Modified immune cell, gRNA targeting Prdm12 gene and application

Abstract

The invention provides a modified immune cell, gRNA of a targeted Prdm12 gene and application, and relates to the technical field of biology. According to the modified immune cell provided by the invention, the killing effect of the immune cell on tumor cells is enhanced by down-regulating or eliminating the expression of the Prdm12 gene. The target sequence of the gRNA targeting the Prdm12 gene provided by the invention is shown as SEQ ID NO.10, or is a reverse complementary sequence of the gRNA, has the advantage of high editing efficiency, and opens up a new way for immunotherapy.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a modified immune cell, a gRNA targeting the Prdm12 gene, and applications thereof. Background Art The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0002] Immunotherapy has revolutionized cancer treatment, yet many patients experience poor responses, primarily due to functional inactivation of tumor-infiltrating lymphocytes (TILs). Epigenetic abnormalities are considered a major contributor to TIL dysfunction in the tumor microenvironment. Immune cells play a crucial role in the immune control of cancer, infectious diseases, and autoimmunity. For example, CD8+ T cells, a type of cytotoxic immune cell, exert anti-tumor immunity by directly killing tumor cells. Activation of antigen-specific CD8+ T cells is initiated by recognition of cognate antigens presented by major histocompatibility complex (MHC) class I (MHC-I) by the T cell receptor (TCR), leading to T cell proliferation, cytokine production, and target cell killing. T cell deficiencies can lead to recurrent infection or cancer, while overactivation of CD8+ T cells can lead to immunopathology and autoimmunity. CD8+ T cells have become a key focus of new cancer therapeutics. Approved immune checkpoint inhibitors enhance the anti-tumor response of CD8+ T cells by neutralizing CTLA-4 or PD-1 / PD-L1. These drugs are effective across a variety of oncology indications, either as monotherapy or in combination with other therapies.

[0003] Cell therapy using immune cells with chimeric antigen receptors (CARs) has demonstrated clinical success in treating tumors. However, a large proportion of patients remain unresponsive to currently approved therapies or experience undesirable side effects. The discovery of previously unknown genes that regulate immune cell function could open up different avenues for immunotherapy.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The first objective of the present invention is to provide a modified immune cell to further enhance its ability to kill tumors. The second objective of the present invention is to provide a method for preparing the modified immune cell and related products used in the preparation method to improve the efficiency of preparing the modified immune cell. The present invention also aims to provide the use of the modified immune cell and its preparation method in oncology medicine.

[0006] In order to solve the above technical problems, the present invention proposes the following technical solutions: In one aspect, the present invention provides a modified immune cell, wherein the expression of the Prdm12 gene in the immune cell is downregulated or eliminated.

[0007] In some embodiments, the immune cells are selected from T cells, B cells, natural killer cells, granulocytes, mast cells, tumor infiltrating lymphocytes, and / or peripheral blood mononuclear cells.

[0008] In some embodiments, the engineered immune cell is an immune cell that expresses a chimeric antigen receptor.

[0009] In some embodiments, the Prdm12 gene expression is downregulated or eliminated by administering one or more of the following substances to the immune cells: antisense RNA, siRNA, shRNA, CRISPR / Cas system, RNA editing system ADAR, RNA-guided nuclease, zinc finger protease, Mega-TAL nuclease and TALENs.

[0010] Optionally, the downregulation or elimination of Prdm12 gene expression is performed by administering at least one CRISPR / Cas gene editing system to the immune cells for gene editing.

[0011] In some embodiments, the CRISPR / Cas gene editing system comprises at least one gRNA targeting the Prdm12 gene, and the target sequence of the gRNA includes at least one of the sequence shown in SEQ ID NO.10 and the reverse complementary sequence of SEQ ID NO.10.

[0012] On the other hand, the present invention provides a gRNA targeting the Prdm12 gene, wherein the target sequence of the gRNA is the sequence shown in SEQ ID NO.10, or the reverse complementary sequence of SEQ ID NO.10.

