Self-assembled ferritin nanoparticles and their application in the preparation of duck hepatitis A vaccine

Abstract

This invention discloses self-assembled ferritin nanoparticles and their application in the preparation of duck hepatitis A vaccine. The invention connects the VP1 portion of the duck hepatitis A virus P1 protein to the N-terminus of a self-assembled ferritin nanoparticle subunit via a linker sequence to obtain a fusion protein, the amino acid sequence of which is shown in SEQ ID NO.1. To improve the expression level or efficiency of the fusion protein in silkworms, the nucleotide sequence of the encoding gene of the fusion protein is optimized and modified according to the codon preference of silkworms, resulting in the optimized gene sequence shown in SEQ ID NO.2. The invention also involves single-site or multi-site mutations of the fusion protein, screening for mutants with significantly improved titers and significantly increased soluble expression levels. This invention utilizes a silkworm or insect cell eukaryotic expression system to express the recombinant protein, and the expression product induces neutralizing anti-duck hepatitis A virus antibodies.

Description

Technical Field

[0001] This invention relates to self-assembled ferritin nanoantigen particles, and more particularly to nanoantigen particles containing a fusion protein consisting of duck hepatitis A virus VP1 protein and monomeric ferritin subunits, as well as duck hepatitis A vaccines prepared from the nanoparticle antigens, belonging to the field of preparation and application of duck hepatitis A vaccines. Background Technology

[0002] Duck viral hepatitis (DVH) is an acute, highly lethal infectious disease caused by duck hepatitis A virus (DHAV), primarily affecting ducklings within the feeding week. Infected ducklings exhibit the following main symptoms: lethargy, generalized convulsions, ataxia, and opisthotonus (head arching backward). DHAV belongs to the family Picornaviridae, genus Hepatoviridae, and is an RNA virus. It is classified into DHAV-1 (classical genotype A), DHAV-2 (genotype B, found only in Taiwan), and DHAV-3 (genotype C, initially discovered in South Korea). Currently, genotypes 1 and 3 are the main circulating strains in China.

[0003] Current virus-like particle vaccines against DHAV primarily utilize two proteins, VP1 and VP0, within the P1 protein, with VP1 being the dominant protein. VP1, as the main protective protein against DHAV, encodes the primary antigenic site and possesses key specific neutralizing sites. Furthermore, comparisons of the VP1 proteins in DHAV-1 and DHAV-3 strains reveal significant differences, including insertions, deletions, point mutations, and continuous variations. Some researchers are exploring new approaches to developing subgenome vaccines by detecting VP3 protein expression or the hydrolysis of the 3C protein.

[0004] Natural ferritin consists of a core and a protein coat. Ferritin found in bacteria, plants, and animals is composed of 24 subunits, with each trimeric subunit forming a trimer. Eight trimers can form a spherical cage-like structure with an outer diameter of 12 nm and an inner diameter of 8 nm. Ferritin is also very stable, tolerating high temperatures and various denaturing agents without affecting its natural protein structure. Ferritin's ability to be modified through chemical methods and gene fusion makes it an ideal multifunctional nanocarrier. Its highly ordered, repetitive antigens, when distributed at 5-10 nm intervals on the surface of microorganisms, readily induce strong T-cell-dependent antibody responses. Developing a duck hepatitis A vaccine using ferritin nanoparticles self-assembled from 24 subunits will have significant application value for the prevention and treatment of duck viral hepatitis. Summary of the Invention

[0005] One objective of this invention is to provide a fusion protein comprising the VP1 protein of duck hepatitis A virus P1 protein;

[0006] A second objective of this invention is to provide a single-site mutant or a multi-site mutant of the fusion protein;

[0007] A third objective of this invention is to provide a method for preparing the fusion protein or its single-site mutant or multi-site mutant;

[0008] The fourth objective of this invention is to apply the fusion protein or its single-site mutant or multi-site mutant to the preparation of a duck hepatitis A vaccine.

[0009] To achieve the above objectives, the technical solution adopted by the present invention includes:

[0010] One aspect of the present invention is to provide a fusion protein, which is obtained by linking the C-terminus of the VP1 protein of duck hepatitis A virus P1 protein and the N-terminus of the monomeric ferritin subunit through the linker sequence SGG.

[0011] The VP1 protein of the duck hepatitis A virus P1 protein was selected from the duck hepatitis A virus P1 protein with amino acid sequence number ACI02689.1 in the GenBank database. The monomeric ferritin subunit is a duck ferritin monomer, and its amino acid sequence is the amino acid sequence shown in the GenBank database with sequence number P80145.

