SNP loci associated with the number of spikelets per spike and the number of grains per spike of wheat and application thereof

Abstract

The application discloses SNP sites related to the number of spikelets per spike and the number of grains per spike of wheat and application thereof, and relates to a kit, primers and use of the above elements in identifying or assisting in identifying the number of spikelets per spike and the number of grains per spike of wheat. The application provides a new method for molecular marker assisted selection breeding of wheat, and has important significance in cultivating high-yield wheat varieties and research.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, and in particular relates to SNP sites related to the number of spikelets and grains per ear of wheat and their applications. Background Technology

[0002] As one of the world's major food crops, wheat's yield and quality improvement are of paramount importance to global food security. The number of grains per spike is one of the three factors contributing to yield, and increasing both the number of spikelets and grains per spike significantly impacts yield, thus contributing to increased wheat production. Therefore, identifying the QTL (quantitative trait loci) blocks controlling the number of spikelets / grains per spike in wheat and their superior allelic variations provides a theoretical basis for genetic improvement of grain number per spike using marker-assisted selection and further applications of major-effect QTLs, while also holding significant importance for the genetic improvement of wheat yield traits.

[0003] Currently, researchers have identified a large number of QTLs that regulate the number of spikelets and grains per spike. The number of spikelets in wheat affects wheat yield by regulating the number of grains per spike. Professor Zheng Youliang's research team at the Wheat Institute of Sichuan Agricultural University used wheat 55K SNP chips and SSR markers to genotype a population of 199 recombinant inbred lines created by crossing the winter wheat variety '20828' with the nationally approved wheat variety Chuannong 16 (Liu et al. 2018). At the same time, they identified the phenotype of spikelet number in this population at eight ecological sites over three years. QTL mapping was performed on each spikelet locus, and five stable QTLs were detected on chromosomes 2D, 4B, 5A, 5B, and 5D. Among them, QSns.sau-2D (LOD = 3.47-38.24, PVE = 10.16-45.68%) was detected in all eight environments, explaining 10.16-45.68% of the phenotypic variation, and was located on chromosome 2DS. 660K SNP microarray typing was performed on the parents '20828' and Chuannong 16, and the KASP marker KASP-AX-94721936, which is closely linked to QSns.sau-2D, was successfully developed using the SNP typing data. The major QTL QSns.sau-2D was validated using this marker in two different genetic background populations. T-test results showed that lines containing the '20828' synergistic locus of this major QTL had 6.93% to 14.72% more spikelets per spike than lines without this locus, with an average increase of 11.38%. Further analysis revealed significant differences between lines containing and without this major QTL locus in flowering time, plant height, spike length, thousand-grain weight, and number of grains per spike (P < 0.05). Figure 4 This indicates that the number of spikelets per spike is related to these traits.

[0004] Zhang Qianqian et al. used a recombinant inbred line population (KJ-RIL) derived from "Ke Nong 9204" and "Jing 411" to analyze the grain number trait under 10 environments, and located qKnps-2A in the range of 78.5-83.0 cM between Ax-111707919 and Ax-111626797. To further clarify the genetic effect of QTL-qKnps-2A, genetic analysis was performed on 188 families of KJ-RIL using the closely linked marker Ax-110454852. The results... The results show that the superior haplotype qKnps-2A significantly increases the number of grains per spike, as well as spike weight and the number of spikelets per spike, with an average yield increase of 3.72% per plant; however, this superior haplotype has a negative effect on thousand-grain weight. An analysis of the application of qKnps-2A in 310 varieties (lines) revealed that while the superior haplotype qKnps-2A has been selected by breeders, its utilization rate is low, indicating significant potential for genetic improvement. These findings provide a theoretical basis for the genetic improvement of spike grain number and the further application of the major-effect QTL qKnps-2A.

[0005] Despite the large number of QTLs identified so far that are associated with the number of spikelets per spike / grains per spike in wheat, most of these QTLs have a small phenotypic contribution and poor repeatability across different years and environments, making them difficult to apply to the genetic improvement of the number of spikelets per spike / grains per spike in wheat. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide SNP loci related to the number of spikelets and grains per ear of wheat and their applications.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows.

[0008] The purpose of the SNP site is as follows: the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1. When this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B.

[0009] The purpose is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear of wheat, wherein the number of spikelets per ear and / or the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.

