities of food raw materials significantly affect the texture and stability of the final product. As shown in Table 1, the water-holding and oil-holding capacities of the samples significantly increased with prolonged fermentation time, rising from 3.20 g / g and 2.47 g / g to 4.02 g / g and 5.88 g / g, respectively, after 120 h of fermentation. The significant changes in the water-holding and oil-holding capacities of soybean residue after fermentation were influenced by changes in its chemical composition and structure. Specifically, the ratio of SDF and protein increased significantly after 48 h; these components have excellent water-holding capacity. Simultaneously, the structure of the soybean residue changed from a dense state to a looser and more brittle state.
[0133] SC (Soybean Residue Scores) is one of the key indicators characterizing the hydration properties of food. Table 1 shows that the SC value of soybean residue continuously increases during fermentation, reaching 10.80 mL / g after 120 hours. Not wanting to be bound by theory, the inventors believe this change may be related to changes in its composition and structural properties, involving the dissociation of cellulose-protein complexes, the dissolution of soluble substances, and the reduction in the particle size of fermented soybean residue.
[0134] Food ingredients with high emulsifying capacity are widely used in meat, baking, and dairy products due to their advantages in improving food texture, extending shelf life, reducing oil loss, and increasing processing efficiency and quality. Table 1 shows that the EAI value of unfermented soybean residue is 7.06 m² / g. After fermentation, the EAI value of the soybean residue increased significantly, reaching a peak of 39.47 m² / g after 120 hours, and then stabilized. Not wanting to be bound by theory, the inventors believe that the enhanced emulsifying properties of fermented soybean residue may be related to the reduction in particle size and the increase in soluble components after fermentation.
[0135] Example 6: Evaluation of the probiotic properties of fermented soybean residue by Aspergillus ryukyu MW-1
[0136] Samples with different fermentation times were homogenized under high pressure at 90 MPa, and then inoculated with lactic acid bacteria (Lactobacillus plantarum Z1 and Lactobacillus bulgaricus CICC 6103) at an inoculation ratio of 2% (cell concentration: 25 mg / mL) for fermentation. Samples were taken every 4 hours at 30℃ and 200 rpm until fermentation was terminated at 48 hours. The following indicators were measured on the samples:
[0137] The pH of the samples was measured using a pH meter, the viable cell count (CFU / mL) in the fermentation medium was determined using plate counting, and the lactic acid content in the samples was determined using potentiometric titration.
[0138] result:
[0139] The changes in viable cell count, pH value, and lactic acid content during the culture of samples with *Lactobacillus plantarum* Z1 and *Lactobacillus bulgaricus* CICC 6103 are as follows: Figure 5 As shown in Figures A, B, and C. During fermentation, the pH value decreased significantly from the initial value of 4.72 to 2.91 (Z1) and 3.07 (CICC 6103). This change is typical of lactic acid bacteria fermentation in high-protein foods and is mainly attributed to the accumulation of organic acids (lactic acid) produced during their metabolism.
[0140] With prolonged fermentation time, the growth of both lactic acid bacteria showed a significant increase. *Lactobacillus plantarum* entered its rapid proliferation phase at 36 hours, while *Lactobacillus bulgaricus* entered its rapid proliferation phase at 28 hours. Both entered a stable growth phase around 40 hours of fermentation, with viable cell counts stabilizing at 102. 9 CFU / mL or higher.
[0141] Lactic acid is a key metabolite of lactic acid bacteria, and its content continuously increases during fermentation. Z1 and CICC 6103 reached lactic acid contents of 6.75 g / L and 7.05 g / L, respectively, after 48 hours of fermentation. This indicates that the fermented soybean residue has the potential to serve as a prebiotic substrate.
[0142] Example 7: Comparison of the fermentation ability of Aspergillus ryukyu MW-1 and commercially available strains of soybean residue
[0143] Commercially available Aspergillus ryuko strains CICC 2257 and CICC 2396 were fermented using the same method as in Example 2. The mycelial weight was measured using the same method as in Example 3, and the processing characteristics of the fermented soybean residue were measured using the same method as in Example 4. A control group was prepared by fermenting soybean residue culture medium (i.e., fresh soybean residue mixed with distilled water).
