Application of CNT2 inhibitor 1 in preparation of medicine for inhibiting progress of atherosclerosis

Abstract

The invention relates to the technical field of biology, in particular to an application of a CNT2 inhibitor 1 in preparation of a medicine for inhibiting atherosclerosis progression, which is characterized in that the combination of FABP5 and STEAP3 is inhibited according to a biomarker FABP5 related to the progression period of atherosclerotic heart disease and a compound CNT2 inhibitor 1 (CNT2 inhibitor 1, the CAS number is 880155-70-4), so that the progression period of the atherosclerotic heart disease is inhibited, and the progression period of the atherosclerotic heart disease is inhibited. Further, the atherosclerosis promoting effect in the plaque progress period caused by FABP5 is relieved.

Description

TECHNICAL FIELD

[0001] The application relates to the field of biotechnology, in particular to application of a CNT2 inhibitor-1 in preparation of a medicine for inhibiting progression of atherosclerosis. BACKGROUND

[0002] Atherosclerotic plaque progression is the core pathological link of transformation from subclinical atherosclerosis to acute cardiovascular events, and the latter includes acute myocardial infarction, unstable angina and other diseases which seriously threaten public health. The number of patients with coronary heart disease in China has reached 11.39 million, and the annual growth rate of incidence is 9.3%. In particular, it is worth noting that although subclinical atherosclerosis patients have no typical symptoms, the all-cause mortality rate is as high as 16% in 12.4 years of follow-up, and the plaque burden is independently related to the mortality rate. Therefore, it is urgent to reduce the transformation of subclinical atherosclerosis patients to coronary heart disease and acute cardiovascular event patients.

[0003] A large number of previous basic researches are mainly focused on explaining the mechanism of atherosclerotic plaque progression from the perspective of atherosclerosis formation, but less attention is paid to the specific role of pro-atherogenic factors in the progression period of atherosclerotic plaques between subclinical atherosclerosis and late atherosclerotic plaques, which restricts the development of more precise clinical intervention strategies for subclinical atherosclerosis patients. SUMMARY

[0004] The application provides application of a compound CNT2 inhibitor-1 (CNT2 inhibitor-1, CAS No.: 880155-70-4) in preparation of a medicine for inhibiting progression of atherosclerosis according to the biomarker FABP5 related to the progression period of atherosclerotic heart disease, and the combination of FABP5 and STEAP3 is inhibited, and then the pro-atherogenic effect of the plaque progression period caused by FABP5 is relieved.

[0005] To achieve the above object, the technical scheme adopted by the application is: (1) According to a plurality of human databases, difference genes affecting atherosclerosis are found out, and the most obvious difference gene FABP5 is screened out by constructing a foam cell model, and it is found that the difference gene FABP5 can predict the long-term adverse prognosis of atherosclerosis patients.

[0006] (2) It is proved by single cell data analysis and animal experiments that FABP5 mainly acts on macrophages in the plaque progression period and can regulate the plaque degree in the atherosclerosis progression period, and the prediction effect and potential intervention value are determined, and there is no biomarker specific to the atherosclerosis progression period at present, and FABP5 can indicate the level of accelerated cardiovascular disease of atherosclerosis patients.

[0007] (3) Through RNA-SEQ technology and cell biology experiments, the potential mechanism of action of FABP5 in the progressive stage of atherosclerosis was discovered. Based on its mechanism of action, the compound CNT2 inhibitor-1 (CAS number: 880155-70-4) was found in the existing protein database in nature. By inhibiting the effects of FABP5 and STEAP3, it can alleviate the progressive stage of atherosclerosis.

[0008] In the present invention, compound CNT2 inhibitor-1 was purchased from MCE Company.

