SIRT2 knocked-down HMC3 cell modified strain and preparation method and application of microvesicles of SIRT2 knocked-down HMC3 cell modified strain

Abstract

The invention discloses a construction method of a human-derived HMC3 microglial cell line modified strain (named SIRT2-KD HMC3) for treating Alzheimer's disease (AD). The cell strain is obtained by knocking down an SIRT2 gene through genetic engineering. The invention also discloses a method for producing LEVs by using the cell strain, the cell strain can form an M2 anti-inflammatory form in a culture process, and the microvesicles LEVs-sh-SIRT2 are obtained by collecting a culture solution and adopting an ultra-high speed centrifugation method. A preclinical animal test (AD mode mouse APP / PS1) result shows that the LEVs prepared by the invention can effectively regulate and control inflammatory response and promote phagocytosis. After nasal administration, the LEVs can smoothly penetrate through a blood brain barrier to enter a hippocampus and are taken by microglial cells, so that chemotactic and phagocytic activities of the microglial cells are promoted, deposition of A beta in the brain is reduced, cognitive impairment of experimental animals is remarkably improved, and the medicine has a wide application prospect in the field of AD innovative treatment.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine and relates to a modified human HMC3 microglial cell line for treating Alzheimer's disease (AD) and a preparation method and application of its microvesicles (LEVs). The cell line is obtained by knocking down the SIRT2 gene through genetic engineering. Background Art

[0002] The current chemical drugs used in clinical practice to treat AD can only relieve symptoms but cannot slow down or reverse the progression of the disease in the middle and late stages. At the same time, although monoclonal antibody drugs targeting amyloid plaques (Aβ) and neurofibrillary tangles (NFTs) have completed a large number of phase II and phase III trials in AD patient cohorts at different stages, progress has been slow and controversial. For example, Aducanumab was approved for marketing in the phase II clinical trial, but data from the phase III clinical trial showed that after 78 weeks of treatment, the rate of decline in cognitive function scores (CDR-SB) in patients in the high-dose group was only slowed by 22%. Therefore, clarifying the pathogenesis of AD and new therapeutic targets is the core link in drug research and development; at the same time, developing innovative treatment strategies and intervention methods has become an urgent need to improve the clinical prognosis of AD.

[0003] In recent years, numerous studies have focused on the relationship between microglia and AD and related therapeutic strategies. Research by the French scholar Hemonnot's team and Zhang Yinglin's team at the Shanghai Jiao Tong University School of Medicine has confirmed that microglial activation triggers neuroinflammation. Of note, microglia serve as the first line of immune defense against β-amyloid (Aβ) deposition. Once their cellular homeostasis phenotype is imbalanced, their autoimmune function is disrupted, accelerating the formation of Aβ plaques. This finding suggests that targeted regulation of microglial homeostasis and its immune function may become a key clinical intervention strategy to improve or even reverse the progression of AD. Professor Mao Ying's team at the Department of Neurosurgery at Shanghai Huashan Hospital demonstrated that exosomes derived from M2 microglia, induced by 1070nm light, significantly reduced the Aβ burden in AD transgenic mice, effectively alleviated neuroinflammation, promoted dendritic spine plasticity, and ultimately improved some cognitive functions in the mice. This research reveals the enormous potential of M2 microglial extracellular vesicles (EVs) for AD treatment. Research by Wang Ban and other scholars at Wuhan University has shown that reducing SIRT2 levels through siRNA can significantly inhibit lipopolysaccharide (LPS)-induced BV2 microglial activation. Further analysis found that knocking down SIRT2 expression or inhibiting its protein activity not only promotes microglial polarization toward the M2 type, but also regulates the NF-κB inflammatory pathway, reducing the production of inflammatory factors such as inducible nitric oxide synthase (iNOS), tumor necrosis factor-α (TNF-α), and interleukin-1β (IL-1β), thereby effectively alleviating neuroinflammatory responses.

[0004] Based on the analysis and summary of the above-mentioned cutting-edge research, the technical team proposed a promising clinical intervention strategy for AD: by targeted inhibition of SIRT2 expression, microglia can be driven to transform into the M2 type with anti-inflammatory properties, effectively alleviating neuroinflammation and exerting a neuroprotective effect. Given that EVs can efficiently transmit the biological functions of parent cells, using EVs secreted by exogenous SIRT2-knockdown microglia as a drug to target microglia in lesions is expected to achieve the biological effect of targeted microglial inhibition of SIRT2, while promoting microglial chemotaxis and phagocytic activity, significantly reducing neuroinflammation levels, and strengthening neuroprotective mechanisms. This is more likely to effectively curb disease progression during the course of AD and even reverse the pathological process, bringing breakthrough progress to the clinical treatment of AD. Summary of the Invention

[0005] Based on these findings, the present invention discloses a modified human HMC3 microglial cell line for the treatment of Alzheimer's disease (AD), and a method for preparing and using the resulting microvesicles (LEVs). This cell line reduces SIRT2 gene expression by more than 80%. The present invention also discloses a method for producing LEVs using this cell line, as well as the potential application of these LEVs in AD treatment.

