A kasp molecular marker related to peanut oil content and application thereof
By locating SNP sites on the peanut A03 chromosome through genome-wide association analysis and developing KASP molecular markers, the problem of low molecular marker detection efficiency in peanut breeding was solved, enabling rapid and accurate identification of peanut kernel oil content and improving breeding efficiency.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CROP RES INST GUANGDONG ACAD OF AGRI SCI
- Filing Date
- 2025-08-05
- Publication Date
- 2026-04-17
AI Technical Summary
In existing technologies, the detection efficiency of molecular markers during peanut breeding is low, making it difficult to meet the needs of rapid and efficient breeding, especially for the complex regulatory mechanism of peanut oil content, where there is a lack of effective KASP molecular markers.
Genome-wide association analysis was used to locate the significant SNP site qOC_A03.1 on the peanut A03 chromosome. KASP molecular marker primers were designed, and KASP technology was used to identify the genotype of peanut oil content. KASP molecular markers were developed to improve breeding efficiency.
It enables rapid and accurate identification of peanut kernel oil content, improves breeding efficiency, provides a high-throughput molecular marker-assisted selection method, and is applicable to the breeding of peanut varieties with different oil contents.
Smart Images

Figure CN120738392B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular genetic breeding and relates to a KASP molecular marker related to peanut oil content and its application. Background Technology
[0002] Peanuts (Arachis hypogaea L.) are one of the world's most important oilseed crops, as well as an important nut or food ingredient. Common peanuts generally have an oil content of over 50%. High-oil peanut varieties have a high oil content and are suitable for oil extraction, while low-oil peanut varieties (approximately 45%) can significantly reduce oil intake, making them particularly suitable as nuts or food ingredients and reducing the risk of nutritional excess. Breeding varieties with different oil contents can enrich the sources of edible peanuts, improve palatability, and meet the market's demand for diversified peanut varieties.
[0003] With the completion of peanut genome sequencing, selection breeding based on the genome and known loci associated with superior traits has become a new direction in peanut breeding, making genotypic selection breeding based on molecular markers / microarrays possible. Previously used molecular markers, such as SSR, DArT, and CAPS, are cumbersome and complex to operate, have low detection efficiency, and are difficult to meet production needs. Therefore, establishing faster, more efficient, and convenient marker detection technologies is urgent. SNP markers, with their large number, wide distribution, high throughput, and fast speed, have become the next generation of genetic markers. Currently, KASP technology (competitive allele-specific PCR) is one of the main SNP genotyping methods internationally. Although some studies have reported loci associated with peanut oil content, the oil content trait has a complex regulatory mechanism. Therefore, developing KASP molecular markers associated with oil content can provide more choices and support for the breeding of peanut varieties with different oil contents. Summary of the Invention
[0004] This invention identifies significant SNP loci associated with peanut oil content through genome-wide association analysis (GWAS). Based on the located candidate regions and genetic variation information of candidate genes, KASP primers are designed, and KASP markers are developed, providing relevant KASP molecular markers and their applications. Based on KASP genotyping technology, the genotype of peanut samples can be rapidly and accurately identified, improving the efficiency of peanut variety breeding.
[0005] The technical solution adopted by this invention to achieve its purpose is as follows:
[0006] A KASP molecular marker associated with peanut oil content was identified, with its SNP located on peanut chromosome A03 (reference genome: *Peanuta fusiforme*), named qOC_A03.1, and its location interval being a 102 kb range between A03: 8591523 and 8693979. Figure 1 ).
[0007] Furthermore, a candidate key gene, AhWRI1.3, was identified within the candidate region. Haplotype analysis revealed that a variant site (A03_8641246) in the candidate gene AhWRI1.3 was significantly associated with peanut oil content. This site is located in the 3'UTR region of the AhWRI1.3 gene, with a nucleotide sequence polymorphism of T / C (A / G for the antisense strand). Phenotypic association analysis showed that the H2 haplotype (CC genotype) had a significantly lower oil content than the H1 haplotype (TT genotype). Figure 2 ).
[0008] Furthermore, the KASP molecular marker primer sequences developed by the SNP are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 (Table 1).
[0009] Table 1. KASP molecular marker primers developed based on the peanut qOC_A03.1 site.