[0013] In another aspect, the present invention provides a composition for editing the Prdm12 gene, comprising: (i) a gRNA or a polynucleotide encoding the gRNA, wherein the target sequence of the gRNA is the sequence shown in SEQ ID NO. 10, or the reverse complementary sequence of SEQ ID NO. 10; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0014] In another aspect, the present invention provides a method for preparing modified immune cells, comprising obtaining the complex, and introducing the complex into immune cells, thereby downregulating or eliminating the expression of the Prdm12 gene.

[0015] In another aspect, the present application provides a delivery system comprising an active ingredient and a delivery carrier, wherein the active ingredient comprises the gRNA, or the complex; and the delivery carrier comprises a liposome, a nanoparticle, a gene gun or an electroporation device.

[0016] In another aspect, the present application provides use of the engineered immune cell, or the gRNA, or the complex, or the preparation method, or the delivery system in the preparation of a medicament for treating a tumor.

[0017] In another aspect, the present application provides a medicament for treating a tumor, comprising the immune cell.

[0018] Compared with the prior art, the present application has the following beneficial effects: The engineered immune cell provided by the present application plays an important role in regulating the activation, differentiation dynamics, migration potential and cytotoxic function of T cells by down-regulating or eliminating the expression of Prdm12 gene. The expression of activation marker CD69 in Prdm12-deficient CD8+ T cells is significantly increased. The expression level of degranulation marker CD107a is significantly up-regulated. The expression of chemokine receptor CX3CR1, which is closely related to the cytotoxicity and migration ability of T cells, is also significantly increased, which indicates that Prdm12 deficiency enhances the activation and migration ability of T cells. In addition, Prdm12-deficient T cells show a significant expansion of CD62L+ CD44− TN (naive) cell population and CD62L+ CD44+ TCM (central memory) cell population, suggesting that Prdm12 is involved in maintaining the stemness characteristics of T cells. Prdm12 deficiency also significantly increases the proportion of CD127hi memory precursor cells (TMP) and reduces the proportion of KLRG1hi short-lived effector cells (TEFF), and the TEFF-like phenotype cells (TEFF-like: CD39+ Ly108−) in Prdm12-deficient CD8+ T cells are significantly increased, while the TEX-Pre (CD39− Ly108+) is significantly reduced, which indicates that Prdm12 deficiency enhances the effector function of T cells. Under co-culture conditions, the secretion ability of immune cell cytokines IL-2, IFN-γ and TNF-α is also enhanced, further enhancing the killing effect of immune cells. Down-regulating or eliminating Prdm12 gene in immune cells increases the number of immune cells infiltrating tumor tissues, and enhances the killing ability of tumor-infiltrating T cells. In vivo experiments show that down-regulating or eliminating Prdm12 gene in immune cells can more effectively inhibit the growth of tumors in test animals.

[0019] The present invention uses CRISPR / Cas technology to modify the Prdm12 gene of immune cells, selectively knocking out the Prdm12 gene, and thereby obtaining immune cells that can effectively inhibit tumors.

[0020] The gRNA targeting the Prdm12 gene provided by the present invention has good targeting specificity, can effectively edit the Prdm12 gene, and can effectively knock down the expression of the Prdm12 gene. The mutant genotype carried by the constructed immune cells is highly stable and heritable.

[0021] The modified immune cell preparation method provided by the present invention is simple, effective, and low-cost. The prepared immune cells have the advantages of sustained and efficient tumor suppression effect and good safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 It was shown that CD8+ T cells from Prdm12-deficient mice exhibited significant immunotherapeutic potential; Figure 2 Shown are the effects of Prdm12 deficiency on the immunological characteristics of mouse CD8+ T cells. DETAILED DESCRIPTION

[0024] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0025] the term Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly used in the field to which the present invention belongs. For the purpose of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural form, and vice versa.

[0026] Unless the context clearly dictates otherwise, as used herein, the expressions "a" and "an" include plural references. For example, reference to "a cell" includes a plurality of such cells and equivalents thereof known to those skilled in the art, and so forth.

[0027] As used herein, the term "about" means ±20% of the number that it precedes. In some embodiments, the term "about" means ±10% of the number that it precedes. In some embodiments, the term "about" means ±5% of the number that it precedes.