[0006] The SIRT2-KD HMC3 cell line has been deposited in the China Center for Type Culture Collection with the accession number CCTCCNO: C2025155. The depository address is Wuhan University, Wuhan, China. The deposit date is June 11, 2025. The deposit is classified and named Homo sapiens SIRT2-KD HMC3 (Chinese name: human brain microglial cells SIRT2-KD HMC3).

[0007] Specifically, the technical solutions of the present invention are as follows:

[0008] The first aspect of the present invention discloses a modified human HMC3 microglial cell line for the treatment of AD, named SIRT2-KD HMC3. The cell line is characterized by a reduction of SIRT2 gene expression by more than 80% and a SIRT2 expression level of no less than 10%. The genetic engineering method preferably adopts a knockdown vector strategy combining a plasmid and a lentiviral shRNA to construct a lentiviral shRNA interference vector pLV[shRNA]-EGFP:T2A:Puro-U6>(hSIRT2) to achieve stable transfection. The characteristic sequence of the vector, sh-SIRT2, is: AAGTAGTGACAGATGGTTGGCCTCGAGGCCAACCATCTGTCACTACTT.

[0009] The second aspect of the present invention discloses a modified human HMC3 microglial cell line and a method for preparing its microvesicles (LEVs). The core feature is that the production cell line must exhibit anti-inflammatory M2 cell characteristics. The vesicles LEVs-sh-SIRT2 are obtained by collecting the cell culture medium and centrifuging it. The enriched microvesicles have a particle size distribution of 200-400nm, with an average particle size of 280±10nm.

[0010] The third aspect of the present invention discloses the potential medical use of microvesicles LEVs-sh-SIRT2 produced by a modified strain of a human HMC3 microglial cell line, which is mainly used for the control treatment and / or adjuvant treatment of AD progression. When it is developed as an AD therapeutic drug, the applicable pharmaceutical preparation is selected from the following dosage forms: tablets, capsules, injections (including freeze-dried powder injections and injections), oral liquid preparations, ointments, creams, aerosols, suppositories, transdermal patches, or any combination thereof. When it is used for the treatment of AD, the route of administration is selected from any one of: oral administration, intravenous / muscular injection, subcutaneous implantation, nasal mucosal administration, and blood-brain barrier targeted administration.

[0011] In the embodiment of the present invention, a SIRT2 knockdown cell line SIRT2-KD HMC3 of human brain microglia was successfully constructed by genetic engineering. This line can form an M2 anti-inflammatory morphology during the culture process. The culture fluid was collected and the microvesicles LEVs-sh-SIRT2 were obtained by differential centrifugation. The results of preclinical animal experiments (AD model mice APP / PS1) showed that the LEVs prepared by the present invention can effectively regulate inflammatory responses and promote phagocytosis. After nasal administration, LEVs can smoothly cross the blood-brain barrier and enter the hippocampus, and are taken up by microglia, thereby promoting the chemotaxis and phagocytic activity of microglia, reducing the deposition of Aβ in the brain, and significantly improving the cognitive dysfunction of experimental animals, and thus have a prospect for application in the treatment of AD.

[0012] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0013] 1. The present invention provides a microvesicle containing genetically modified human HMC3 microglia-derived LEVs-sh-SIRT2, which has been shown in animal experiments to effectively penetrate the blood-brain barrier;

[0014] 2. The microvesicles LEVs-sh-SIRT2 prepared by the present invention have been shown to inhibit neuroinflammation in AD model mice in animal experiments;

[0015] 3. The microvesicles LEVs-sh-SIRT2 prepared in the present invention have been shown in animal experiments to promote the chemotaxis and phagocytic activity of microglia in AD model mice, reduce the deposition of Aβ plaques, and improve cognitive function. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The drawings described herein are used to provide a further understanding of the embodiments of the present invention, constitute a part of this application, and do not constitute a limitation of the embodiments of the present invention.