[0009] The beneficial technical effect of the present invention is that, through animal experiments, the present invention demonstrates that CNT2 inhibitor-1 can significantly inhibit the binding of FABP5 and STEAP3, thereby alleviating the pro-atherosclerotic effects of FABP5 during the progression of plaques. By focusing on the unique factors of plaque progression and elucidating their specific mechanisms, the present invention will more accurately apply the brakes on plaque progression in patients with subclinical atherosclerosis, providing a theoretical basis and potential therapeutic targets for reducing the likelihood of acute cardiovascular events, improving long-term patient survival, and developing precise intervention strategies based on coronary artery disease staging. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0011] Figure 1Differential gene sets were identified using multiple human databases. The most significantly differentially expressed gene, FABP5, was then identified using a foam cell model, and its potential characteristics were analyzed. (A) Heatmap of differentially expressed genes between normal and atherosclerotic groups in the GSE43292 database; (B) Venn diagram of differentially expressed genes in GSE43292, GSE100927, and GSE28829, with the common differentially expressed genes being FABP5, MMP12, and MMP9; (C) PCR validation of differentially expressed genes in the foam cell model; (D-F) FABP5 expression patterns in different atherosclerosis stages (Atheroma: atheroma including the core and shoulder (Stary classification stage IV and above); Intact: Atheroma paired with a distant macroscopic intact tissue sample (including stages I and II); Advanced: advanced plaque; Early: early plaque; Calcification: calcified plaque; Non-calcification: non-calcified plaque).

[0012] Figure 2 Comparison of human and mouse databases revealed a correlation between high FABP5 expression and adverse cardiovascular events. (A) Patients with high FABP5 expression in atherosclerotic plaques were more likely to experience ischemic events than those with low FABP5 expression. (B) FABP5 expression patterns in mice at different stages of atherosclerosis (WT: wild type, normal diet; DKO: Ldlr - / - / Apob 100 / 100 , normal diet; DKO_1mo:Ldlr - / - / Apob 100 / 100 , high-fat diet for 1 month; DKO_3mo:Ldlr - / - / Apob 100 / 100 , high-fat diet for 3 months); (C) Expression pattern of FABP5 in different stages of atherosclerosis in mice, comparing WT mice and ApoE - / - The expression levels of FABP5 in mice of different ages were different.

[0013] Figure 3 HE staining showed a significant increase in FABP5 expression during plaque progression. (AB) HE staining of aortic plaques in each group of mice; (C) Changes in FABP5 mRNA expression within plaques.

[0014] Figure 4Single-cell sequencing analysis of mouse plaques revealed that FABP5 expression patterns are primarily associated with plaque progression. Analysis of the single-cell database (GSE155513) revealed that (A) macrophages in atherosclerotic plaques from Ldlr- / - or ApoE- / - mice were clustered into six subpopulations. (BC) Analysis of differentially expressed genes in their respective cell markers revealed high expression of FABP5 in subpopulation 5. (D) The number of macrophages in subpopulation 5 increased significantly during plaque progression. (E) In macrophage subpopulation 5, expression of genes involved in lysosomal, cholesterol metabolism, and ferroptosis inhibition pathways was upregulated, while expression of genes involved in ribosome and cell adhesion molecule pathways was downregulated. (F) Ferroptosis inhibition gene scores were analyzed for macrophages in subpopulation 5.

[0015] Figure 5 In vivo experiments showed that knocking out FABP5 during the progression of atherosclerotic plaques reduced the extent of the plaques. (A) Oil Red O staining of aortas in different groups; (B) HE staining of atherosclerotic plaques in different groups.

[0016] Figure 6 Cell experiments revealed increased ferroptosis in RAW264.7 macrophages in the shFABP5 group. (A-B) Western blot analysis of protein expression of related indicators among different groups (n = 4); (C) RT-PCR analysis of relative mRNA levels of related indicators (n = 4); (D) Malondialdehyde (MDA) assay kit (n = 3); (E) Reduced glutathione (GSH) assay kit (n = 3); (F) Ferrous ion colorimetric assay kit (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001.

[0017] Figure 7 Transcriptome RNA-seq analysis identified downstream molecules involved in FABP5-mediated ferroptosis regulation. STEAP3 may be involved in FABP5-mediated ferroptosis inhibition. (A) GSEA enrichment analysis of differentially expressed genes in transcriptome RNA-seq analysis revealed top 30 pathways; (B) Volcano plot indicates elevated STEAP3 levels in the shFABP5 group; (C) Protein-protein docking prediction results.