[0010] SEQ ID NO.1 F TTGAGCGAATACCCCATCCG SEQ ID NO.2 R1 CGTTGCCCTTTCGAGATAATTGTT SEQ ID NO.3 R2 CGTTGCCCTTTCGAGATAATTGTC
[0011] Furthermore, the genotyping method for peanut kernel oil content can be achieved by extracting genomic DNA from peanut leaves and performing PCR amplification on the extracted genomic DNA using KASP marker primer sequences of the SNPs shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3.
[0012] Furthermore, the PCR amplification method is as follows:
[0013] The total reaction volume for PCR amplification was 5 μl, which included 2.4 μl of genomic DNA, 2.5 μl of 2×KASP MasterMix, and 0.1 μl of KASP Essay Mix (primer mixing working solution).
[0014] Furthermore, the KASP primer working solution includes: a universal forward primer (F), a reverse primer for FAM fluorescence binding of a specific sequence (R1), a reverse primer for HEX fluorescence binding of a specific sequence (R2), and pure water. Specifically, the primer working solution is prepared in advance, and the primers are diluted with pure water to 10 μM and then the primer working solution is prepared according to the ratio of R1:R2:F = 1:1:3. The pure water mentioned in this article refers to deionized water.
[0015] Furthermore, the PCR reaction procedure is as follows: Step 1, 94℃, 15min; Step 2, 94℃, 20s, 61~55℃ gradient PCR, 1min, decreasing by 0.6℃ for each cycle, for 10 cycles; Step 3, 94℃, 20s, 55℃, 1min, for 26 cycles; Step 4, store at 10℃.
[0016] Furthermore, the PCR results were analyzed using the Pherastar fluorescence analyzer (KASP).
[0017] Furthermore, this invention also provides an application of KASP molecular markers related to peanut oil content. Using the aforementioned KASP markers, haplotype identification is performed on hybrid progeny plants. If the haplotype identified by amplification of the progeny plant is CC (signal corresponding to reverse primer R2), consistent with the low-oil parent, it indicates that the plant carries a low-oil type locus. If the haplotype identified by amplification of the progeny plant is heterozygous haplotype TC, it indicates that the plant carries a heterozygous locus, which can be selected and retained, and haplotype selection can be performed again in self-pollination progeny until homozygous plants are obtained. If the haplotype identified by amplification of the progeny plant is TT (signal corresponding to reverse primer R1), consistent with the high-oil parent, it indicates that the plant carries a high-oil type locus, and whether to retain the plant can be chosen according to breeding needs.
[0018] Furthermore, the present invention also provides the application of KASP molecular markers related to peanut oil content in peanut kernel oil content-related auxiliary breeding, in identifying or assisting in identifying peanut kernel oil content, and in comparing the oil content of peanut kernels.
[0019] Furthermore, the present invention also provides a peanut oil content detection kit, wherein the KASP molecular marker primer sequence of the kit is:
[0020] The universal forward primer F has the following nucleotide sequence as shown in SEQ ID NO.1: 5'-TTGAGCGAATACCCCATCCG-3';
[0021] The reverse primer R1 has the following nucleotide sequence as shown in SEQ ID NO.2: 5'-CGTTGCCCTTTCGAGATAATTGTT-3';
[0022] The reverse primer R2 has the following nucleotide sequence as shown in SEQ ID NO.3: 5'-CGTTGCCCTTTCGAGATAATTGTC-3'.
[0023] The beneficial effects of this invention are:
[0024] This invention identifies SNP loci associated with peanut oil content through genome-wide association analysis (GWAS) and develops and provides the KASP molecular marker. The KASP molecular marker located at the peanut oil content-related locus originates from a cluster of significant SNP loci identified in GWAS, situated in the 3'UTR region of the AhWRI1.3 gene. The CC / TT haplotype of this locus leads to different kernel oil contents. The KASP molecular marker designed based on this locus can be used for marker-assisted selection of peanut kernel oil content, improving breeding efficiency and demonstrating broad application prospects. Attached Figure Description
[0025] Figure 1 The images show Manhattan plots and qq plots of BLUP values for peanut oil content phenotypic trait, obtained through genome-wide association analysis using a mixed linear model.
[0026] Figure 2 This is a schematic diagram illustrating the relationship between different haplotypes and peanut oil content.