[0012] In a preferred embodiment of the present invention, the amino acid sequence of the fusion protein is shown in SEQ ID NO. 1. To improve the expression level or efficiency of the fusion protein in silkworms, the present invention optimizes and modifies the nucleotide sequence of the gene encoding the fusion protein according to the codon preference of silkworms. Optimization is performed on various related parameters affecting gene transcription efficiency, translation efficiency, and protein folding, including GC content, CpG dinucleotide content, codon preference, mRNA secondary structure, mRNA free energy stability, RNA instability gene sequences, and repetitive sequences, while maintaining the final translated protein sequence unchanged. The resulting optimized gene sequence is shown in SEQ ID NO. 2. The optimized sequence is expressed in a silkworm expression system. ELISA titer results of the gene expression product show that the protein expression level of the optimized gene is significantly improved compared to the unoptimized version.

[0013] Another aspect of the present invention is to provide a single point mutant or a multi-site mutant of the fusion protein.

[0014] To improve the potency of fusion proteins, this invention creates single-site mutants or multi-site mutants of the fusion proteins, and screens these mutants to obtain single-site mutants or multi-site mutants with significantly improved potency.

[0015] This invention obtained multiple point mutants of the fusion protein with the amino acid sequence shown in SEQ ID NO.1 by single-point mutation of amino acids P12Q, L42V, S66H, T87G, M110A, L133Y, F164L, K189C, or D203N. These point mutants were expressed in a silkworm expression system. The expression results showed that the expression products of the four point mutants obtained by single-point mutation of amino acids L42V, M110A, L133Y, or D203N in the amino acid sequence shown in SEQ ID NO.1 exhibited significantly increased titers. Among them, the mutant obtained by single-point mutation of amino acid L133Y in the amino acid sequence shown in SEQ ID NO.1 showed the most significant increase in titer. Based on point mutation, this invention further... Four multi-site mutants were obtained from the amino acid sequence shown in SEQ ID NO.1 by multi-site mutation methods: L42V-M110A-L133Y, L42V-M110A-D203N, L42V-L133Y-D203N, or M110A-L133Y-D203N. These multi-site mutants were expressed in the silkworm expression system. According to the expression results, the mutant obtained by multi-site mutation of the amino acid sequence shown in SEQ ID NO.1 by M110A-L133Y-D203N showed the most significant increase in titer.

[0016] The amino acid point mutant “P12Q” described in this invention represents the mutation of the 12th amino acid in the amino acid sequence shown in SEQ ID NO.1 from P (proline) to Q (glutamine); the descriptions of the remaining point mutations follow the same pattern.

[0017] The amino acid multisite mutation “L42V-M110A-L133Y” described in this invention means simultaneously mutating the 42nd amino acid of the amino acid shown in SEQ ID NO.1 from L (leucine) to V (valine), the 110th amino acid from M (methionine) to A (alanine), and the 133rd amino acid from L (leucine) to Y (tyrosine); the descriptions of other multisite mutants follow the same pattern.

[0018] Another aspect of the present invention is to provide a method for preparing the fusion protein or a single point mutant or multi-site mutant thereof.

[0019] Those skilled in the art can use conventional eukaryotic expression methods to express the coding gene of the fusion protein or its mutant in eukaryotic cells using a eukaryotic expression system to obtain the recombinant protein. These are all conventional techniques in the field.

[0020] In a preferred embodiment of the present invention, the present invention provides a method for preparing the fusion protein or its mutant, the method comprising: expressing the coding gene of the fusion protein or its mutant in a silkworm expression system, collecting and purifying the expressed antigen; preferably, constructing a silkworm baculovirus expression vector from the coding gene of the fusion protein, or its single-point mutant or multi-site mutant or mutant gene, and infecting silkworm cells to obtain recombinant silkworm baculovirus; amplifying the recombinant silkworm baculovirus in silkworm cells and expressing it in silkworms or silkworm pupae.

[0021] Alternatively, the encoding gene of the fusion protein or its mutant can be expressed in an insect cell eukaryotic expression system, and the expressed antigen can be collected and purified; preferably, the encoding gene of the fusion protein or its mutant can be cloned into a baculovirus recombinant vector to construct a recombinant baculovirus recombinant vector; the baculovirus recombinant vector and baculovirus DNA can be co-transfected into insect cells to obtain recombinant baculovirus; the recombinant baculovirus can be used to infect insect hosts or insect cells, and the infected insect cells or insect hosts can be cultured to express the corresponding antigen, and then purified to obtain the final product.