[0017] Figure 1 Schematic diagram of SIRT2 knockdown in HMC3 microglia. Figure A shows the vector map of the lentiviral shRNA interference vector pLV[shRNA]-EGFP:T2A:Puro-U6>(hSIRT2). Figure B shows the vector map of the lentiviral shRNA control vector pLV[shRNA]-EGFP / Puro-U6>Scramble_shRNA. Figure C shows fluorescence microscopy images of green fluorescent protein (GFP) expression in HMC3 cells infected with the control vector (sh-control) and the knockdown vector (sh-SIRT2). Figure D shows Western blot analysis of the SIRT2 knockdown effect in HMC3 cells.

[0018] Figure 2 Extracellular vesicles (EVs) derived from the SIRT2-knockdown HMC3 cell line SIRT2-KD HMC3 and their characterization. Figure A shows the morphology of extracted EVs captured by transmission electron microscopy. Figure B shows the quantitative analysis of the diameters of each extracted EV by transmission electron microscopy. Figure C shows the identification of EV-specific marker proteins by Western blot. Figure D shows the size distribution of each EV as analyzed by a nanoparticle size analyzer. Figure E shows the extraction and DiI staining of EVs from HMC3 cells.

[0019] Figure 3 Analysis of the distribution of extracellular vesicles (EVs) derived from the SIRT2-KD HMC3 cell line after entering the brain via the nose-brain pathway. Panel A shows IF verification of DiI-labeled SEVs being taken up by microglia, astrocytes, and neurons in the mouse olfactory bulb and hippocampus. Panel B shows IF verification of DiI-labeled LEVs being taken up by microglia, astrocytes, and neurons in the mouse olfactory bulb and hippocampus. Panel C shows a schematic diagram of EV intranasal administration and EV entry into the brain via the nose-brain pathway.

[0020] Figure 4Schematic diagram showing that intranasal administration of LEVs-sh-SIRT2 significantly improves cognitive function in APP / PS1 mice. Eight-month-old APP / PS1 mice and their littermate control mice were treated intranasally with SEVs or LEVs, and their behavioral performance was assessed eight weeks later. Panel A shows that LEVs-sh-SIRT2 significantly improves nesting behavior in APP / PS1 mice. Panel B shows that LEVs-sh-SIRT2 improves spontaneous alternation behavior in APP / PS1 mice. Panels C and D show that LEVs-sh-SIRT2 significantly improves learning and memory in APP / PS1 mice in a water maze.

[0021] Figure 5 Immunofluorescence analysis showed that LEVs-sh-SIRT2 promoted microglial migration and phagocytosis in APP / PS1 mice, reducing Aβ plaque deposition. Figure A shows immunofluorescence analysis of Aβ plaque deposition in the mouse hippocampus. Figure B shows quantitative analysis of Aβ plaque density in the hippocampus. Figure C shows quantitative analysis of Aβ plaque area in the hippocampus. Figure D shows Western blot analysis of soluble Aβ oligomer content and its quantitative analysis in the mouse hippocampus. Figure E shows immunofluorescence analysis of Iba1 and Aβ expression in the mouse hippocampus. Figure F shows quantitative analysis of the percentage of Aβ plaques internalized by microglia in the hippocampus. Figure G shows quantitative analysis of the number of microglia surrounding Aβ plaques in the hippocampus. Figure H shows Western blot analysis of Iba1 expression in the mouse hippocampus and its quantitative analysis.

[0022] Figure 6 Proteomic analysis revealed that LEVs-sh-SIRT2 possesses enhanced intrinsic characteristics of phagocytosis induction and inflammation resistance. Figure A shows the differentially expressed proteins in a pairwise comparison of the four EVs. This quantitative protein comparison only includes proteins with significant differences in expression and excludes proteins with or without differences in expression between groups. Figure B shows a KEGG butterfly plot of differentially up- and down-regulated proteins between HMC3 cell-derived LEVs and SEVs. Figure C shows a KEGG butterfly plot of differentially up- and down-regulated proteins between SEVs-sh-control and SEVs-sh-SIRT2. Figure D shows a KEGG butterfly plot of differentially up- and down-regulated proteins between LEVs-sh-control and LEVs-sh-SIRT2. In Figures B and D, red indicates signaling pathways enriched for up-regulated proteins, and blue indicates signaling pathways enriched for down-regulated proteins.