[0028] The terms "comprising" or "including" or "containing" as used herein can be open-ended or closed-ended. In other words, the terms also include "consisting essentially of" or "consisting of."

[0029] "Optional" or "optionally" as used herein means that the subsequent described event or circumstance can or can not occur.

[0030] "and / or" as used herein means that one or the other or both of the situations described can occur, for example, A and / or B includes (A and B) and (A or B).

[0031] A "chimeric antigen receptor (CAR)" as used herein is a fusion protein comprising an extracellular domain capable of binding an antigen, a transmembrane domain derived from different polypeptides from the extracellular domain, and at least one intracellular domain. An "extracellular domain capable of binding an antigen" means any oligopeptide or polypeptide capable of binding to an antigen, and an "intracellular domain" means any oligopeptide or polypeptide known to be a domain that transmits a signal to activate or inhibit a biological process within a cell. A "domain" means a region of a polypeptide that is independent of other regions and folds into a specific structure.

[0032] The term "polynucleotide" as used herein refers to a polymeric form of nucleotides of any length, and includes ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-, double- or multi-stranded DNA or RNA, genomic DNA, cDNA, a DNA-RNA hybrid, or a polymer comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. A polynucleotide can optionally be a coding or non-coding sense or antisense strand. A polynucleotide can be naturally occurring, synthetic, or recombinant or any combination thereof.

[0033] Herein, "Prdm12" is a transcriptional regulator that belongs to the PRDI-BF1 homeodomain protein family, a subset of Kruppel-like zinc finger proteins. It plays a role in diverse biological processes, including neurogenesis, pain perception, tumorigenesis, and cellular metabolism. In humans, Prdm12 is crucial for pain perception, as pathogenic mutations result in a congenital inability to perceive pain. Furthermore, Prdm12 is upregulated in a variety of solid tumors, such as colon, breast, kidney, lung, liver, thyroid, ovarian, and prostate cancers, suggesting its potential as a tumor marker. However, the role of Prdm12 in limiting or enhancing the immunotherapeutic potential of adoptive cell transfer (ACT) remains unclear.

[0034] Modified immune cells In one aspect, the present invention provides a modified immune cell in which the expression of the Prdm12 gene is downregulated or eliminated.

[0035] In some embodiments, the immune cell is selected from T cells, B cells, natural killer cells, granulocytes, mast cells, macrophages, tumor infiltrating lymphocytes, and / or peripheral blood mononuclear cells.

[0036] In some embodiments, the Prdm12 gene expression is downregulated or eliminated by administering one or more of the following substances to the immune cells: antisense RNA, siRNA, shRNA, CRISPR / Cas system, RNA editing system ADAR, RNA-guided nuclease, zinc finger protease, Mega-TAL nuclease and TALENs.

[0037] In some embodiments, the downregulation or elimination of Prdm12 gene expression is achieved by gene editing using at least one CRISPR / Cas gene editing system. The CRISPR / Cas9 system can deliver a Cas9 protein and sgRNA complex to primary mouse cells in vitro to cleave double-stranded DNA, effectively knocking out the target gene.

[0038] In some embodiments, the immune cells are selected from T cells, B cells, natural killer (NK) cells, granulocytes, specifically neutrophils, eosinophils and / or basophils, mast cells, tumor infiltrating (TIL) lymphocytes and / or peripheral blood mononuclear cells.

[0039] In some embodiments, sources of the immune cells include allogeneic and autologous sources.

[0040] In some embodiments, the immune cells are of human origin.

[0041] In some embodiments, the immune cells are selected from CD8+ T cells.

[0042] In some embodiments, the immune cell is an immune cell expressing CAR (chimeric antigen receptor), preferably a CAR-expressing T cell (CAR-T) cell, and more preferably a CAR-expressing CD8+ T cell.

[0043] The present invention does not limit the structure of the chimeric antigen receptor in the immune cell expressing CAR. For the extracellular domain, transmembrane domain and intracellular domain of the chimeric antigen receptor capable of binding to the antigen, those skilled in the art can select them according to the methods described in well-known textbooks, references, process manuals, product descriptions and standard documents, and the present invention does not impose any restrictions on this.