[0022] In this invention, the expression product of the mutant gene encoding the fusion protein in the silkworm expression system was initially purified and observed by electron microscopy. The observation results showed that the product was nanoparticles with a size consistent with expectations, and the diameter of the cage-like structure was about 12 nanometers.

[0023] Animal experiments and virus neutralization experiments have demonstrated that immunization of mice with the fusion protein prepared in this invention and its single-point mutant or multi-site mutant resulted in high neutralizing anti-duck hepatitis A virus antibody titers, showing significant preventive and therapeutic effects against duck hepatitis A virus.

[0024] Another aspect of the present invention is to apply the fusion protein, a single point mutant or a multi-site mutant of the fusion protein to the preparation of a duck hepatitis A vaccine, comprising: mixing an effective amount of the fusion protein, or a single point mutant or a multi-site mutant of the fusion protein, with a medically acceptable immune adjuvant or carrier to obtain a duck hepatitis A vaccine.

[0025] Therefore, the present invention provides a duck hepatitis A vaccine, the duck hepatitis A vaccine comprising an antigen and a medically acceptable immune adjuvant or carrier; wherein the antigen is the fusion protein shown in SEQ ID NO.1; or the antigen is a single point mutant or a multi-site mutant of the fusion protein shown in SEQ ID NO.1.

[0026] Compared with the prior art, the present invention has the following advantages and effects:

[0027] 1. This invention utilizes silkworm baculovirus and insect cell eukaryotic expression system to express recombinant protein vaccines. The vaccine preparation process does not involve live harmful viruses, making it safer and simpler to operate compared to traditional attenuated live vaccine methods, and suitable for rapid large-scale production.

[0028] 2. The duck hepatitis A vaccine prepared from nanoparticle antigens provided by this invention can induce duck hepatitis A virus antibodies with broad-spectrum properties, laying the foundation for the preparation of a duck hepatitis A vaccine.

[0029] Definitions of terms involved in this invention

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0031] The terms “antigen” and “immunogen” are used interchangeably and refer to molecules, substances, proteins, glycoproteins, or live viruses that can induce specific humoral (antibody) and cellular immune responses.

[0032] The term "antigenicity" refers to the ability of an antibody to react with or bind to a specific antigen; the term "immunogenicity" refers to the ability of an antigen or vaccine to induce a specific immune response; the term "immune response" refers to a humoral or antibody-mediated and cell-mediated immune response against an antigen, vaccine, or infectious agent; the term "vaccine" refers to a composition comprising an antigen used for therapeutic treatment or prophylactic immunization against an infectious or non-infectious disease; the term "immunity" refers to an immune response generated by vaccination or infection that provides protection against infectious or foreign agents; the term "recombinant protein or antigen" refers to a protein or antigen produced using recombinant DNA technology, which can be used to clone and express genes in a variety of hosts, including bacteria, mammalian cells, insect cells, and plants, to produce proteins.

[0033] The term "potency" refers to the amount of antigen in an antigen preparation or vaccine as measured by a specified potency assay.

[0034] The terms “mutation” and “mutant” have their common meanings here, referring to genetic, naturally occurring or introduced changes in a nucleic acid or polypeptide sequence, and their meanings are the same as those commonly known to those skilled in the art.

[0035] The terms "host cell" or "recombinant host cell" refer to a cell containing the polynucleotides of the present invention, regardless of the method used for insertion to produce a recombinant host cell, such as direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotides may remain as, for example, non-integrating vectors of plasmids or may be integrated into the host genome.

[0036] The term "transfection" refers to the process by which eukaryotic cells acquire new genetic markers due to the incorporation of foreign DNA. Attached Figure Description

[0037] Figure 1 This is a Western blotting image of the DHAV VP1-FE expression product in the silkworm expression system; lane 1 is the marker, lane 2 is the DHAV VP1-FE expression product in the silkworm expression system, and lane 3 is the negative control.

[0038] Figure 2 Electron micrograph of the product expressed by DHAV VP1-FE-XYZ in the silkworm expression system. Detailed Implementation

[0039] The present invention will be further described below with reference to specific experimental examples, and the advantages and features of the present invention will become clearer with the description. However, these experimental examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0040] 1. Experimental Materials and Reagents

[0041] 1.1 Vectors, Viral Strains, Cells, and Laboratory Animals

[0042] Recombinant vector pBR, E. coli The TOP10 strain, BmN cells, and Vero cells were all preserved and provided by the Institute of Biotechnology, Chinese Academy of Agricultural Sciences; the experimental silkworm variety JY1 was provided by the Sericulture Research Institute of Jiangsu University of Science and Technology, and the parent virus BmBac DNA was constructed according to the method disclosed in the literature (CN 102286534 A).