[0144] After 120 hours of fermentation, the mycelial weight was measured as follows: Figure 6 As shown, the transformation mycelium mass of MW-1 is 51.92 g / 100 g, which is comparable to the transformation capacity of CICC 2396, and both are significantly higher than CICC 2257 (37.78 g / 100 g).
[0145] The results of the processing characteristics measurement are shown in Table 2 below:
[0146]
[0147] As can be seen from Table 2, Aspergillus ryuko MW-1 exhibits excellent bioconversion ability during the fermentation of soybean residue, especially in terms of water holding capacity, water swelling capacity and emulsifying activity index (EAI), which are significantly better than commercially available strains CICC2257 and CICC 2396.
[0148] In terms of water retention capacity, MW-1 had a value of 4.02 g / g, which was about 1.25 times higher than the unfermented group (3.20 g / g), indicating that MW-1 had the most outstanding ability in water retention and adsorption.
[0149] In terms of oil holding capacity, MW-1 has a value of 5.88 g / g, which is 1.21 times that of CICC 2257 (4.85 g / g) and 1.87 times that of CICC2396 (3.13 g / g), indicating that MW-1 has a strong advantage in the adsorption and conversion of fat-soluble substances.
[0150] In terms of water swelling capacity (SC), MW-1 reaches 10.81 mL / g, which is 1.68 times that of CICC 2396 (6.4 mL / g), demonstrating its excellent performance in hydration and dissolution.
[0151] In terms of emulsifying activity index (EAI), MW-1 has an EIA of 39.47 m² / g, which is 1.24 times that of CICC 2257 (31.89 m² / g) and 1.55 times that of CICC 2396 (25.39 m² / g), indicating that it is the most outstanding in terms of oil-water emulsification ability.
[0152] In summary, MW-1 demonstrates significant advantages in various processing characteristics, especially in improving the emulsification, water solubility, and structural stability of fermentation products. Its performance is more significant than that of commercially available strains, showing great application potential and making it suitable for the development of efficient fermentation processes and functional foods.
[0153] Example 8: Production of Fungal Protein Powder
[0154] The food raw materials prepared in Example 2 were mixed with distilled water at a ratio of 1:8 (w / v) and thoroughly mixed. The mixture was then subjected to high-pressure homogenization pretreatment at 90 MPa and 3 L / h. The pH of the mixture was then adjusted to 9.0 using 1 M KOH. The mixture was stirred at room temperature for 60 min and centrifuged at 4 °C and 8000 rpm for 30 min. The lower precipitate was discarded to obtain the supernatant (bacterial protein solution).
[0155] The pH of the supernatant was adjusted to 4.5 using 1M HCl, and the mixture was allowed to stand at room temperature for 2 hours. It was then centrifuged at 8000 rpm for 30 minutes at 4°C to obtain the lower precipitate, which is the bacterial protein. The pH of the lower precipitate was adjusted to 7 using 1M KOH, and then spray-dried to obtain protein powder.
[0156] Example 9: Evaluation of recovery efficiency of different protein production methods
[0157] The protein production method in Example 8 is referred to as the high-pressure homogenization-assisted alkali method (HPH-P).
[0158] Another method for protein production using the alkaline method (ASP) differs from HPH-P in that it omits the high-pressure homogenization pretreatment step and directly adjusts the pH of the mixed system with 1M KOH.
[0159] The protein content M0 of fermented soybean residue was determined by the Dumas method. The mass of the raw materials used, M1, was obtained by weighing, and the mass of the obtained protein powder, M2, was obtained by weighing. The protein recovery efficiency was then calculated using formula (III).
[0160] Bacterial protein recovery efficiency (%) = M2 / M1 / M0 × 100% (III).