[0044] An exemplary CAR structure is as follows: The extracellular domain consists of a single-chain variable fragment (scFv) that recognizes and binds to an antigen and a hinge region. The scFv determines the specificity and function of the CAR-expressing immune cell. The hinge region connects the scFv to the transmembrane domain. Exemplary hinge regions are derived from the hinge of IgG or the extracellular region of CD8α / CD28. The transmembrane domain connects the extracellular domain of the CAR to the intracellular signaling domain. Exemplary transmembrane domains are derived from CD4, CD8, CD28, and CD3ζ, or their derivatives. The intracellular domain contains a signaling domain or is composed of a costimulatory domain and a signaling domain. Exemplary costimulatory domains are derived from the CD28 receptor family (CD28, ICOS) or the tumor necrosis factor receptor family (4-1BB, OX40, CD27). Exemplary signaling domains are the T cell receptor (TCR) / CD3ζ chain or the immunoglobulin Fc receptor (FcεRIγ) chain.

[0045] In some embodiments, the immune cell targets expressing CARs are but are not limited to PSMA, CD19, CD20, CD22, CD23, CD30, CD33, CD38, CD44v6, CD56, CD70, CD117, CD123, CD138, CD319 (CS1, SLAMF7), CD371 (CLL-1), BCMA, BAFF-R, FLT-3, FRβ, IL1RAP, LMP1, ROR1, PSMA, FAP, EGFRvⅢ, CEA, CD171, GD2, Glypican-3, HER2, IL-13, Claudin, FRα, L1-CAM, CAIX, CD56, CD70, NKG2D, AFP, AXL, c-MET, DLL-3, DR5, EpHA2, gp100, MAGE A1, MAGE A3, MAGE A4, MUC1, CD25, PD-1, PD-L1, PD-L2, CTLA-4, immunoglobulin receptor (KIR), LAG-3, TIM-3, 4-1BB, 4-1BBL, GITR, CD40, CD40L, OX40, OX40L, CXCR2, B7-H3, B7-H4, BTLA, HVEM, CD28, A2aR, CD27, TCRICOS, CD80, CD86, ICOS-L, Gal-9, VISTA, CD137, CD155, CD266, PVR, PVR-2, CD47, CD160, NT5E, CD96, and TNFRSF18.

[0046] In some embodiments, the CAR-expressing immune cell targets prostate-specific membrane antigen, and its chimeric antigen receptor contains a PSMA (prostrate specific membrane antigen) binding domain (PSMA-CAR).

[0047] CRISPR-Cas system targeting the Prdm12 gene In one aspect, the present invention provides a CRISPR / Cas gene editing system targeting the Prdm12 gene, comprising at least one guide RNA (gRNA) targeting the Prdm12 gene.

[0048] The guide RNA of the present invention may include a single-stranded guide RNA (sgRNA) or a double-stranded guide RNA consisting of crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). In some embodiments, the guide RNA is a double-stranded structure consisting of a crRNA and a tracrRNA. The crRNA generally contains a guide sequence and a tracr partner sequence, and the tracrRNA generally contains a tracr sequence.

[0049] In some embodiments, the guide RNA can be a single-stranded molecule that can include a guide sequence, a tracr partner sequence, and a tracr sequence. This single-stranded molecule is also referred to as a chimeric single-stranded guide RNA (sgRNA). When the tracr sequence and the tracr partner sequence are contained in a single transcript, hybridization between the two produces a transcript with a secondary structure (such as a hairpin). The sequence used in the hairpin structure can be a loop-forming sequence, for example, a sequence that can be four nucleotides in length. For example, the sequence used in the hairpin structure can have a sequence of the sequence GAAA. Longer or shorter loop sequences can also be used, such as alternative sequences. In some cases, these sequences can include triplets (e.g., AAA), as well as other nucleotides (e.g., C or G). Examples of loop-forming sequences can include CAAA and AAAG. In some cases, the transcript or transcribed polynucleotide sequence can have at least two or more hairpins. In some specific cases, the transcript can have two, three, four, or five hairpins. In other cases, the transcript can have up to five hairpins.