[0010] A method for identifying or assisting in the identification of the number of spikelets per ear and / or the number of grains per ear in wheat, comprising: performing PCR amplification on any DNA fragment in the wheat genomic DNA containing the SNP site described in claim 1; and performing enzyme digestion identification on the PCR amplification product, wherein the enzyme digestion comprises the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR product; diluting the PCR product 20 to 50 times, using it as a template, amplifying with primers 2F and 2R to obtain PCR product; digesting the PCR product with the restriction endonuclease SmaI; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the size of the number of spikelets per ear and / or the number of grains per ear in wheat is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B;

[0011] The DNA fragment amplified by PCR is the 5' end 473-571bp of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pairs 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0012] The primer combinations are primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5;

[0013] The purpose is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear of wheat by detecting single nucleotide polymorphisms at the following SNP sites in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, and when this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B; the number of spikelets per ear and / or the number of grains per ear of wheat is: wheat homozygous for genotype A is greater than or can be greater than wheat homozygous for genotype B.

[0014] The use of the reagent or kit, wherein the reagent or kit comprises at least the primer combination as described in claim 2 and the necessary restriction endonuclease components;

[0015] The purpose is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear of wheat by detecting single nucleotide polymorphisms at the following SNP sites in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, and when this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B; the number of spikelets per ear and / or the number of grains per ear of wheat is: wheat homozygous for genotype A is greater than or can be greater than wheat homozygous for genotype B.

[0016] More preferably, the restriction endonuclease is SmaI enzyme.

[0017] More preferably, the reagent or kit further includes template DNA, buffer for PCR amplification, dNTPs, and other components necessary for gene detection.

[0018] More preferably, the target DNA fragment for PCR amplification by the reagent or kit is designed to be the 473-571 bp from the 5' end of SEQ ID NO.1.

[0019] More preferably, the PCR amplification specific primer combination includes: primer pairs 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pairs 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5.

[0020] The beneficial effects of adopting the above technical solution are as follows: Through genetic variation analysis and extensive data processing in a natural wheat population, this invention ultimately verified a stable major-effect SNP corresponding to a significant phenotypic difference, located at position 498 from the 5' end of SEQ ID NO. in the sequence listing. By designing a dCAPS marker for this SNP site, two genotypes were discovered: genotype A (C) and genotype B (G). Through multiple experiments and data verification, in the homozygous types of these two genotypes, the number of spikelets per spike and the number of grains per spike were: wheat homozygous for genotype A > wheat homozygous for genotype B. The research results of this invention are of great importance to wheat breeding. This invention provides a clear association of target traits: by identifying SNP sites related to the number of spikelets per spike and the number of grains per spike in wheat, specific and operable targets are provided for wheat breeding. Breeders can directly screen for these sites, improving the targeting and efficiency of breeding. This invention also develops molecular markers and detection kits and identification methods based on these markers, enabling targeted screening and breeding through molecular marker-assisted selection (MAS) during the breeding process. MAS (Magnetic Marker Syndrome) enables accurate genotyping in early wheat growth, reducing the uncertainty and time cost of phenotypic selection in traditional breeding. This invention utilizes molecular markers to determine wheat genotypes at the seed or seedling stage, allowing for early screening of individuals with desired traits and significantly shortening the breeding cycle. The SNP-based identification method is more accurate and reliable than traditional phenotypic identification, reducing the influence of environmental factors on phenotypes and more accurately reflecting the genetic potential of wheat. The primer combinations and gene detection kits developed in this invention provide wheat breeders with convenient tools for use in various laboratories and breeding environments. In terms of wheat breeding potential, the technology based on this invention holds promise for increasing wheat yield by screening and breeding wheat with specific SNP genotypes to improve the number of spikelets and grains per spike. Attached Figure Description

[0021] Figure 1 This is a schematic diagram of the gene structure of the SNP site and its associated gene (KeNong 9204) of this invention.

[0022] Figure 2 The electrophoretic detection results of the dCAPS-labeled enzyme digestion products for the SNPs of this invention were obtained. After two rounds of PCR amplification using primers F2 and R2, the PCR products were digested with enzymes, and the PCR products were 99 bp. This polymorphism can be recognized by SmaI. Among them, primer F2 itself contains a SmaI site, which can cut a 13 bp fragment. Therefore, the size of genotype A (C / C) after enzyme digestion is 86 bp. The size of genotype B (G / G) after enzyme digestion is two bands of 86 bp and 74 bp.