[0023] Figure 7Transcriptome sequencing analysis of mouse hippocampal tissue revealed that LEVs-sh-SIRT2 significantly alleviated neuroinflammation in APP / PS1 mice. Figure A shows a volcano plot of differentially expressed genes between the AD LEVs-sh-SIRT2-treated group and the AD PBS group. Figure B shows a volcano plot of differentially expressed genes between the AD PBS group and the WT PBS group. Figure C shows a Venn diagram of the intersection of differentially expressed genes between the three groups of mice. Figure D shows a trend analysis of differentially expressed genes in hippocampal tissue from the three groups of mice. Cluster 4 is a gene cluster upregulated in the AD PBS group and downregulated in the AD LEVs-sh-SIRT2 group and the WT PBS group. Figure E shows KEGG enrichment analysis revealing the top 20 signaling pathways within Cluster 4. Figure A represents the AD LEVs-sh-SIRT2 group, B represents the AD PBS group, and C represents the WT PBS group. DETAILED DESCRIPTION

[0024] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with examples and drawings. The exemplary embodiments of the present invention and their descriptions are only used to explain the present invention and are not intended to limit the present invention.

[0025] Example 1: Construction of SIRT2 knockdown lentiviral vector pLV[ShRNA]-EGFP:T2A:Pur-U6>(hSIRT2) and preparation of lentivirus

[0026] The construction process of knockdown lentiviral plasmid pLV[ShRNA]-EGFP:T2A:Pur-U6>(hSIRT2) and its blank control plasmid pLV[ShRNA]-EGFP:T2A:Pur-U6>Scramble_shRNA is almost the same. The vector map is shown in Figure 1 As shown in A and 1B.

[0027] Specifically, the sh-SIRT2 sequence and the sh-scramble sequence were first cloned by PCR, and the target fragments were purified for later use. The primers were designed as shown below.

[0028] sh-SIRT2-F ccggaagtagtgacagatggttggcctcgaggccaaccatctgtcactactttttttg sh-SIRT2-R aattcaaaaaaagtagtgacagatggttggcctcgaggccaaccatctgtcactactt sh-scramble-F ccggcctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttaggtttttg sh-scramble-R aattcaaaaacctaaggttaagtcgccctcgctcgagcgagggcgacttaaccttagg

[0029] Subsequently, the pLV[shRNA]-EGFP / Puro-U6(shRNA) backbone vector, the sh-SIRT2 sequence PCR product, and the sh-scramble sequence PCR product were double-digested using AgeⅠ-HF and EcoRI-HF restriction endonucleases, respectively. After the reaction was completed, each product was subjected to agarose gel electrophoresis to extract the target fragments, which were purified using the SanPrep column-based DNA gel extraction kit, and their concentrations were determined using a NanoDrop 8000. Finally, the sh-SIRT2 and sh-scramble digestion products were mixed with the digested pLV[shRNA]-EGFP / Puro-U6(shRNA) vector product at a molar ratio of 3:1. T4 DNA ligase was added, and the ligation reaction was carried out overnight at 4°C. The ligation products were finally purified.

[0030] The purified product was transformed into UltraStable (E. coli K-12) competent cells, which were then streaked onto LB plates. After monoclonal colonies developed on the plates, 6-8 colonies were selected for preliminary PCR verification using two pairs of validation primers: U6-F (GGGCCTATTTCCCATGATTCCTTC) and shRNA-R2 (TGCAGAATGCGGAACAC). Monoclonal colonies that tested positive for PCR were cultured, plasmids were extracted using conventional methods, and the plasmid sequences were accurately verified by gene sequencing.

[0031] E. coli K-12 glycerol strains containing pLV[ShRNA]-EGFP:T2A:Pur-U6>(hSIRT2) were selected and inoculated into LB liquid medium for overnight culture. Plasmid DNA was extracted using an endotoxin-free plasmid DNA isolation kit and the plasmid concentration was measured by NanoDrop8000 for later use. HEK-293T cells were seeded into 10 cm culture dishes and cultured in DMEM medium containing 10% FBS at 37°C and 5% CO2 for 24 hours to achieve a cell fusion rate of 80% to 90%. One hour before transfection, the culture medium was replaced with 1. Add solution A (1.5 mL I and 4 μg DNA (packaging plasmid pMD2.G, psPAX2 and target gene plasmid, the mass ratio of the three is 1:1:2)) and B solution (1.5 mL Mix the culture medium (1) with 40 μL of Lipofectamine 2000 by pipetting and incubate at room temperature for 20 minutes. After incubation, slowly add the transfection complex to the culture medium, gently shake to distribute it evenly, and continue incubation at 37°C, 5% CO2 for 6 hours. The culture medium is then replaced with DMEM supplemented with 10% FBS and incubation continues. After 48 hours, the culture supernatant is collected and centrifuged at 2000 g for 30 minutes at 4°C. Cell debris is removed through a 0.45 μM filter, and the filtrate is collected and centrifuged at 50,000 g for 2 hours to obtain lentiviral particles. Resuspend the viral particles in 200 μL of HBSS buffer, aliquot, and store at -80°C. These particles are designated EGFP:T2A:Puro-U6>hSIRT2_shRNA. Lentivirus EGFP:T2A:Puro-U6>Scramble_shRNA is obtained similarly.