[0050] In some embodiments, the tracrRNA sequence is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 9).

[0051] In some embodiments, the target sequence of the gRNA includes at least one of the sequence shown in SEQ ID NO.10 and the reverse complementary sequence of SEQ ID NO.10.

[0052] Composition for editing the Prdm12 gene In one aspect, the present invention provides a composition for editing the Prdm12 gene, comprising: (i) a gRNA or a polynucleotide encoding the gRNA, wherein the target sequence of the gRNA is the sequence shown in SEQ ID NO. 10, or the reverse complementary sequence of SEQ ID NO. 10; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

[0053] In some embodiments, the Cas nuclease refers to a Cas nuclease that can bind to a target sequence, or cut or nick a target sequence, or mutate a target sequence. The Cas nuclease includes but is not limited to a natural Cas nuclease or a polypeptide or complex containing the main functional domain of a Cas nuclease; or a mutated Cas nuclease or polypeptide; or a fusion protein containing a Cas nuclease or a Cas nuclease functional domain fused with other functional domains. The Cas nuclease includes but is not limited to Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9; or a protein, polypeptide or complex obtained by mutating the above Cas nucleases and / or fusion with other functional domains. In some embodiments, examples of the functional domain that can be fused to the Cas nuclease include but are not limited to an epitope tag, a reporter gene, and a protein domain having one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity and nucleic acid binding activity.

[0054] Immune cell preparation In one aspect, the present invention also provides a method for preparing the above-mentioned modified immune cells, comprising obtaining the above-mentioned complex for editing the Prdm12 gene, introducing the complex into immune cells, thereby downregulating or eliminating the expression of the Prdm12 gene. In the preparation method, the above-mentioned complex for editing the Prdm12 gene can be introduced into immune cells by any conventional method known in the art, such as but not limited to liposome introduction, nanoparticle delivery, vector, transfection, heat shock, electrofection, transduction, gene gun or microinjection. In an optional embodiment, the above-mentioned composition for editing the Prdm12 gene includes an RNP complex formed by Cas nuclease and gRNA, which is introduced into the immune cells to be edited by electrofection.

[0055] deliver In one aspect, the present invention also provides a delivery system, comprising an active ingredient and a delivery vector, wherein the active ingredient comprises the above-mentioned gRNA targeting the Prdm12 gene, or the above-mentioned complex for editing the Prdm12 gene, and the delivery vector comprises a liposome, a nanoparticle, a gene gun or an electroporation device.

[0056] Pharmaceutical compositions, methods and uses In one aspect, the present invention also provides a drug for treating tumors, comprising the modified immune cells described above. In an optional embodiment, the drug for treating tumors further comprises a pharmaceutically acceptable excipient. The excipient includes, but is not limited to, one or a combination of carriers, diluents, buffers, protective agents, stabilizers, adsorbents, matrices, and excipients.

[0057] On the other hand, the present invention also provides the above-mentioned modified immune cells, or the above-mentioned gRNA targeting the Prdm12 gene, or the above-mentioned composition for editing the Prdm12 gene, or the preparation method of the above-mentioned modified immune cells, or the use of the above-mentioned delivery system in the preparation of drugs for treating tumors.

[0058] The concept of the present invention is to increase the lethality of immune cells by inhibiting Prdm12 gene expression, so the types of tumors that immune cells can kill are all objects that can be treated by the drugs for treating tumors described herein. The implementation of the drugs for treating tumors in any of the above aspects, for example, but not limited to blood tumors, solid tumors or a combination thereof. Blood tumors, for example, but not limited to acute myeloid leukemia (AML), multiple myeloma (MM), chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), diffuse large B-cell lymphoma (DLBCL), or a combination thereof. Solid tumors, for example, but not limited to prostate cancer, liver cancer, head and neck cancer, melanoma, non-Hodgkin's lymphoma, bladder cancer, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, osteosarcoma, bile duct cancer, ovarian cancer, gastric cancer, bladder cancer, meningioma, pancreatic cancer, multiple squamous cell tumors, esophageal cancer, small cell lung cancer, colorectal cancer, breast cancer, medulloblastoma, breast cancer, or a combination thereof. When the engineered immune cells are CAR-expressing immune cells, the drugs used to treat tumors are more suitable for tumor types with corresponding tumor markers that can be bound by the antigen-binding domain of the chimeric antigen receptor in the immune cells. For example, in some embodiments, the engineered immune cells are cells that express a chimeric antigen receptor that binds to PSMA, which can be used to prepare drugs for treating prostate tumors.