[0018] Figure 8 The chemical formula of CNT2 inhibitor-1 and its ability to effectively inhibit the binding of FABP5 to STEAP3, thereby achieving the same level of anti-atherosclerotic effects as knocking out FABP5. (A) Chemical formula of CNT2 inhibitor-1; (B-C) Binding affinity of CNT2 inhibitor-1 and simulated docking; (D) Animal model established, showing that plaque area after application of CNT2 inhibitor-1 was not statistically different from that after knocking out FABP5. DETAILED DESCRIPTION

[0019] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0020] Statistical methods used

[0021] All statistical analyses of the bioinformatics part of this study were performed using R software (V4.2.2). Figures were generated in R Studio using ggplot2 (V3.4.0), Seurat (V4.3.0), and pheatmap (V1.0.12). When necessary, the normal distribution data between the two groups were analyzed using t Non-normally distributed data were compared using the Wilcoxon rank sum test. P Values ​​greater than or equal to 0.05 were considered not statistically significant, and P Values ​​less than 0.05 are as follows:* P <0.05,** P <0.01,*** P <0.001 and **** P <0.0001. In addition, the P The values ​​were adjusted for multiple hypothesis testing based on the false discovery rate (FDR). Experimental data are presented as mean ± standard deviation (mean ± SD). Statistical analysis was performed using GraphPad Prism 8.0 software. Data between the two groups were compared using t One-way ANOVA was used to compare data among multiple groups. All experiments were repeated at least three times. P <0.05 was considered statistically significant. P Values ​​less than 0.05 are as follows:* P <0.05,** P <0.01,*** P <0.001.

[0022] 1. Based on multiple human databases, we identified differential gene sets that affect atherosclerosis, constructed a foam cell model to screen out the most significant differential gene, FABP5, and found that it can predict the long-term adverse prognosis of patients with atherosclerosis.

[0023] (1) The most significant differentially expressed genes were screened based on the foam cell model from multiple human databases. This study retrieved datasets from the NCBI GEO database for analysis. We first compared the differentially expressed genes between healthy individuals and those with atherosclerosis (GSE100927). Visualization was performed using R language, and the genes were integrated to form a heat map ( Figure 1 A). Compared with normal tissues, genes with high expression and significant differences in atherosclerotic tissues are shown as follows ( Figure 1 A). Based on the intersection of differentially expressed genes in different databases (GSE43292, GSE100927, GSE28829), it was found that the only three significantly differentially expressed genes in the intersection of the three databases were MMP9, FABP5, and MMP12 ( Figure 1 B).

[0024] We prepared to validate the relevant gene clusters in the foam cell model. By constructing a RAW264.7 foam cell model to simulate the cell model of atherosclerosis, combined with the above gene screening, we compared the mRNA levels of the corresponding genes between normal cells (Ctrl group) and foam cells (Ctrl+oxLDL group) by RT-PCR. The most significant differences were found in FABP5 and MMP9 by RT-PCR. P <0.001). Among them, the gene with the most significant expression difference was fatty acid-binding protein 5 (FABP5) ( Figure 1 C). We analyzed the expression differences of FABP5 based on different types of database tissue samples (GSE43292, GSE28829, GSE104140). We found that FABP5 expression levels were higher in atherosclerotic plaques (stage IV and above according to Stary classification) in the core and shoulder of the plaque ( Figure 1 D). In addition, during the analysis of early-stage and advanced plaques, we also found that FABP5 was highly expressed in advanced plaques ( Figure 1 E). We further compared calcified plaques with non-calcified plaques and found that FABP5 was significantly overexpressed in calcified plaques ( Figure 1 F).

[0025] (2) There is a high correlation between high expression of FABP5 in plaques and ischemic adverse events. We also focused on the differences in long-term prognosis of patients with different expression levels of FABP5 in atherosclerotic plaques. We grouped the patients according to the median FABP5 content in carotid atherosclerotic plaques in the BiKE cohort database (GSE21545). Through survival analysis, we found that patients with high expression of FABP5 in plaques were more likely to have ischemic adverse events ( P=0.037)( Figure 2 A). This means that plaques with high FABP5 expression are more vulnerable, which has a significant impact on the patient's potential adverse ischemic events. This also means that FABP5 may play an important role in the long-term adverse cardiovascular prognosis of patients with atherosclerosis.

[0026] We also looked at the mouse-derived atherosclerosis database (GSE205929, GSE40156), and found that FABP5 was also highly expressed in atherosclerotic plaque tissue. At the same age, double-knockout mice were fed a normal diet, a high-fat diet for 1 month, and a high-fat diet for 3 months. We found that FABP5 expression increased significantly with the duration of the high-fat diet ( Figure 2 B). Moreover, in wild-type mice and ApoE - / - We found ApoE in the plaques of mice that were on a normal diet at different time periods. - / - FABP5 is significantly overexpressed in mice ( Figure 2 C), which means that its effects in mouse models and cells are equivalent to those in humans. Interestingly, we found that the increase in FABP5 expression levels in the plaque development stage was significantly higher than that in the late stage of plaque development, as of 32 weeks.