[0023] Figure 3This is a schematic diagram showing the association analysis results between the SNP sites of this invention and the number of spikelets per spike in a natural wheat population.

[0024] Figure 4 This is a schematic diagram showing the association analysis results between the SNP sites of this invention and the number of grains per spike in a natural wheat population. Detailed Implementation

[0025] The following embodiments illustrate the present invention in detail. All raw materials and equipment used in this invention are commercially available products and can be directly obtained through market purchase. The wheat materials used in the following embodiments are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and material information can be found on the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0026] It should be understood that, when used in this specification and the appended claims, the term "comprising" indicates the presence of a described feature, integral, step, operation, or element, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, or elements. It should also be understood that, as used in this specification and the appended claims, the term "and / or" refers to any combination of one or more of the associated listed items and all possible combinations, and includes such combinations.

[0027] As used in this application specification and the appended claims, the term "if" may be interpreted, depending on the context, as "when," "once," "in response to determination," or "in response to detection." Similarly, the phrase "if determined" or "if detected [the described condition or event]" may be interpreted, depending on the context, as meaning "once determined," "in response to determination," "once detected [the described condition or event]," or "in response to detection [the described condition or event]."

[0028] Furthermore, in the description of this application and the appended claims, the terms "first," "second," "third," etc., are used only to distinguish descriptions and should not be construed as indicating or implying relative importance. References to "one embodiment" or "some embodiments" in this application mean that one or more embodiments of this application include a specific feature, structure, or characteristic described in connection with that embodiment. Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in still other embodiments," etc., appearing in different parts of this specification do not necessarily refer to the same embodiment, but rather mean "one or more, but not all, embodiments," unless otherwise specifically emphasized. The terms "comprising," "including," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0029] Example 1: Specific primers and sequence analysis of SNPs

[0030] Based on our research and extensive data analysis and validation, we identified a stable and significantly phenotypic SNP in the coding region of the wheat (Kenong 9204) genome, corresponding to position 498 from the 5' end of SEQ ID NO.1. By designing dCAPS markers for this SNP site, we found that this site exhibits two genotypes in the naturally occurring wheat population: genotype A or I: C; and genotype B or II: G.

[0031] Based on the sequence differences in different wheat genomes, specific primers were designed for PCR amplification of DNA fragments containing the SNP site:

[0032] F1: CGACCATGCCGTACGCCGGC (SEQ ID NO: 2);

[0033] R1: CACATTAGTACGTGGTCCGT (SEQ ID NO: 3);

[0034] F2: ACCACAGGGGCCCGGGCGCCGGCCC (SEQ ID NO: 4);

[0035] R2: TGCTGCCGCGCACGTCCATC (SEQ ID NO: 5);

[0036] The target sequence for PCR amplification using primers F1 and R1 is shown in Sequence 1 of the sequence listing, positions 383-1441; the target sequence for PCR amplification using primers F2 and R2 is shown in Sequence 1 of the sequence listing, positions 473-571. Enzyme digestion analysis showed that this polymorphism could be recognized by SmaI.

[0037] Example 2: PCR-restriction polymorphism detection and genotyping of SNPs

[0038] 1) Extract genomic DNA from the wheat to be tested;

[0039] 2) Using the genomic DNA from step 1) as a template, perform PCR amplification with primers F1 and R1. The PCR amplification system (20 μL) consists of: 16.8 μL ddH2O, 0.2 μL KOD, 1 μL dNTP, 0.5 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), and 1 μL template (50-100 ng / μL).

[0040] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, for 32 cycles; 72℃ for 10 min; and storage at 16℃.

[0041] 3) Dilute the PCR product from step 2) 20 to 50 times and use it as a template for PCR amplification with primers F2 and R2. The PCR amplification system (20 μL) is as follows: ddH2O 7 μL, 2×Taq Mix 10 μL, primer F1 (10 μmol / L) and primer R1 (10 μmol / L) 1 μL, template (20 ng / μL) 1 μL.

[0042] PCR amplification conditions were: 95℃ for 3 min; 95℃ for 30 s, 58℃ for 10 s, 72℃ for 10-12 s, 32 cycles; 72℃ for 10 min, and stored at 16℃.