[0059] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0060] Examples Example 1: CD8+ T cells from Prdm12-deficient mice exhibit significant immunotherapy potential 1. Targeting sgRNA design To study the role of Prdm12 in immunotherapy, this example designed an sgRNA targeting Prdm12. The sgRNA targeting sequence was designed based on the Prdm12 gene, the PD-1 gene (positive control group), and the non-targeting control (NTC). The tracrRNA sequence is as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU (SEQ ID NO. 9).

[0061] The sgRNA structure is 5'-targeting sequence+tracrRNA sequence-3'.

[0062] Table 1 sgRNA targeting sequences

[0063] 2. Obtaining mouse CD8+ T cells 1) Construction of GFP-OVA cell line B16-F10 mouse melanoma cells were transduced with a lentivirus expressing GFP-OVA. To isolate monoclonal cell populations by limiting dilution, three days after transduction, transduced B16-OVA cells were diluted to 10 cells / mL and cultured individually in 96-well plates, with 100 µL of cell suspension added to each well. Two weeks later, GFP-positive B16-F10-OVA cell clones were identified by fluorescence microscopy. GFP-positive B16-OVA clones were assessed for OVA expression using an anti-mouse SIINFEKL:H-2Kb antibody (Porgador et al., 1997). Different GFP-positive B16-OVA clones were selected based on their OVA expression levels.

[0064] 2) Construction of OTI:Cas9 mice Rosa26-Cas9 transgenic mice were crossed with OT-I mice to construct mice expressing OTI:Cas9. Mice expressing OTI:Cas9 were screened by PCR using the following primers (Table 1).

[0065] Table 2 Primers for screening OTI:Cas9 expression

[0066] 3) Isolation and culture of mouse CD8+ T cells Spleens taken from OT-I:Cas9 mice were placed in pre-chilled PBS solution containing 2% FBS (FBS purchased from Sigma, PBS purchased from GIBCO). The spleens were ground through a 100 pm cell strainer to make a single cell suspension. Subsequently, the cells were treated with ACK lysis buffer (Lonza) for 5 minutes at room temperature to lyse the red blood cells, after which the cells were washed with 2% FBS. The lymphocytes were further filtered through a 40 pm strainer and resuspended using MACS buffer (PBS containing 0.5% BSA and 2 mM EDTA). Next, the naive CD8+ T cells were isolated using the Mouse CD8 Naive T Cell Isolation Kit (BioLegend). Finally, the cells were resuspended in cRPMI-1640 medium at a final concentration of 1 x 10 6 cells / mL. Among them, the cRPMI-1640 medium formula is: RPMI-1640 medium, added with 10% FBS, 2 mM L-glutamine, 100 U / mL Pen / Strep and 49 nM β-mercaptoethanol. In addition, for in vivo experiments, 2 ng / mL IL-2, 2.5 ng / mL IL-7, 50 ng / mL IL-15 and 1 pg / mL anti-CD28 antibody were additionally added to the medium; while for in vitro experiments, 2 ng / mL IL-2, 2 ng / mL IL-12p70 and 1 pg / mL anti-CD28 antibody were added. All cells were cultured in culture plates pre-coated with 5 pg / mL anti-CD3 antibody.

[0067] 3. Gene editing in CD8+ T cells Each targeting sgRNA (sgPrdm12 / sgNTC) was electroporated into Cas9:OT-I T cells.