[0027] 2. Single-cell data analysis and animal experiments have demonstrated that FABP5 primarily acts on macrophages in the progression phase of plaques and can regulate the extent of plaques in the progression phase of atherosclerosis, clarifying its predictive role and potential intervention value. Currently, there are no specific biomarkers for the progression phase of atherosclerosis. FABP5 can indicate the degree of acceleration of cardiovascular disease in patients with atherosclerosis.

[0028] (1) HE staining showed that FABP5 expression increased significantly during the progression of plaques To investigate the correlation between FABP5 and atherosclerotic plaques at different stages, we performed HE staining on paraffin sections of the aorta of three groups of mice. HE staining showed that as the duration of high-fat diet increased, the plaques gradually worsened ( Figure 3 AB). We took plaques and performed RT-PCR to detect FABP5 mRNA. We found that the content of FABP5 increased during the progression of plaques ( Figure 3 C).

[0029] (2) Single-cell sequencing analysis of mouse plaques showed that FABP5 mainly acts on the progression of plaques We analyzed the mouse atherosclerotic plaque single-cell database (GSE155513) and found that Ldlr - / - or ApoE - / - In mouse atherosclerotic plaques, macrophages are clustered into six subpopulations ( Figure 4 A). By analyzing the cell markers of differentially expressed genes, we found that FABP5 was significantly overexpressed in the 5th subpopulation ( Figure 4 B). Horizontal comparison between different subgroups also shows significant differences in FABP5 expression. Figure 4 In C, it can be clearly seen that FABP5 is highly expressed in the fifth subpopulation. It was found that as the plaque progressed, the number of macrophages in the fifth subpopulation increased significantly ( Figure 4 D). This potentially suggests that the fifth macrophage subpopulation with high FABP5 expression appears and functions primarily during the plaque progression stage.

[0030] Further analysis of the mouse atherosclerotic plaque single-cell database revealed that in the fifth subpopulation of macrophages with high FABP5 expression, the expression of genes involved in pathways such as lysosomes, cholesterol metabolism, and ferroptosis inhibition was upregulated, while the expression of genes involved in pathways such as ribosomes and cell adhesion molecules was downregulated ( Figure 4 E). In addition, group 5 macrophages have the highest ferroptosis inhibitory gene score ( Figure 4 F). Single-cell database analysis suggests that high expression of FABP5 may be potentially associated with the inhibition of the ferroptosis pathway in the progressive stage of atherosclerosis.

[0031] (3) Animal experiments found that knockout of FABP5 in specific macrophages reduced the severity of atherosclerosis To investigate the effect of FABP5 on advanced atherosclerotic plaques, we performed Oil Red O staining of mouse aorta. The results showed that under HFD diet, ApoE - / - The mice had less plaque formation, but there was no statistical difference. - / - Plaque formation in mice was significantly reduced ( P< 0.05) ( Figure 5 A). The above results demonstrate that silencing FABP5 alleviates the progression of atherosclerotic plaques during the progression phase. Interestingly, compared to the HFD group, the progression of aortic plaques in mice fed HID was significantly milder, suggesting that ferroptosis alleviates the progression of atherosclerotic plaques during the progression phase. HE staining showed that compared to the AAV-shCtrl+HFD group, the area of ​​necrotic core in the AAV-shFABP5+HFD group was reduced ( P <0.05); compared with the AAV-shCtrl+HID group, the area of ​​necrotic core in the AAV-shFABP5+HID group was reduced, and the difference was greater ( P <0.001). The necrotic core area of ​​the plaques in the HFD group was significantly higher than that in the HID group ( Figure 5 B).

[0032] 3. Through RNA-SEQ technology and cell biology experiments, we discovered the potential mechanism of action of FABP5 in the progressive stage of atherosclerosis. Based on this mechanism of action, we found that CNT2 inhibitor-1, found in existing natural protein databases, can inhibit the interaction between FABP5 and STEAP3, thereby achieving the effect of alleviating progressive atherosclerosis.