[0043] Animal experiments on a nanovaccine constructed by fusing duck hepatitis A virus with ferritin were conducted in an isolation laboratory.

[0044] 1.2 Preparation of solutions and culture media

[0045] For instructions on preparing solutions and culture media, please refer to relevant reference books (Joseph et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, 2002; Osber et al., A Concise Guide to Molecular Biology, 1998).

[0046] Experimental Example 1: Preparation and Detection of Nanoparticle Antigens After Amino Acid Point Mutation Using DHAV VP1-FE

[0047] 1. Synthesis of the DHAV VP1 gene sequence

[0048] The original fusion protein sequence was obtained by linking the C-terminus of the VP1 protein to the N-terminus of ferritin (after removing the first 18 amino acids) using a linker, and then further processed using OptimumGene. TM The technology optimizes the amino acid sequence of the fusion protein (as shown in SEQ ID NO.1), and modifies the nucleotide sequence according to the codon preference of the silkworm. It optimizes various related parameters that affect gene transcription efficiency, translation efficiency and protein folding, such as GC content, CpG dinucleotide content, codon preference, mRNA secondary structure, mRNA free energy stability, RNA instability gene sequence, and repetitive sequences, while keeping the final translated protein sequence unchanged.

[0049] To improve the translation initiation and termination efficiency of the target gene, the Kozak sequence ATCAAC is added before the gene, and the stop codon is changed to TAA. Restriction enzyme sites within the gene sequence that affect the operation are removed, and a Kozak sequence is added upstream of the gene. Bam HI, add downstream of the gene Eco The RI restriction enzyme site was selected for subsequent cloning into the eukaryotic recombinant vector pBR. The optimized nucleotide sequence is shown in SEQ ID NO.2. This optimized gene sequence was synthesized and inserted into the pUC57 vector to form the plasmid pUC57-VP1-FE.

[0050] 2. Expression of DHAV VP1-up in a prokaryotic expression system and preparation of polyclonal antibodies

[0051] To qualitatively and quantitatively verify the antigen samples expressed by the eukaryotic expression system, polyclonal antibodies were prepared using the prokaryotic expression system. A segment of VP1 containing the antigen epitope was selected for synthesis and named VP1-up. Its amino acid sequence is shown in SEQ ID NO.3 and its nucleotide sequence is shown in SEQ ID NO.4. The synthesized gene was cloned into the expression vector pET28a.

[0052] Following the standard procedure for expressing the target protein in Escherichia coli prokaryotes, His-VP1-up protein was expressed and purified. After BCA assay, the expression level was 579 μg / mL. Polyclonal antibodies were obtained after immunizing mice and used for subsequent qualitative and quantitative protein assays.

[0053] Construction of the VP1-FE single point mutant gene

[0054] Using VP1-FE as a template, multiple primer pairs were designed to perform site-directed mutagenesis using fusion PCR. The fusion PCR method was performed according to the method described by Kuang Feiting et al. (A Novel Method for Vector Construction: Recombinant Fusion PCR, Genomics and Applied Biology, 2012, Vol. 31, No. 6, pp. 634-639). This invention has conducted a large number of mutation experiments. In this experiment, only the mutation sites with obvious mutation effects are described in detail, and the same applies below. The mutation sites for the unit point mutations were: P12Q, L42V, S66H, T87G, M110A, L133Y, F164L, K189C, and D203N. The resulting mutants were named VP1-FE-P12Q, VP1-FE-L42V, VP1-FE-S66H, VP1-FE-T87G, VP1-FE-M110A, VP1-FE-L133Y, VP1-FE-F164L, VP1-FE-K189C, and VP1-FE-D203N, respectively.