[0068] After centrifugation, the cells were resuspended in P3 primary cell nuclear infection solution (Lonza, #V4XP-3032) at a concentration of 1 x 10 6 cells per 20 pL. The cell-sgRNA (i.e. 300 pmol sgRNA was added to each 20 pL system) mixture was then transferred to a 96-well electroporation cuvette plate, and nuclear infection was performed using the EH115 program. After electroporation, 100 pL of preheated complete RPMI-1640 medium was immediately added to each well, and the cells were then incubated at 37°C for 2 minutes. Subsequently, the cells were transferred to a culture container containing 2 ng / ml interleukin-2 (IL-2) and 2 ng / ml interleukin-12p70, and the density was adjusted to 1 x 10 6cells / mL. Cells were cultured for three days after electroporation to allow sgRNA expression. Thereafter, genomic DNA was extracted from sgNTC- and sgPrdm12-modified CD8+ T cells, followed by PCR amplification and Sanger sequencing, and qPCR and Western blot experiments were performed to assess the efficiency of target gene editing ( Figure 1 B and C).

[0069] PCR detection was performed using upstream and downstream primers Prdm12 check-F (SEQ ID NO. 13) and Prdm12 check-R (SEQ ID NO. 14) designed based on the corresponding editing positions in the genome. Sanger sequencing of the PCR product and analysis of the editing efficiency revealed an editing efficiency of 96%.

[0070] Effects of Prdm12 gene knockout on T cell anti-tumor and immune reconstruction First, the expression level of Prdm12 mRNA in Prdm12-KO OT-I:Cas9 T cells was quantitatively detected by qPCR ( Figure 1 (B) qPCR primers are shown in the following table: Table 3 qPCR primers

[0071] Its protein expression was assessed by Western blotting, confirming that Prdm12 was successfully downregulated ( Figure 1 Subsequently, the edited OT-I:Cas9 T cells were adoptively transferred into mice bearing B16-OVA tumors ( Figure 1 Middle A).

[0072] Example 2 Evaluation of the Effect of Prdm12 KO OT-I:Cas9 CD8+ T Cells on Mouse Tumors 1. Adaptive transfer of Prdm12 KO OT-I:Cas9 CD8+ T cells Naive OT-I:Cas9 CD8 T cells were cultured for three days in the presence of plate-bound anti-CD3 (5 μg / mL) and soluble anti-CD28 (1 μg / mL). sgPrdm12 or sgNTC were then electroporated into the cells as in Example 1 and cultured at 37°C for another three days. On the sixth day of culture, T cells were harvested, washed with ice-cold PBS, and resuspended to 5 × 10 7 cells / mL. Rag1 - / - A total of 5 × 10 6cells. Tumor size was measured with calipers every 2 to 3 days after T cell injection. Tumor volume was calculated using the formula: length × width × width × 0.5. After the experiment, mice were humanely euthanized, and the tumors and spleens were isolated. Tumor weights were recorded, and it was found that Prdm12-KO OT-I;Cas9 CD8+ T cells significantly inhibited tumor growth compared to mice treated with control (non-targeting control, NTC) T cells ( Figure 1 D and E).

[0073] 2. Tumor transplantation and tissue processing Rag1- / - mice were injected subcutaneously with 5×10 6 Freshly isolated naive OT-I;Cas9 CD8+ T cells were plated onto plates pretreated with 5 μg / mL anti-CD3ε in cRPMI supplemented with 2 ng / mL IL-2, 2.5 ng / mL IL-7, 50 ng / mL IL-15, and 1 μg / mL anti-CD28. Cells were electroporated with sgRNAs and cultured for 3 days. 5×10 6 Electroporated T cells were intravenously injected into Rag1- / - tumor-bearing mice (T cell:naive cancer cell ratio = 1:1). Tumor volume and weight were measured at the indicated time points. After the experiment, spleens and tumors were isolated.

[0074] Spleen processing: Gently mash the spleen in PBS containing 2% FBS and filter through a 70 μm cell strainer to remove large tissue debris and obtain a single-cell suspension. Red blood cells are removed using red blood cell lysis buffer. Lymphocytes are collected by washing and centrifugation.