[0033] (1) Cell experiments found that FABP5 can affect the level of macrophage ferroptosis To verify whether FABP5 affects plaque progression by affecting the level of ferroptosis in macrophages, shFABP5-RAW264.7 macrophages were constructed based on the RAW264.7 macrophage cell line and detected by Western Blot and RT-PCR. Western Blot results showed that compared with the Ctrl+Fe group, the shFABP5+Fe group showed a significant decrease in GPX4 protein expression ( Figure 6 AB). RT-PCR analysis showed that the relative level of GPX4 mRNA in the shFABP5+Fe group also decreased significantly ( Figure 6 C). The above results confirmed that FABP5 silencing can reduce GPX4 expression at both protein and mRNA levels. In the cell model, to further clarify the relationship between FABP5 and ferroptosis, we detected the levels of MDA, GSH, and ferrous ions in each group of cells and found that MDA content increased significantly after FABP5 silencing ( P <0.0001)( Figure 6 D), GSH content decreased significantly ( P <0.0001)( Figure 6 E). Increased intracellular ferrous ion content ( Figure 6 F). The above results indicate that silencing of FABP5 can promote ferroptosis in macrophages.

[0034] (2) Searching for downstream molecules that regulate ferroptosis through transcriptome RNA-seq To clarify the mechanism by which FABP5 inhibits ferroptosis, transcriptome RNA-seq was used to compare the differentially expressed genes between the Ctrl group and the shFABP5 group. GSEA pathway enrichment analysis ( Figure 7 A) found significant differences in the iron transport pathway (Fe-TF transport) in ferroptosis (https: / / www.genome.jp / pathway / map04216+K10142). This result suggests that FABP5 may regulate ferroptosis by regulating iron transport.

[0035] We further compared the expression differences of all Fe-TF transport-related genes between the two groups. We found that 6-transmembrane epithelial antigen of the prostate 3 (STEAP3) was a key gene ( Figure 7 B). This suggests that FABP5 may regulate STEAP3. Iron reductase STEAP3 can make intracellular free Fe 3+ Reduction to Fe 2+ , while intracellular Fe 2+ It promotes lipid peroxidation and thus promotes ferroptosis. The above results prove that FABP5 inhibits ferroptosis by affecting the iron ion transport pathway. Among them, STEAP3 may be a potential downstream protein of FABP5. In order to clarify whether there is a protein-protein interaction between FABP5 and STEAP3, we used ZDOCK in Discovery Studio to perform protein docking calculations. We found that there can be obvious protein-protein docking between FABP5 and STEAP3 ( Figure 7 C). Based on the above results, we have reason to believe that FABP5 downregulates STEAP3, thereby increasing the intracellular Fe 2+ Reduce, and finally achieve the effect of inhibiting ferroptosis.

[0036] (3) CNT2 inhibitor-1 will inhibit the binding of FABP5 to STEAP3 and thus affect the progression of atherosclerotic plaques We simulated the docking of FABP5 and STEAP3 proteins to screen small molecule compounds that affect their docking. We used the high-throughput screening (HTVS) mode in the Glide module to screen the small molecule compounds prepared in the database (HY-L001P Bioactive Compound Library). The top 30% of the small molecule compounds were selected for a second round of screening using the standard (SP) mode. The top 30% of the small molecule compounds were then selected for a third round of screening using the high-precision (XP) mode to obtain a ranking of the small molecule compounds. The top-ranked compound was CNT2 inhibitor-1 (HY-112843, docking score: -7.644, derived from the top-ranked compound in the HY-L001P Bioactive Compound Library Plus) ( Figure 8 AC).

[0037] To explore its effect on atherosclerotic plaques, we constructed a CNT2 inhibitor-1 group and a FABP5 knockout group. We performed HE staining on paraffin sections. HE staining showed that there was no statistically significant difference in atherosclerotic plaques between the two groups ( Figure 8 D). We conclude that CNT2 inhibitor-1 can effectively inhibit the effect of FABP5 on the progression of atherosclerotic plaques, and demonstrate that during the progression of plaques, FABP5 mainly regulates STEAP3 to affect iron metabolism in macrophages, thereby inhibiting macrophage ferroptosis and aggravating macrophage accumulation.