[0161] result:
[0162] The protein recovery efficiency results of the two production methods are as follows: Figure 7As shown, the protein recovery efficiency of alkaline extraction was 14.70%, while high-pressure homogenization-assisted extraction significantly improved it to 79.97%. This result indicates that the application of high-pressure homogenization not only improves the protein recovery rate but also promotes the efficient release of mycelial proteins. The inventors believe this may be due to its ability to disrupt cell structure, thereby enhancing the extraction effect. The significant improvement in recovery efficiency highlights the great potential of high-pressure homogenization-assisted extraction technology in optimizing the protein separation process in the Aspergillus ryukyu MW-1 fermentation substrate.
[0163] Example 10: Evaluation of processing characteristics of different protein production methods
[0164] The following measurements were performed on the protein powders prepared by the two methods described above to evaluate their processing characteristics:
[0165] Solubility: The prepared protein sample (0.1 g) was mixed with distilled water (10 mL) and stirred at room temperature for 1 h. Then, the mixture was centrifuged at 10,000 rpm for 10 min to separate the protein supernatant. The protein content was determined using the Bradford assay kit.
[0166] Water-holding capacity and oil-holding capacity: Mix 50 mg of protein sample with 1 mL of distilled water or soybean oil and stir at room temperature for 2 h. Then centrifuge the mixture at 8000 rpm for 20 min, separate and weigh the protein sample that has adsorbed water or oil, and determine the water-holding capacity or oil-holding capacity of the sample based on the weight difference before and after adsorption.
[0167] Emulsifying ability: The emulsifying activity index (EAI) and emulsifying stability index (ESI) of the protein samples were determined using the same method as in Example 4.
[0168] Foaming properties: 10 mL of the 20 mg / mL sample solution was placed in a 50 mL graduated glass cylinder and stirred at 10,000 rpm for 1 min using a high-speed shear mixer. The initial foam volume (V0) was recorded immediately after mixing, and the foaming capacity (FA) was calculated using formula (IV):
[0169] FA(%)=V0 / V L ×100 (IV)
[0170] Where V0 is the initial foam volume at 0 min, V L This refers to the volume of the sample solution (10 mL).
[0171] Next, record the foam volume (V) at 30 minutes. 30 And calculate the foam stability (FS) using the following formula (V):
[0172] FS(%)=V 30 / V0×10 (V)
[0173] result:
[0174] The results of protein solubility are as follows Figure 8 As shown in Figure A. Protein solubility is one of the key functional properties, directly affecting not only the application performance of proteins but also significantly influencing other functional properties, such as foaming and gelling properties. From Figure 8 As shown in Figure A, the protein solubility of ASP is 63.72%. In contrast, the protein solubility of high-pressure homogenization (HPH-P) is not much different from that of ASP, indicating that this treatment method better preserves its solubility.
[0175] The results of the water-holding and oil-holding capacities of proteins are as follows: Figure 8 China B and Figure 8 As shown in Figure C, the water-holding and oil-holding capacities of proteins play a decisive role in food texture regulation, flavor optimization, and processing stability. It can be seen that there are significant differences in the water-holding and oil-holding capacities of proteins obtained by the HPH-P and ASP methods. The water-holding capacity of HPH-P protein is 2.95 g / g, which is 37.2% higher than that of ASP protein (2.15 g / g, p < 0.05). The inventors believe that this enhanced hydration capacity may stem from the exposure of hydrophilic groups in its tertiary protein structure. Conversely, the oil-holding capacity of HPH-P (1.515 g / g) is 14.4% lower than that of ASP (1.77 g / g), indicating that the difference in the distribution of hydrophobic amino acid residues affects lipid binding efficiency. These differences in functional properties provide diversity for food development in different scenarios: the good water-holding capacity of HPH-P protein makes it an ideal texture modifier for water-sensitive systems (such as meat analogues and plant-based cheeses), while the good oil-holding capacity of ASP highlights its potential in emulsified systems (such as salad dressings and margarine).