[0055] Primers required for VP1-FE amino acid point mutation:

[0056] (1) Upstream and downstream primers on both sides:

[0057] F: GCGGATCCATCAACATGGGTGAG (SEQ ID NO.5);

[0058] R: CGGAATTCTTAGGACTCGCTGCT (SEQ ID NO.6);

[0059] (2) Upstream and downstream primers (only primers with significant mutation effects are listed):

[0060] 1.F: GGCGACGATGAACAGGTGTGC (SEQ ID NO.7);

[0061] 1.R:TTCAGGAAGCACACCTGTTCATCGT (SEQ ID NO.8);

[0062] 2.F: CCGTCAATGGGTCGTGCGTAC (SEQ ID NO.9);

[0063] 2.R: GTACGCACGACCCATTGACGG (SEQ ID NO.10);

[0064] 3.F: ATCAAGGCCACGCGCACC (SEQ ID NO.11);

[0065] 3.R: AAACGCAGCAGGTGCGC (SEQ ID NO. 12);

[0066] 4.F: AACAACGGCGGCACCCC (SEQ ID NO.13);

[0067] 4.R: CGGGGTGCCGCCGTT (SEQ ID NO.14);

[0068] 5.F: TGACCGCTGCGGGTGGCATTCT (SEQ ID NO.15);

[0069] 5.R: AGAATGCCACCCGCAGCGGTCA (SEQ ID NO.16);

[0070] 6.F: GTGACCCCGTATCGTCCGACC (SEQ ID NO.17);

[0071] 6.R:GGTCGGACGATACGGGGTCAC (SEQ ID NO.18);

[0072] 7. F: GTGAGCGTTTTGATGGGCCTGCAC (SEQ ID NO. 19);

[0073] 7.R: GTGCAGCCCATCAAAACGCTCAC (SEQ ID NO. 20);

[0074] 8.F:ACACCCTGCTGAACTGCATTGAAACCATGAA (SEQ ID NO.21);

[0075] 8.R:TTCATGGTTTTCAATGCAGTTCAGCAGGGTGT (SEQ ID NO. 22);

[0076] 9.F: AGCGACCAACCGAATTGCCACCT (SEQ ID NO.23);

[0077] 9.R: ATTTCGCACAGGTGGCAATTCGGTTG (SEQ ID NO. 24);

[0078] The recombinant product was transformed into E. coli competent cells TOP10, colonies were selected for culture, plasmids were extracted, and then... Bam HI and EcoPositive clones were identified by RI double digestion. The correctly identified recombinant plasmids were sequenced. The correctly sequenced plasmids were named as follows: pUC57-VP1-FE-P12Q, pUC57-VP1-FE-L42V, pUC57-VP1-FE-S66H, pUC57-VP1-FE-T87G, pUC57-VP1-FE-M110A, pUC57-VP1-FE-L133Y, pUC57-VP1-FE-F164L, pUC57-VP1-FE-K189C, and pUC57-VP1-FE-D203N (hereinafter referred to as "pUC57-VP1-FE-X").

[0079] 4. Construction and identification of recombinant vectors for DHAV VP1-FE and VP1-FE-X

[0080] plasmids pUC57-VP1-FE and pUC57-VP1-FE-X were subjected to Bam HI and Eco After double digestion with RІ, agarose gel electrophoresis was performed. The target fragment was recovered using the Tiangen agarose gel DNA recovery kit, and the target fragment was ligated into the vector pBR, which had been digested with the same enzyme, using T4 DNA ligase. The plasmids that were correctly identified by enzyme digestion and sequencing were named pBR-VP1-FE and pBR-VP1-FE-X.

[0081] 5. Expression and preliminary purification of recombinant proteins in a silkworm eukaryotic expression system

[0082] 5.1 Construction and Obtaining of Recombinant Silkworm Baculoviruses rBmBacmid-VP1-FE and rBmBacmid-VP1-FE-X

[0083] Approximately 1×10 6 Silkworm cells (BmN) at 15 cm 2After cells adhere to the culture flask, remove the culture medium containing fetal bovine serum (FBS), wash three times with FBS-free medium, and add 1.5 mL of FBS-free medium. Add 1 µg of Bombyx mori baculovirus parental strain BmBcmid DNA (CN 102286534 A), 2 µg of recombinant transfer plasmid, and 5 µL of liposomes to a sterile tube, and bring the volume to 60 µL with sterile water. Gently mix, let stand for 15 min, and then add dropwise to the culture flask for co-transfection. After incubation at 27°C for 4 h, add 1.5 mL of serum-free medium and 300 µL of FBS. Incubate at 27°C for 4–5 days, and collect the supernatant for screening recombinant viruses. Inoculate an appropriate amount of cells (approximately 70–80%) into 35 mm Petri dishes. After cell adhesion, aspirate the medium, dilute the co-transfection supernatant to different concentrations, and add 1 mL of the co-transfection solution to the adherent cells, distributing it evenly. After infection at 27℃ for 1 h, the infection solution was aspirated, and 2% low melting point agarose gel was melted in a 60℃ water bath. The gel was cooled to 40℃ and mixed evenly with 2×TC-100 medium (containing 20% ​​FBS) preheated to 40℃. 4 mL of gel was added to each petri dish, and after solidification, the dishes were sealed with Parafilm. The dishes were incubated upside down at 27℃ for 3-5 days. Microscopic observation was performed, and well-defined plaques formed by the recombinant virus were selected. The above steps were repeated, and pure recombinant silkworm baculovirus rBmBacmid-VP1-FE and rBmBacmid-VP1-FE-X were obtained after 2-3 rounds of purification.