[0038] Example 1 Analysis and use of public databases This study retrieved the GSE100927, GSE43292, GSE40156, GSE28829, GSE21545, GSE205929, and GSE104140 datasets from the NCBI GEO database for analysis. GSE100927, GSE43292, GSE40156, GSE28829, and GSE21545 are microarray data sets, while GSE205929 and GSE104140 are high-throughput RNA-seq data sets. The GSE100927 dataset contains samples from 104 individuals, 69 of which are atherosclerotic plaque tissues, including 29 carotid artery plaques, 26 femoral artery plaques, and 14 popliteal artery plaques. The remaining 35 samples in the dataset are normal control vascular tissues from the corresponding locations. The GSE43292 dataset consists of 64 paired samples from 32 patients with carotid atherosclerosis. Each patient provided one atheroma containing the core and shoulder (Stary stage IV or higher) and one distant macroscopic intact tissue sample (stages I and II). The GSE28829 dataset contains 29 samples of human carotid atherosclerotic plaque tissue, which can be further categorized into early-stage (pathological intimal thickening and intimal xanthomas) and late-stage (thin or thick fibrous cap atheromas). The GSE104140 dataset includes carotid atherosclerotic plaque tissue from humans with early-stage disease (diffuse intimal thickening) and two late-stage disease states (calcified and non-calcified fibroatheromas). In this study, only samples of early-stage disease and late-stage calcified fibroatheromas were analyzed.

[0039] Example 2 Analysis of long-term prognosis of patients The GSE21545 dataset contains 223 samples from the BiKE cohort, and only 125 carotid atherosclerotic plaque tissues were selected for data analysis in this study. The GSE205929 dataset includes samples from wild-type and atherogenic (Ldlr - / - / Apob 100 / 100 The GSE40156 dataset contains 65 different tissue samples from wild-type and ApoE mice on a C57BL / 6J genetic background. - / - Aorta, spleen, blood, and renal lymph nodes of mice at different ages (6, 32, and 78 weeks). In this study, only atherosclerotic plaque tissue from the aorta was selected for data analysis.

[0040] Example 3 Animal Experiment Beijing Weishanglide Biotechnology Co., Ltd. purchased 30 6-week-old male ApoE - / - Mice (18–20 g) were raised at the Animal Experimental Center of the First Affiliated Hospital of Harbin Medical University. High-fat diet (HFD) feed was purchased from Nanjing Qingzilan Technology Co., Ltd.

[0041] Based on the duration of high-fat diet, the subjects were divided into an early atherosclerosis group (8 weeks of high-fat diet, n = 10), an advanced atherosclerotic plaque group (14 weeks of high-fat diet, n = 10), and a late atherosclerosis group (20 weeks of high-fat diet, n = 10). Tissue HE staining and plaque PCR were performed. PCR primers are shown in Table 1.

[0042] Table 1 Plaque tissue PCR primer sequences Primer name Forward Reverse FABP5 ATGGCCAAGCCAGACTGTAT TCTTCACTGTGCTCTCGGTT Example 4 Single-cell sequencing data analysis A scRNA-seq dataset of atherosclerotic plaques was downloaded from the NCBI GEO database. The raw gene expression matrix was converted to a Seurat object using the Seurat R package (v4.3.0). Violin plots were used to visually assess cell quality metrics (number of genes counted per cell, UMI counts, and proportion of mitochondrial genes), and appropriate thresholds were used to exclude low-quality cells. Doublets were then identified using DoubletFinder (v2.0.3) and removed from the remaining cells. After quality control, standard Seurat analysis was performed using the "vars.to.regress" function to regress cell cycle expression, and batch effect correction was performed using the harmon method. Principal component analysis (PCA) was then performed using highly variable genes, and appropriate principal components were selected for dimensionality reduction. The "RunTSNE" function was used to visualize the two-dimensional t-distributed stochastic neighbor embedding (t-SNE) model. Data clustering was performed using a graph-based clustering method implemented in the "FindNeighbor" and "FindClusters" functions of the Seurat package. Known cell lineages were assigned to the main cell clusters projected from the t-SNE model based on classical marker genes. Cell clusters were then manually annotated to major cell types based on these established markers. Any cell cluster with multiple marker genes for two different cell types was considered a bicellular cell and excluded from downstream analysis. When subclustering the macrophage population, an appropriate threshold was selected and the same steps of quality control, batch effect removal, data dimensionality reduction, and cluster analysis were repeated. Any cell clusters detected with an abnormal number of genes or UMI counts were removed from downstream analysis.