[0176] The results of protein emulsification ability are as follows Figure 8 As shown in Figure D, the emulsifying activity index of HPH-P (47.64 m) can be observed. 2 / g) compared to ASP (38.12 m 2 The percentage of protein (g) increased by 25.03%, indicating that HPH treatment significantly enhanced the protein's oil-water interface adsorption capacity and emulsion formation efficiency.
[0177] The results of protein foaming properties are as follows Figure 8 As shown in Figure E, the foaming ability of HPH-P protein (21.10%) increased by 29.85% compared with that of ASP protein (16.25%, p<0.05). The inventors believe that this may be closely related to its enhanced molecular flexibility (reduced α-helix content).
[0178] This document uses specific embodiments to illustrate the principles and implementation methods of the present invention. The descriptions of the embodiments above are merely for the purpose of helping to understand the method and central idea of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from its principles, and these improvements and modifications also fall under the protection of the claims of the present invention.
Claims
1. Aspergillus Ryukyu( Aspergillus luchuensi The use of s)MW-1 in the production of protein food raw materials from fermented soybean residue, among which, The Aspergillus ryukyu was deposited on March 31, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNO.41859.
2. The use as described in claim 1, characterized in that, The soybean residue is fresh soybean residue with a moisture content of 83% to 85%.
3. The use of Aspergillus ryukyu MW-1 in the treatment of insoluble dietary fiber food by-products, among which, The Aspergillus ryukyu was deposited on March 31, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.41859.
4. A method for preparing a protein food ingredient, characterized in that, The method includes the following steps: Aspergillus ryuko MW-1 was cultured in PDA medium and mycelium was obtained by filtration; The mycelium was added to a soybean residue culture medium for fermentation, and then freeze-dried to obtain a protein food raw material. The *Aspergillus ryuki* was deposited on March 31, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNO.41859.
5. The method according to claim 4, characterized in that, The ratio of fresh soybean residue to distilled water in the soybean residue culture medium is 1:3.5-4.5; the moisture content of the fresh soybean residue is 83% to 85%; and the fermentation conditions are 26℃ to 30℃, 100rpm to 200rpm, and fermentation for 2 to 5 days.
6. A method for preparing protein powder, characterized in that, The method includes the following steps: Aspergillus ryuko MW-1 was cultured in PDA medium and mycelium was obtained by filtration; The mycelium was added to soybean residue culture medium for fermentation, and then freeze-dried to obtain protein food raw material; The protein food raw material is mixed with distilled water and subjected to high-pressure homogenization. The pH of the protein food raw material solution that has been homogenized under high pressure is adjusted with an alkaline solution, stirred at room temperature, centrifuged, and the lower precipitate is discarded to obtain the supernatant. The pH of the supernatant was adjusted with an acid solution, allowed to stand at room temperature, centrifuged, the pH of the lower precipitate was adjusted with an alkaline solution, and then spray-dried to obtain the protein powder. The *Aspergillus ryuki* was deposited on March 31, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCCNO.41859.
7. The method of claim 6, characterized in that, The ratio of the protein food raw material to distilled water is 1:8-12, and the high-pressure homogenization treatment conditions are 80Mpa to 100Mpa and 2L / h to 4L / h.
8. The method of claim 6, characterized in that, The alkaline solution is KOH solution; the acid solution is HCl solution; the pH of the protein food raw material solution after high-pressure homogenization is adjusted to 7.5 to 9.5 using the alkaline solution, and stirred at room temperature for 30 to 90 minutes; and the pH of the supernatant is adjusted to 4 to 5 using the acid solution, and allowed to stand at room temperature for 1 to 3 hours, and the pH of the lower precipitate is adjusted to 6.5 to 7.5 using the alkaline solution.
9. The method of claim 8, characterized in that, Adjust the pH of the protein food raw material solution that has undergone high-pressure homogenization to 8.9 to 9.1, and stir at room temperature for 55 to 65 minutes.