[0032] Example 2: Construction of SIRT2-knockdown HMC3 stable transfection cells

[0033] HMC3 cells (1×10 5 Cells) were inoculated into 6 cm cell culture dishes to ensure that the cell confluency reached an optimal state of 30-50% during lentiviral infection. The virus was thawed on ice, and the required virus volume was calculated based on an MOI of 25. The lentiviral vectors EGFP:T2A:Puro-U6>hSIRT2_shRNA (shRNA-SIRT2) and EGFP:T2A:Puro-U6>Scramble_shRNA (shRNA-control) were diluted in MEM medium. Afterwards, MEM complete medium was thoroughly mixed with the infection-promoting reagent polybrene, and 2 ml of mixed medium was added to each dish to replace the original medium. Next, 200 μl of diluted lentivirus was added to each culture dish, and the culture dish was gently shaken to ensure that the virus solution evenly covered all cells. 24 hours after lentiviral infection, the culture medium was replaced with fresh culture medium; 72 hours after infection, the cells were treated with 1.5 μg / ml puromycin, and cell lines with stable expression were selected and passaged. After multiple passages, the HCM3 cell line was obtained through repeated screening and named SIRT2-KD HMC3 strain, which was preserved in the cell bank of our laboratory. SIRT2 expression in this strain was downregulated by more than 80%, and this cytological feature could be stabilized without the need for subsequent addition of puromycin. Figure 2 As shown, infection with the lentiviral EGFP:T2A:Puro-U6>hSIRT2_shRNA downregulated SIRT2 expression in HMC3 cells by more than 80%.

[0034] Example 3: Preparation of extracellular vesicles from HMC3 cells

[0035] SIRT2-KD HMC3 and shRNA-control HMC3 stably transfected cells were seeded into 15 cm culture dishes and cultured under the same conditions. When cells reached 80% confluency, the complete MEM medium was replaced with exosome-free MEM medium and cultured for another 24 hours. The culture medium was collected and frozen at -80°C. Once sufficient culture medium was obtained, the culture medium was thawed and centrifuged at 500 g for 10 minutes at 4°C. The pellet (cells and cell debris) was discarded. The supernatant was centrifuged again at 4,000 g for 10 minutes at 4°C, and the pellet (cells and cell debris) was discarded. The supernatant was centrifuged again at 16,000 g for 30 minutes at 4°C to separate the supernatant and pellet. The pellet was resuspended in sterile PBS (by repeatedly pipetting with a 1 ml pipette) to obtain large vesicles (LEVs). The LEV suspension was diluted and washed with sterile PBS, then centrifuged at 16,000 g for 30 minutes at 4°C. The pellet was collected and used in subsequent experiments. The supernatant obtained by the first centrifugation at 16,000 g for 30 min was filtered through a 0.45 μm filter and transferred to a 70 ml Beckman ultracentrifuge tube. The tubes were balanced to ensure that the error between the centrifuge tubes did not exceed 0.01 g. The tubes were centrifuged at 4 ° C and 100,000 g for 120 min, and the precipitate was collected and resuspended with sterile PBS (1 ml pipette was used to repeatedly blow the precipitate) to obtain exosomes (SEVs). The obtained SEVs were diluted and washed with sterile PBS, and centrifuged again at 4 ° C and 100,000 g for 120 min. The precipitate was collected and used for subsequent experiments. The SEVs and LEVs derived from the shRNA-control and shRNA-SIRT2 stably transfected HMC3 cells obtained above were named LEVs-sh-control, SEVs-sh-control, LEVs-sh-SIRT2, SEVs-sh-SIRT2 ( Figure 2 E). Nanoparticle size analysis (NTA) and transmission electron microscopy were used to examine the size distribution and morphology of each EV. Western blotting was used to detect marker proteins (CD63, Alix, flotilin-2, ARF6, and GM-130) in each EV. The captured EVs were labeled with the fluorescent dye DiI, and EV uptake by HMC3, U87, and SH-SY5Y cells was observed.