[0043] 4) Digest the PCR product obtained in step 3) with SmaI enzyme to obtain the digested product. Perform 4% agarose gel electrophoresis to detect whether the PCR product was digested into two fragments. Determine and record the status of the wheat sample at the specified site according to the following method:

[0044] If the enzyme digestion product is a single or large fragment, then the wheat being tested is homozygous for C at the specified site (represented as C / C). Figure 1 Lane G in the middle of the swimming lane;

[0045] If the enzyme digestion product consists of two or smaller fragments, then the wheat being tested is homozygous for G at the specified site (represented as G / G). Figure 1 Lane A in the middle of the pool.

[0046] 5) Based on the results of step 4), wheat is classified into two types, I and II, at the stated site:

[0047] I: C / C (i.e., homozygous genotype A);

[0048] II: G / G (i.e., homozygous genotype B);

[0049] The part before the " / " represents the case on one homologous chromosome, and the part after the " / " represents the case on another homologous chromosome.

[0050] Example 3: Generating natural populations using dCAPS markers and performing association analysis with the traits of number of spikelets per spike and number of grains per spike.

[0051] Each wheat variety in a natural population consisting of 320 hexaploid wheat samples was used as a test wheat variety. Genotyping was performed according to the method in step 2. The amplification products of a random sample of wheat varieties were sequenced for verification. The results are shown in Table 1.

[0052] Table 1 shows the polymorphic sites in the natural wheat population.

[0053]

[0054]

[0055]

[0056]

[0057]

[0058] Example 4: Association analysis between SNP loci and the number of spikelets per spike in a natural wheat population

[0059] In 2018, wheat populations of the above-mentioned natural populations were planted in dry-hot and dryland, hydrothermal and irrigated areas at the Luancheng Experimental Station of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng, Hebei Province); in 2019, they were planted in dry-hot and dryland, hydrothermal and irrigated areas at the Hengshui Experimental Farm of the Agricultural Resources Research Center of the Chinese Academy of Sciences (Luancheng and Hengshui, Hebei Province); and in 2020, they were planted in dryland and dry-hot areas at the Institute of Crop Science of the Chinese Academy of Agricultural Sciences (Zhaoxian Experimental Station). The number of spikelets per spike and the number of grains per spike for each wheat variety were investigated. The correlation between the number of spikelets per spike and the number of grains per spike and the polymorphic loci was analyzed using Tassel 2.1 software. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P<0.05 as the significance level. The results are shown in Table 2.

[0060] Table 2. Association analysis results of TaWFZP-2D gene polymorphism sites and the number of spikelets per spike in the natural population.

[0061]

[0062] The association analysis results in Table 2 show that the differences in spikelet number per spike between the two types formed by the natural population of 320 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, type I wheat had a higher spikelet number per spike than type II wheat. In several environments, type I wheat materials had 0.25, 0.21, 0.36, 0.20, 0.17, 0.17, -0.05, 0.14, and 0.15 more spikelets per spike than type II wheat, respectively. This study of the natural population indicates that type I is a superior genotype for increasing spikelet number per spike in wheat.

[0063] Table 3. Association analysis results of TaWFZP-2D gene polymorphism sites and grain number per ear in natural populations.

[0064]

[0065]

[0066] The association analysis results in Table 3 show that the differences in grains per spike between the two types formed by the natural population of 320 hexaploid wheat accessions shown in Table 1 were statistically significant (P < 0.05). Specifically, type I wheat had a higher grains per spike than type II wheat. In several environments, type I wheat had 4.47, 3.07, 4.03, 2.03, 3.30, 2.39, 1.99, -0.54, 2.78, and 3.42 more spikelets than type II wheat, respectively. This study of the natural population indicates that type I is a superior genotype for increasing grains per spike in wheat.

[0067] In the above embodiments, the descriptions of each embodiment have different focuses. For parts that are not described in detail or recorded in a certain embodiment, please refer to the relevant descriptions of other embodiments.