[0043] Example 5 Animal Model Construction ApoE was given to 6-week-old males - / - After two weeks of normal diet, 20 mice were randomly selected and injected with adeno-associated virus (AAV9-F4 / 80-shFABP5, Hanbio) via the tail vein. Another 20 mice were injected with empty adeno-associated virus (AAV9-F4 / 80-shCtrl, Hanbio). Ten mice in each group were fed a high-fat diet (HFD) and ten mice were fed a high-fat, high-iron diet (HID). At week 20, the mice were sacrificed to obtain aortic tissue and arterial blood.

[0044] Example 6 Ferroptosis-related Detection Ferrous ion detection: Cells were treated using the ferrous ion colorimetric test kit (Elabscience, E-BC-K773-M). The supernatant after cell lysis was obtained for later use. The assay was then performed according to the instructions. Three replicate wells were set up for each treatment group. The absorbance of each well was measured at 593 nm using a microplate reader. Statistical analysis was performed in triplicate.

[0045] MDA assay: Pretreated RAW264.7 cells were trypsinized and collected into a centrifuge tube. After centrifugation, the cell pellet was resuspended in an appropriate amount of extraction solution and disrupted by ultrasound (200W, 3 seconds with 10-second intervals). The cells were centrifuged at 8000g for 10 minutes at 4°C, and the supernatant was retained for analysis. The MDA content assay kit (Solarbio BC0025) was used according to the manufacturer's instructions. The absorbance of each sample was measured at 532 nm and 600 nm, and the MDA content was calculated.

[0046] GSH assay: Preliminary cell treatment was performed using the same MDA assay method. After collecting the supernatant, the GSH assay kit was used according to the instructions. The absorbance of each group was measured at 412 nm to calculate the GSH content. PCR and Western blot assays for ferroptosis marker proteins were also performed. PCR primers are listed in Table 2.

[0047] Table 2 PCR primers for ferroptosis marker proteins Primer name Forward Reverse FABP5 ATGGCCAAGCCAGACTGTAT TCTTCACTGTGCTCTCGGTT GPX4 CGCCAAAGTCCTAGGAAACG AACTCGGAGCTGTTGCAGTA Example 7 Exploration of the FABP5 Mechanism Transcriptome RNA-seq: Three samples of Ctrl-RAW264.7 macrophages and three samples of shFABP5-RAW264.7 macrophages from the same batch were collected and commissioned to a third-party company, Qiantang Biotechnology (Suzhou) Co., Ltd., to perform transcriptome RNA-seq testing.

[0048] Simulated protein-protein docking prediction: In Discovery Studio, protein docking calculations were performed using ZDOCK. ZDOCK is a rigid protein docking algorithm based on fast Fourier transform correlation technology (http: / / zdock.umassmed.edu / ). It uses fast Fourier transform correlation technology to search the translational and rotational space of protein-protein systems. RDOCK, an energy optimization program based on CHARMm, optimizes the binding configurations of protein-protein complexes discovered by ZDOCK and scores them using an energy scoring function. Based on the scores, the most appropriate pose was selected. Visualization was performed using Pymol software.

[0049] Example 8 Screening of Compound CNT2 Inhibitor-1 Based on the protein structures obtained from previous FABP5 and STEAP3 protein-protein docking results, 2D formats of the HY-L001P Bioactive Compound Library Plus (containing 25.3K compounds) and the HY-L901PLead-like Diverse Library Plus (containing 80.0K compounds) were processed using the Schrödinger software LigPrep Module for hydrogenation, energy optimization, and other processing, exporting them to 3D structures for virtual screening. This yielded the top-ranked small molecule with the highest binding energy: CNT2 inhibitor-1. Animal experiments demonstrated that it significantly inhibited the binding of FABP5 to STEAP3, thereby mitigating the atherogenic effects of FABP5 during the progression of plaques.

[0050] Finally, it should be noted that the above embodiments are only used to illustrate rather than limit the technical solutions of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that the present invention can still be modified or replaced by equivalents. Any modification or partial replacement that does not depart from the spirit and scope of the present invention should be included in the scope of the claims of the present invention.

Claims

1. Application of CNT2 inhibitor-1 in the preparation of drugs for inhibiting the progression of atherosclerosis.

Images