[0084] 5.2 Identification of Recombinant Viruses

[0085] The integration of exogenous genes was analyzed using PCR. The extraction method for cell-free viral genomic DNA was as follows: 150 μL of viral supernatant was taken, and 150 μL (0.5 mol / L) of NaOH was added and mixed well. Then, 20 μL (8 mol / L) of ammonium acetate was added and mixed well. The mixture was then extracted once with equal volumes of phenol and once with chloroform. After ethanol precipitation, the DNA was dissolved in 20 μL of TE buffer. 1 μL of the above viral genomic DNA was used for PCR amplification, and the results confirmed the acquisition of recombinant virus.

[0086] 5.3 Expression of recombinant virus in silkworms and silkworm pupae

[0087] The silkworm pupae used were of the high-expression variety JY1 (preserved in the inventor's laboratory). JY1 silkworm rearing was conducted according to the standard methods described in *Chinese Sericulture* (Shanghai Science and Technology Press, 1991), edited by Lü Hongsheng. Forty-eight hours after feeding, silkworms of similar average weight and 15 pupae of similar average weight seven days after cocooning were selected. Each pupae and silkworm was inoculated with approximately 1.0 × 10⁻⁶ gram. 5After 4–5 days, diseased silkworm pupae and silkworm blood were collected and stored at -20°C for ELISA detection.

[0088] 6. Western blotting detection

[0089] Silkworm hemolymph infected with the recombinant virus was diluted 10-fold with PBS (pH 7.4) and sonicated. SDS-PAGE gel electrophoresis was then performed, with a stacking gel concentration of 5% and a separating gel concentration of 15%. The protein was then transferred to a polyvinylidene fluoride (PVDF) membrane using a semi-dry transfer method. The membrane was blocked with 3% BSA prepared with PBST. Serum from mice immunized with the prokaryotically expressed His-VP1-up protein was used as the primary antibody (1:1000 dilution), and HRP-labeled goat anti-mouse IgG was used as the secondary antibody (1:5000 dilution). Finally, DAB (diaminobenzidine) was used for color development, followed by termination with deionized water. Western blotting results showed that a specific band of 40 kDa was detectable in the recombinant expression product. Figure 1 ).

[0090] 7. ELISA test

[0091] Dilute the silkworm blood lymph samples to be tested serially with coating buffer as appropriate. Use silkworm blood samples infected with the parental virus as a negative control. Add 100 µL to each well of the plate and incubate overnight at 4°C. Quickly discard the liquid in the wells and wash three times with PBST. Add 300 µL of 3% BSA blocking buffer to each well and incubate at 37°C for 3 h, then wash three times with PBST. Dilute the serum from mice immunized with prokaryotically expressed His-VP1-up protein 1:1000 and add 100 µL to each well. Incubate at 37°C for 1.5 h, then wash four times with PBST. Add 100 µL of HRP-labeled goat anti-mouse antibody (1:5000) to each well and incubate at 37°C for 45–60 min, then wash four times with PBST. Add 100 µL of freshly prepared OPD (o-phenylenediamine) chromogenic solution and incubate at room temperature in the dark for 10–30 min. Stop the reaction by adding 50 µL of 2M sulfuric acid to each well. The OD value was measured at a wavelength of 492 nm using an ELISA reader. The OD value of each well was measured after zeroing the blank control well.

[0092] ELISA result interpretation criteria: A positive result is defined as a P / N value (OD value of positive well minus OD value of blank control well / OD value of negative well) greater than or equal to 2.1, with the highest single point mutant ELISA value being around 2400.

[0093] Table 1. ELISA titers and expression levels of silkworm expression products (only mutations with significant effects are listed).

[0094]

[0095] As can be seen from the data in Table 1, the expression levels of four single mutants (VP1-FE-L42V, VP1-FE-M110A, VP1-FE-L133Y, and VP1-FE-D203N) among the obtained unit point mutants were significantly increased, with VP1-FE-L133Y showing the highest expression level at 434 μg / mL.