[0068] As can be seen from the above embodiments, this invention discloses SNP loci associated with the number of spikelets and grains per spike in wheat and their applications. Through genetic variation analysis of the TaWFZP-2D gene coding region in a natural wheat population, this invention identified a SNP corresponding to position 498 from the 5' end of sequence listing 1. This SNP has two genotypes: genotype A (C) and genotype B (G). Association analysis showed that in homozygous types of these two genotypes, the number of spikelets and grains per spike was: wheat homozygous for genotype A > wheat homozygous for genotype B. This invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting this SNP, wheat varieties with higher numbers of spikelets and grains per spike can be identified. This invention provides a new method for marker-assisted selection breeding of wheat, which is of great significance in breeding high-yielding wheat varieties or in research. The research findings of this invention are of great importance to wheat breeding. This invention provides clear target trait associations: by identifying SNP loci associated with the number of spikelets and grains per spike in wheat, it provides specific and actionable targets for wheat breeding. Breeders can directly screen for these loci, improving the targeting and efficiency of breeding. This invention also develops molecular markers and marker-based detection kits and identification methods, enabling targeted screening and breeding through marker-assisted selection (MAS) during the breeding process. MAS can accurately identify genotypes in the early stages of wheat growth, reducing the uncertainty and time cost of relying on phenotypic selection in traditional breeding. This invention can use molecular markers to determine the genotype of wheat at the seed or seedling stage, thereby screening individuals with the desired traits in advance and significantly shortening the breeding cycle. The SNP locus-based identification method of this invention is more accurate and reliable than traditional phenotypic identification, reduces the influence of environmental factors on phenotype, and can more accurately reflect the genetic potential of wheat.

[0069] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.

Claims

1. The uses of SNP sites, characterized by: The SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.

1. When this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B. The purpose is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear of wheat, wherein the number of spikelets per ear and / or the number of grains per ear is: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B.

2. A method for identifying or assisting in the identification of the number of spikelets per ear and / or the number of grains per ear of wheat, characterized in that: A DNA fragment containing the SNP site described in claim 1 from any segment of the wheat genomic DNA to be tested is amplified by PCR, and the PCR amplification product is identified by enzyme digestion. The enzyme digestion includes the following steps: using wheat genomic DNA as a template, amplifying with primers 1F and 1R to obtain PCR products; diluting the PCR product 20 to 50 times, using it as a template, amplifying with primers 2F and 2R to obtain PCR products; digesting the PCR product with the restriction endonuclease SmaI; if the PCR product cannot be cleaved, the nucleotide polymorphism site is C / C, and the genotype is A; if the PCR product can be cleaved, the nucleotide polymorphism site is G / G, and the genotype is B; the number of spikelets per ear and / or the number of grains per ear of wheat is as follows: wheat homozygous for genotype A is greater than or candidate greater than wheat homozygous for genotype B; The DNA fragment amplified by PCR using primers 2F and 2R is the 5' end 473-571bp of SEQ ID NO.1; the specific primer pairs for PCR amplification are primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3, and primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.

5.

3. The application of primer combinations, characterized in that: The primer pairs are primer pairs 1F and 1R consisting of SEQ ID NO.2 and SEQ ID NO.3 in the sequence listing, and primer pairs 2F and 2R consisting of SEQ ID NO.4 and SEQ ID NO.5; The purpose is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear of wheat by detecting single nucleotide polymorphisms at the following SNP sites in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, and when this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B; the number of spikelets per ear and / or the number of grains per ear of wheat is: wheat homozygous for genotype A is greater than or can be greater than wheat homozygous for genotype B.

4. The uses of the reagent, characterized in that: The reagent comprises at least the primer combination as described in claim 3 and the restriction endonuclease SmaI. The purpose is to identify or assist in identifying the number of spikelets per ear and / or the number of grains per ear of wheat by detecting single nucleotide polymorphisms at the following SNP sites in the wheat genome; the SNP site corresponds to the 498th base from the 5' end of the sequence shown in SEQ ID NO.1, and when this site is C / C homozygous, the corresponding genotype is A; when this site is G / G homozygous, the corresponding genotype is B; the number of spikelets per ear and / or the number of grains per ear of wheat is: wheat homozygous for genotype A is greater than or can be greater than wheat homozygous for genotype B.

5. The use according to claim 4, characterized in that: The reagents also include template DNA, buffer for PCR amplification, dNTPs, and other necessary components for gene detection.

6. The use according to claim 4 or 5, characterized in that: The target DNA fragment for PCR amplification using primers 2F and 2R is designed to be the 473-571 bp from the 5' end of SEQ ID NO.1.

Images