[0036] The results are as follows Figure 2 Transmission electron microscopy results showed that after negative staining with uranyl acetate, both LEVs and SEVs had a distinct double-layered capsule structure, with a saucer-shaped or hemispherical shape with one side concave ( Figure 2 A). Further analysis of the electron microscopy images of each EV and comparison of the diameters of the four extracellular vesicles revealed significant differences in the diameters of LEVs and SEVs ( Figure 2B). Western blot analysis showed that CD63, Alix, and flotilin-2 markers were enriched in SEVs, and CD63, Alix, flotilin-2, ARF6, and GM-130 markers were enriched in LEVs ( Figure 2 C). NTA results showed that the LEVs secreted by HMC3 cells had a particle size range of 100-500 nm, mainly concentrated at 200, 300, and 400 nm, with average particle sizes of 269.7 nm (LEVs-sh-control) and 288.6 nm (LEVs-sh-SIRT2), respectively. SEVs secreted by HMC3 cells were mainly concentrated at around 130 nm, with average particle sizes of 159.5 nm (SEVs-sh-control) and 143.9 nm (SEVs-sh-SIRT2), respectively. ( Figure 2 D).

[0037] Example 4: Extracellular vesicles (EVs) derived from HMC3 cells can enter the brain via the nose-brain pathway

[0038] To observe whether SEVs and LEVs can enter the hippocampus through the nose-brain pathway, we administered DiI-labeled SEVs or LEVs to mice by nasal drops, spraying 10 μl each time with an interval of 5 minutes. Each mouse received 40 μl EVs per day for 7 consecutive days. The brain tissues of the mice were obtained and stained with Iba1 / DAPI, GFAP / DAPI and NeuN / DAPI fluorescence to observe the localization of DiI-labeled EVs in microglia, astrocytes and neurons in the olfactory bulb and hippocampus of the mice.

[0039] The results are as follows Figure 3 SEVs can be observed in microglia, astrocytes, and neurons in the olfactory bulb and hippocampus of mice ( Figure 3 A) and LEVs( Figure 3 B). These experimental results indicate that SEVs and LEVs can enter the brain through the nose-brain pathway and spread to the hippocampus ( Figure 3 C).

[0040] Example 5: Intranasal administration of LEVs-sh-SIRT2 significantly improves cognitive impairment in APP / PS1 transgenic mice

[0041] To observe the effects of SEVs and LEVs derived from sh-control-HMC3 cells and sh-SIRT2-HMC3 cells on cognitive function in APP / PS1 mice, we randomly divided 8-month-old APP / PS1 mice (AD) and wild-type littermate (WT) mice into six groups: WT PBS (WT type, PBS treatment), AD PBS, AD SEVs-control, AD LEVs-control, AD SEVs-sh-SIRT2, and AD LEVs-sh-SIRT2. The mice in each group were treated with the corresponding PBS, SEVs, and LEVs by intranasal administration. Extracellular vesicles were expressed at a concentration of 0.5*10 9 The mice were intranasally administered with a dose of 10 μg of each particle per time, once every other day, and behavioral tests were performed after 30 consecutive intranasal drops (when the mice were 10 months old).

[0042] The results are as follows Figure 4 The nesting experiment results showed that compared with WT mice, the nesting score of AD mice was significantly reduced. After intranasal treatment with LEVs-sh-SIRT2, the nesting score of AD mice recovered, but SEVs-control, LEVs-control, and SEVs-sh-SIRT2 intranasal treatment had no such effect ( Figure 4 A). The results of the Y-maze test showed that the spontaneous alternation index of AD mice was significantly decreased compared with that of WT mice. After intranasal treatment with LEVs-sh-SIRT2, the spontaneous alternation index of AD mice recovered, but the difference was not statistically significant ( Figure 4 B). In the water maze test, during the visible platform test phase, there was no significant difference in the swimming speed of mice in each group ( Figure 4 C). In the hidden platform test phase, after 5 consecutive days of training, the latency of mice in each group to escape from the water to the hidden platform gradually shortened. However, compared with WT mice, the latency of AD mice to escape from the water to the hidden platform was significantly prolonged; after intranasal treatment with LEVs-sh-SIRT2, their latency to escape from the water surface was significantly shortened; while SEVs-control, LEVs-control, and SEVs-sh-SIRT2 intranasal treatment had no such effect ( Figure 4 D and E), indicating that intranasal administration of LEVs-sh-SIRT2 can significantly improve the spatial learning ability of APP / PS1 mice. During the exploratory phase, compared with WT mice, the frequency of AD mice crossing the platform area and the time they stayed in the platform quadrant were significantly reduced. However, after intranasal administration of LEVs-sh-SIRT2, the frequency of AD mice crossing the platform area and the time they stayed in the target quadrant were significantly prolonged ( Figure 4FH), indicating that LEVs-sh-SIRT2 can significantly improve the spatial memory ability of APP / PS1 mice.