[0027] Figure 3 This is a schematic diagram of the KASP marker typing results in 94 peanut cultivars. Detailed Implementation
[0028] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the scope of protection of the present invention.
[0029] Example 1
[0030] The SNP sites and molecular markers associated with peanut oil content were obtained using the following methods:
[0031] (a) Based on 390 core cultivated peanut germplasm resources, 10× whole-genome resequencing was performed, and the sequences were compared with the peanut reference genome "Fuhuasheng". After quality control, 1,048,576 high-quality, high-density SNP loci were obtained. The oil content of peanut kernels was detected by near-infrared spectroscopy, and the oil content of peanut kernels was used as the phenotypic trait of peanut oil content.
[0032] (b) Association analysis was performed between BLUP values of peanut oil content phenotypic phenotypes under multiple environments and SNP loci, and a mixed linear model (MLM) was used to detect the associated SNP loci. A new cluster of SNP loci significantly associated with peanut oil content phenotypic trait was found on chromosome A03, named qOC_A03.1. Figure 1 ).
[0033] (c) Based on the LD decay level (~50kb), qOC_A03.1 was located within a 102kb range on chromosome A03, between A03: 8591523-8693979bp (reference genome: peanut). This region contains 9 genes. Based on variation analysis, haplotype analysis, and genome annotation, AhWRI1.3 was identified as a key candidate gene regulating peanut oil content.
[0034] (d) There is one variant site within the AhWRI1.3 gene, located in the 3'UTR region. Phenotypic data analysis revealed that this site (A03_8641246) is significantly associated with peanut oil content, with the CC genotype showing a significantly lower oil content compared to the TT genotype. Figure 2 ).
[0035] (e) Primers were designed using the 100bp flanking sequences at both ends of the SNP marker sites to develop KASP markers. KASP marker primers for the SNPs were developed by searching the *Peanuts fusiforme* reference genome (NCBI database: https: / / www.ncbi.nlm.nih.gov / ; accession number SDMP00000000). The universal forward primer sequence SEQ ID NO.1 is 5'-TTGAGCGAATACCCCATCCG-3', the reverse primer SEQ ID NO.2 is 5'-CGTTGCCCTTTCGAGATAATTGTT-3', and the reverse primer SEQ ID NO.3 is 5'-CGTTGCCCTTTCGAGATAATTGTC-3' (Table 1).
[0036] (f) Validation of KASP marker accuracy. Ninety-four peanut cultivars that had undergone resequencing were selected as experimental materials. Genomic DNA was extracted from young leaves during the seedling stage. The extracted genomic DNA was amplified by PCR using KASP marker primers. The total PCR reaction volume was 5 μl, consisting of 2.4 μl of genomic DNA, 2.5 μl of 2×KASP MasterMix, and 0.1 μl of KASPassayMix (primer working solution). The KASP primer working solution included a universal forward primer (F), a reverse primer for specific sequences bound by FAM fluorescence (R1), a reverse primer for specific sequences bound by HEX fluorescence (R2), and pure water. PCR reaction procedure: Step 1, 94℃, 15 min; Step 2, 94℃, 20 s, 61-55℃ gradient PCR, 1 min, decreasing 0.6℃ per cycle, for 10 cycles; Step 3, 94℃, 20 s, 55℃, 1 min, for 26 cycles; Step 4, store at 10℃. PCR results were analyzed using a Pherastar KASP fluorescence analyzer (LGC) according to its genotyping guidelines. The results showed that the genotyping of SNP sites in the experimental materials using the KASP markers designed in this invention was completely consistent with the genotyping results obtained from resequencing. Figure 3 This indicates that the KASP marker designed in this invention is accurate and reliable, and can be used for molecular breeding-assisted selection.
[0037] In summary, this embodiment provides a KASP molecular marker method related to peanut oil content. This method utilizes genome-wide association analysis to identify SNP sites significantly associated with peanut kernel oil content and develops the markers using flanking sequences of these SNPs. The KASP molecular marker technology developed in this invention is reliable, economical, and simple, enabling high-throughput genotyping and can be used for marker-assisted selection of peanut kernel oil content.