[0096] Experimental Example 2: Preparation and Detection of Nanoparticle Antigens after Multi-site Mutation of Amino Acids using DHAV VP1-FE-X

[0097] Construction of VP1-FE-X amino acid sequence multi-site mutant gene

[0098] Based on the results of Experiment 1, some effective mutation sites were identified. Considering that the amino acid sequence is the primary structure of a protein, determining its higher-order structure, and that some of the single-point mutations in Experiment 1 may be interconnected, multi-site mutations were attempted. Multi-site mutations were performed based on the single-point mutation sequence obtained in Experiment 1, using the optimized gene sequence with the VP1-FE-X codon as a template. Using appropriate primers (see Experiment 1), site-directed mutations at the second and third sites were performed via fusion PCR. The site-directed mutations were performed using the same fusion PCR method as in Experiment 1.

[0099] The multiple mutation sites are: L42V-M110A-L133Y, L42V-M110A-D203N, L42V-L133Y-D203N, and M110A-L133Y-D203N; the resulting multiple mutants are named: VP1-FE-L42V-M110A-L133Y, VP1-FE-L42V-M110A-D203N, VP1-FE-L42V-L133Y-D203N, and VP1-FE-M110A-L133Y-D203N.

[0100] 2. Construction and identification of VP1-FE-XYZ recombinant vector

[0101] The recombinant product was transformed into E. coli competent cells TOP10, colonies were selected for culture, and plasmids were extracted for use. Bam HI and EcoPositive clones were identified by RI double digestion. The correctly identified recombinant plasmids were sequenced and named as follows: pBR-VP1-FE-L42V-M110A-L133Y, pBR-VP1-FE-L42V-M110A-D203N, pBR-VP1-FE-L42V-L133Y-D203N, pBR-VP1-FE-M110A-L133Y-D203N.

[0102] The specific experimental method is the same as in Experiment 1.

[0103] 3. Expression and purification of recombinant proteins in a silkworm eukaryotic expression system

[0104] The specific experimental method is the same as in Experiment 1.

[0105] 4. Western blotting detection

[0106] The specific experimental method is the same as in Experiment 1.

[0107] Western blotting results showed that a specific band of 40 kDa was detected in the supernatant of silkworm hemolymph samples after recombinant virus infection (see...). Figure 2 ).

[0108] 5. ELISA test

[0109] The specific experimental method is the same as in Experiment 1. ELISA results show that the highest ELISA value for the multimutant strain is around 2800.

[0110] Based on the single mutation, multi-site mutations were performed to obtain four multi-site mutants (VP1-FE-L42V-M110A-L133Y, VP1-FE-L42V-M110A-D203N, VP1-FE-L42V-L133Y-D203N, VP1-FE-M110A-L133Y-D203N). As can be seen from the data in Table 2, VP1-FE-M110A-L133Y-D203N had the highest expression level, reaching 507 μg / mL.

[0111] Table 2. ELISA titers and expression levels of silkworm expression products (only mutations with significant effects are listed).

[0112]

[0113] 6. Electron microscopy observation

[0114] Use a 1 mL syringe to aspirate a certain amount of 1% uranyl acetate for later use, and use another syringe to aspirate a certain amount of distilled water. After the VP1-FE-X-Y-Z (VP1-FE-L42V-M110A-L133Y, VP1-FE-L42V-M110A-D203N, VP1-FE-L42V-L133Y-D203N, VP1-FE-M110A-L133Y-D203N) nanoparticles in silkworm hemolymph were preliminarily purified, dilute them with the suspension. Drop the suspended sample on the sealing film to form a small liquid bead. Use the tip of forceps to hold the grid and make the film side face down to pick up the sample, then dry it with filter paper, and then wash away the excess suspended matter, wash 5 times. After drying, place the grid on the droplet of 1% uranyl acetate staining solution, stain for 3 minutes, dry the excess staining solution from the edge of the copper grid with filter paper, repeat 2 - 3 times, and examine under the microscope after drying. The microscopic examination results are as Figure 2 shown.