[0043] Example 6: LEVs-sh-SIRT2 promotes microglial migration and phagocytosis in the hippocampus of APP / PS1 mice and reduces Aβ plaque deposition

[0044] To investigate the effects of HMC3 cell-derived EVs on the pathological phenotypes of APP / PS1 mice, we assessed Aβ plaque deposition and microglial phagocytosis in the hippocampus of 10-month-old APP / PS1 mice by Iba1 / Aβ immunofluorescence and Western blot (6E10). For immunofluorescence, 30 μm frozen brain sections were blocked with 3% BSA-PBS for 1 hour and then incubated with rabbit anti-Iba1 (1:200, Wako) and mouse anti-Aβ (1:1000, Biolegend) overnight at 4°C, followed by goat anti-mouse Alexa Fluor 555 and goat anti-rabbit Alexa Fluor 488 (1:500, ThermoFisher) for 1 hour at room temperature. The sections were then mounted on glass slides, covered with anti-fluorescence quencher (ThermoFisher), and images were captured using a digital slide scanning system and confocal microscopy. For Western blot experiments, protein samples were electrophoresed on a 6-12% SDS-PAGE. After transfer, the protein-containing PVDF membrane was incubated with rabbit anti-Iba1 (1:1000, Wako) and mouse anti-Aβ (1:1000, Biolegend) overnight at 4°C. The membrane was then incubated with HRP-conjugated goat anti-rabbit IgG and HRP-conjugated goat anti-mouse IgG antibodies (1:5000, Proteintech) for 1 hour at room temperature. After incubation in a luminescent solution for 1 minute, protein bands were imaged using an imaging system.

[0045] Immunofluorescence and Western blot results are shown in Figure 2. Figure 5 As shown in Figure 2, after intranasal treatment with LEVs-sh-SIRT2, the number and area of ​​Aβ plaques in the hippocampus of APP / PS1 mice were significantly reduced ( Figure 5 AC). Western blot results showed that after intranasal treatment with LEVs-sh-SIRT2, the expression of Aβ oligomers in the hippocampus of APP / PS1 mice tended to decrease ( Figure 5 D). The above results indicate that intranasal administration of LEVs-sh-SIRT2 can significantly reduce the deposition of Aβ plaques in the hippocampus of APP / PS1 mice, thereby improving the cognitive function of mice. In addition, after intranasal treatment with LEVs-sh-SIRT2, the accumulation of microglia around Aβ plaques in the hippocampus of APP / PS1 mice increased ( Figure 5E and 5G), the percentage of Aβ plaques internalized by microglia increased significantly ( Figure 5 E and 5F). Western blot results showed that after intranasal treatment with LEVs-sh-SIRT2, the expression level of Iba1 in the hippocampus of APP / PS1 mice did not change significantly ( Figure 5 H), suggesting that the increased microglia around Aβ plaques are not caused by microglial proliferation. The above results show that intranasal administration of LEVs-sh-SIRT2 can significantly promote the migration of microglia to Aβ plaques and the phagocytosis of Aβ plaques in the hippocampus of APP / PS1 mice. Example 7: LEVs-sh-SIRT2 has stronger intrinsic characteristics of phagocytosis induction and inflammation resistance

[0046] To analyze and investigate the effects of SIRT2 knockdown on the protein content of HMC3 cell-derived EVs, we performed further proteomic analysis of the obtained EVs. Appropriate amounts of LEVs-sh-control, SEVs-sh-control, LEVs-sh-SIRT2, and SEVs-sh-SIRT2 EV samples were collected and protein extracted using SDT (4% SDS, 100 mM Tris-HCl, pH 7.6) lysis buffer for quantitative analysis. Subsequently, 15 μg of protein from each EV group was subjected to SDS-PAGE electrophoresis, stained with Coomassie Brilliant Blue R-250, excised, and trypsinized using the Filter-aided proteome preparation (FASP) method. The peptides from the digested samples were desalted using a C18 cartridge, lyophilized, and reconstituted in 40 μL of 0.1% formic acid. Peptide concentrations were determined by OD 280. An appropriate amount of iRT standard peptides was added to the enzymatically digested peptides of each sample, and DIA mass spectrometry was performed using an Astral high-resolution mass spectrometer. The resulting DIA data were processed using DIA-NN software and normalized for bioinformatics analysis.