[0038] Finally, it should be noted that the above-described embodiments are merely specific implementations of the present invention, used to illustrate the technical solutions of the present invention, and not to limit it. The scope of protection of the present invention is not limited thereto. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any person skilled in the art can still modify or easily conceive of changes to the technical solutions described in the foregoing embodiments, or modify some of the technical features within the scope of the technology disclosed in the present invention.
[0039] Equivalent substitution; and these modifications, changes, or substitutions do not alter the nature of the corresponding technical solution.
[0040] Any content that deviates from the spirit and scope of the technical solutions of the embodiments of this invention should be covered by this invention.
[0041] Within the protected area.
Claims
1. A KASP molecular marker associated with peanut oil content, characterized in that, The SNP site is located on peanut chromosome A03, named qOC_A03.1, with a localization interval of 102 kb between A03: 8591523 and 8693979. The SNP site is located at 8641246 bp on chromosome A03, and its polymorphism is T / C. The primer sequences for the molecular marker are as follows: The universal forward primer F has the following nucleotide sequence as shown in SEQ ID NO.1: 5'-TTGAGCGAATACCCCATCCG-3'; The reverse primer R1 has the following nucleotide sequence as shown in SEQ ID NO.2: 5'-CGTTGCCCTTTCGAGATAATTGTT-3'; The reverse primer R2 has the following nucleotide sequence as shown in SEQ ID NO.3: 5'-CGTTGCCCTTTCGAGATAATTGTC-3'.
2. A method of genotyping peanut kernel oil content using the KASP molecular marker associated with peanut oil content of claim 1, characterized in that, The method is as follows: genomic DNA is extracted from peanut leaves, and the extracted genomic DNA is amplified by PCR using the KASP-tagged primer sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3; The total reaction volume for PCR amplification was 5 μl, which included 2.4 μl of genomic DNA, 2.5 μl of 2×KASP Master Mix, and 0.1 μl of primer mixing working solution. The primer mixing working solution includes: universal forward primer F, FAM fluorescently bound specific sequence reverse primer R1, HEX fluorescently bound specific sequence reverse primer R2, and pure water.
3. The method for genotyping peanut kernel oil content according to claim 2, wherein, The PCR reaction procedure is as follows: Step 1, 94℃, 15min; Step 2, 94℃, 20s, 61-55℃ gradient PCR, 1min, decreasing by 0.6℃ for each cycle, for 10 cycles; Step 3, 94℃, 20s, 55℃, 1min, for 26 cycles; Step 4, store at 10℃.
4. A method for genotyping peanut kernel oil content using KASP molecular markers related to peanut oil content, as described in claim 2 or 3, characterized in that... PCR results were analyzed using a Pherastar fluorescence analyzer (KASP).
5. The use of a KASP molecular marker related to peanut oil content according to claim 1 in the haplotype identification of single plants of peanut hybrid offspring, characterized in that, KASP amplification was performed on the peanut DNA to be tested using the primer sets shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3; the haplotype identified by amplification of progeny single plants was CC, indicating that the site carried by the single plant was of the low-oil type; the haplotype identified by amplification of progeny single plants was TT, indicating that the site carried by the single plant was of the high-oil type.
6. The application of the KASP molecular marker related to peanut oil content as described in claim 1 in peanut kernel oil content-related assisted breeding.
7. The application of the KASP molecular marker related to peanut oil content as described in claim 1 in the identification or auxiliary identification of peanut kernel oil content.
8. The application of the KASP molecular marker related to peanut oil content as described in claim 1 in comparing the oil content of peanut kernels.
9. A peanut oil content test kit characterized by, The kit contains the following KASP molecular marker primer sequence: The universal forward primer F has the following nucleotide sequence as shown in SEQ ID NO.1: 5'-TTGAGCGAATACCCCATCCG-3'; The reverse primer R1 has the following nucleotide sequence as shown in SEQ ID NO.2: 5'-CGTTGCCCTTTCGAGATAATTGTT-3'; The reverse primer R2 has the following nucleotide sequence as shown in SEQ ID NO.3: 5'-CGTTGCCCTTTCGAGATAATTGTC-3'.
Citation Information
Patent Citations
Gene AhWRI1 for regulating and controlling oil content of peanut and application of gene AhWRI1
CN116286849A
KASP molecular marker of QTL related to content of arachidonic acid and linoleic acid and application of KASP molecular marker
CN117448475A