[0115] Experimental Example 3 Animal Experiment and Virus Neutralization Experiment

[0116] 1 Inoculate animals with the expression products VP1-FE, VP1-FE-L133Y, VP1-FE-M110A-L133Y-D203N of the silkworm eukaryotic expression system

[0117] After quantitative experiments on the target proteins expressed by silkworm pupae, prepare various types of vaccines according to the equimolar ratio of the target protein amount to immunize animals. The preparation method is as follows: Weigh the crude products containing the corresponding expression amounts of antigens or nanoparticle antigens respectively, add 90 mL of PBS buffer, stir with a stirrer for 5 - 10 min, mix well, and make the mother liquor and put it into a sterilized bottle. The 206 adjuvant is sterilized in advance and placed in a 30 °C incubator for heat preservation. An appropriate amount of the mother liquor is first placed on ice and adjusted. When mixing with the adjuvant, first add 3 mL of the adjuvant to a 15 mL centrifuge tube, slowly drop 3 mL of the mother liquor, and homogenize with a homogenizer for 3 min. Add ciprofloxacin hydrochloride. The vaccine is milky white. Take a small amount for quality inspection. Centrifuge at 3000 rpm for 15 min. If the vaccine does not separate layers, it is qualified. Treat the crude products of healthy silkworm pupae in the same way to make vaccines for control.

[0118] After 50 SPF mice were adaptively fed for one week, they were randomly divided into 5 groups with 10 mice in each group. 10 mice were respectively intraperitoneally injected with 1 dose (0.2 mL) of the vaccines prepared from blank silkworm blood control, VP1-FE, VP1-FE-L133Y, VP1-FE-M110A-L133Y-D203N silkworm pupa expression products; 10 mice were not immunized as the normal control group. 15 days after inoculation, take about 1 mL of blood from the orbital cavity, place it in a test tube and tilt it, place it at 37 °C for 2 h, and then transfer it to room temperature overnight. Transfer the serum to a centrifuge tube, centrifuge at 2000 rpm for 10 min, and collect the serum.

[0119] 2. ELISA detection

[0120] The specific experimental method is the same as in Experiment 1.

[0121] Using the prokaryotic expression protein VP1-up as the antigen for quantification, expression products with significant mutation effects were selected for animal experiments, and the antibody titers of the experimental animals were measured. The results are shown in Table 3.

[0122] Table 3. Detection of serum antibody titers in immunized mice (21 days)

[0123]

[0124] 3. Virus neutralization experiment

[0125] Further neutralization experiments with the target virus were conducted on animal sera containing products showing significant mutation effects. The test sera were serially diluted 2-fold with serum-free DMEM medium. An equal volume of 100 TCID50 virus solution was then added to each dilution of the test sera, and the mixed samples were incubated at 37 ℃ for 1 h. 200 μL of each mixed sample was inoculated into duck embryos. Daily observations were performed, and the neutralizing titer of the test sera was calculated using the Reed-Muench method based on the duckling embryo mortality rate. The results are shown in Table 4.

[0126] Table 4. Detection of neutralizing antibody titers in the serum of immunized mice (21 days)

[0127]

[0128] The results of mouse immunization showed that the titer of neutralizing anti-duck hepatitis A virus antibodies induced by the mutant antigen was not lower than that of serum controls from VP1-FE immunized mice.

Claims

1. Mutants of fusion proteins, characterized in that, The mutant is a single-site mutant obtained by mutating the fusion protein with the amino acid sequence shown in SEQ ID NO. 1 at the L133Y amino acid unit point; or a multi-site mutant obtained by mutating the amino acid sequence shown in SEQ ID NO. 1 at the M110A-L133Y-D203N multi-site.

2. The coding gene of the mutant of claim 1.

3. The expression vector containing the coding gene of claim 2.

4. A method of preparing the mutant of claim 1, wherein, Comprising: expressing the coding gene of the mutant in a silkworm expression system, collecting and purifying the expressed antigen; or expressing the coding gene of the mutant in an insect cell eukaryotic expression system, collecting and purifying the expressed antigen.

5. The method of claim 4, wherein, constructing a silkworm baculovirus expression vector from the coding gene of the mutant and infecting silkworm cells to obtain a recombinant silkworm baculovirus; amplifying the recombinant silkworm baculovirus in silkworm cells and then expressing it in silkworms or pupae; or cloning the coding gene of the mutant into a baculovirus recombinant vector to construct a recombinant baculovirus recombinant vector; co-transfecting insect cells with the baculovirus recombinant vector and baculovirus DNA to obtain a recombinant baculovirus; infecting insect hosts or insect cells with the recombinant baculovirus, and culturing the infected insect cells or insect hosts to express the corresponding antigen, which is then purified.

6. The use of the mutant of claim 1 or the coding gene of claim 2 in the preparation of a duck hepatitis A vaccine.

7. A duck hepatitis A vaccine comprising an antigen and a medically acceptable immunological adjuvant or carrier, characterised in that, The antigen is the mutant of claim 1.

Images