[0047] The experimental results are as follows Figure 6 As shown in Figure 2, bioinformatics analysis revealed proteins with significant differences among EVs ( Figure 6 A). KEGG analysis of these differentially expressed proteins showed that compared with SEVs-sh-control, the upregulated proteins in LEVs-sh-control were mainly enriched in the "Ribosome" and "Oxidative phosphorylation" signaling pathways ( Figure 6B), indicating that LEVs derived from HMC3 cells play an important role in regulating ribosome and mitochondrial oxidative phosphorylation function. When SIRT2 was knocked down, compared with LEVs-sh-control, the up-regulated proteins in LEVs-sh-SIRT2 were mainly enriched in signaling pathways such as "Platinum drug resistance", "SNARE interactions in vesicular transport", "Autophagy" and "Phagosome", while the down-regulated proteins were mainly enriched in inflammation-related signaling pathways such as "Systemic lupuserythematosus", "Intestinal immune network for IgA production", "Inflammatorybowel disease" and "Cytokine-cytokine receptor interaction" ( Figure 6 D) These results indicate that after SIRT2 knockdown, HMC3 microglia-derived LEVs possess stronger phagocytosis induction and intrinsic characteristics of inflammation resistance.

[0048] Example 8: LEVs-sh-SIRT2 significantly improves neuroinflammation in the brain tissue of APP / PS1 mice

[0049] To further verify the improvement effect of LEVs-sh-SIRT2 on APP / PS1 mice, we performed further transcriptome sequencing analysis on the hippocampal tissues of mice in the AD LEVs-sh-SIRT2 group, AD PBS group, and WT PBS group. The RNA of the above hippocampal tissues was extracted using Trizol and other methods, and the obtained RNA OD 260 / OD280 ratio was between 1.8 and 2.0. The above RNA samples were placed in enzyme-free 1.5mL centrifuge tubes, embedded in dry ice, and sent to Zhongke Xinsheng Life Science for RNA sequencing according to the standard protocol provided in the commercial kit. After obtaining the raw sequencing data, the obtained Clean Reads were aligned with the specified genome using HISAT2 software, and the expression level (FPKM value) of each gene in each sample was calculated using featureCounts software, and then the differential expression analysis of genes was performed using DESeq2 software.

[0050] The experimental results are as follows Figure 7 As shown. The genes with significant differences among the groups were obtained through bioinformatics analysis ( Figure 7 AC). Further trend analysis of these differentially expressed genes was performed, and the genes that were upregulated in AD PBS and downregulated in AD LEVs-sh-SIRT2 group and WT PBS group were grouped as cluster 4 ( Figure 7 D) KEGG enrichment analysis showed that genes in cluster 4 were mainly enriched in inflammatory signaling pathways such as "NF-κB signaling pathway," "Cytokine-cytokine receptor interaction," "Complement and coagulation cascades," and "Toll-like receptor signaling pathway," indicating that intranasal treatment with LEVs-sh-SIRT2 can significantly improve neuroinflammation in the hippocampus of APP / PS1 transgenic mice.

Claims

1. A modified human HMC3 microglial cell line for the treatment of Alzheimer's disease (AD), named SIRT2-KDHMC3 cells, characterized by: The expression level of SIRT2 gene is reduced by more than 80%, and the expression level of SIRT2 is not less than 10%; the biological material preservation information of the cell line is as follows: the preservation number is: CCTCCNO: C2025155, the preservation unit is China Center for Type Culture Collection (CCTCC), and the preservation time is June 11, 2025.

2. The human HMC3 microglial cell line modified strain SIRT2-KD HMC3 described in claim 1 exhibits anti-inflammatory M2 microglial cell characteristics when used to prepare microvesicles (LEVs). The produced microvesicles are named LEVs-sh-SIRT2 and can be potentially used in the treatment and / or adjuvant treatment of AD patients.

3. The microvesicles (LEVs-sh-SIRT2) according to claim 2 are prepared as follows: the culture fluid of the SIRT2-KD HMC3 cell line with M2 phenotype characteristics is collected, and the microvesicles (LEVs-sh-SIRT2) are separated and collected by centrifugation. The particle size of the microvesicles suitable for therapeutic purposes is mainly distributed in the range of 200-400 nm, with an average particle size of 280±10 nm.

4. The LEVs according to claim 3, when developed as a drug for the treatment of AD, are suitable pharmaceutical preparations selected from the following dosage forms: tablets, capsules, injections (including lyophilized powder injections and injection solutions), oral liquid preparations, ointments, creams, aerosols, suppositories, and transdermal patches, or any combination thereof.

5. The LEVs according to claim 3, wherein the administration route for the treatment of AD is selected from the group consisting of oral administration, intravenous / muscular injection, subcutaneous implantation, nasal mucosal administration, and blood-brain barrier targeted administration.

Images