[0075] Tumor tissue processing: Tumor tissue was collected and broken into smaller fragments, then digested with 1 mg / mL collagenase IV (Yeasen) at 37°C for 60 minutes. The cell suspension was passed through a 70 μm filter to remove large cell clumps, rinsed twice with PBS, and resuspended in RPMI-1640 medium. For FACS analysis, single-cell suspensions were stained with anti-mouse CD3 and CD8 antibodies on ice for 30 minutes. Samples were then rinsed twice with PBS containing 2% FBS. FACS analysis was performed using a flow cytometer (BD Biosciences).

[0076] 3. Flow cytometry and analysis Surface protein staining: Spleen cells or tumor cell suspensions were stained with anti-mouse CD8a (BioLegend, #100706) in staining buffer (0.1% BSA in PBS) for 30 minutes. After staining, cells were washed and resuspended in FACS buffer before data acquisition. FACS analysis using a flow cytometer (BD) revealed an increase in the number of tumor-infiltrating T cells (TILs), which was consistent with the increase in the number of CD8+ T cells in the spleen ( Figure 1 These data indicate that Prdm12 gene deletion enhances the anti-tumor efficacy and immune reconstitution capacity of CD8+ T cells in vivo.

[0077] Example 3 Effects of Prdm12 deficiency on the immunological characteristics of mouse CD8+ T cells To investigate the role of Prdm12 deficiency in CD8+ T-mediated anti-tumor immune responses, this example evaluated the immunological characteristics of CD8+ T cells after Prdm12 depletion. Prdm12 KO CD8+ T cells were surface stained using the surface protein staining protocol described in Example 2. On-chip analysis revealed that Prdm12-deficient CD8+ T cells expressed higher levels of the activation marker CD69 ( Figure 2 When co-cultured with syngeneic B16-OVA cells, Prdm12-knockout CD8+ T cells showed a significant increase in degranulation, as evidenced by enhanced surface expression of CD107a ( Figure 2 In the middle B). It was also observed that the expression of chemokine CX3CR1, which is associated with T cell cytotoxicity and migration function, was significantly enhanced in Prdm12-knockout CD8+ T cells ( Figure 2 Middle C) To further investigate the regulation of Prdm12 on the differentiation state of CD8+ T cells, we found that the loss of Prdm12 increased the proportion of CD127hi memory precursor (TMP) cells and decreased the frequency of KLRG1hi short-term effector cells (TEFF) ( Figure 2 In addition, the proportion of CD39+Ly108- cytotoxic potential cells in Prdm12-knockout CD8+ T cells was significantly increased ( Figure 2(F and G). Antibodies used for staining were from BioLegend. Antibodies used included anti-mouse CD69 (Cat#104508), anti-mouse CD107a (Cat#121611), anti-mouse Cx3CR1 (Cat#149047), anti-mouse CD39 (Cat#143805), anti-mouse CD108 (Cat#134609), anti-mouse / human KLRG1 (Cat#138429), and anti-mouse CD127 (Cat#135013). Data acquisition and analysis: Samples were analyzed using a Fortessa LSR II flow cytometer (Becton Dickinson), and data were processed using FlowJo X software. Statistical analysis was performed using an unpaired two-tailed t-test. Significance levels were defined as *p < 0.05, **p < 0.01, and ***p < 0.001. Data are presented as mean ± SEM.

[0078] The ability of Prdm12-deficient CD8+ T cells to produce cytokines was also evaluated. In this example, intracellular cytokine staining (ICS) was performed. Prdm12 KO OT1-CD8+ T cells or control (CTRL) OT-1-CD8+ T cells were collected, washed, and then fixed and permeabilized using the Cytofix / Cytoperm Plus Fixation / Permeabilization Kit (BD, Cat#554714) according to the manufacturer's instructions. Intracellular cytokine (IFN-γ, TNF-α, or IL-2) staining was performed for 30 minutes, followed by washing twice with Cytoperm / WashBuffer. Finally, the cells were resuspended in MACS buffer before FACS analysis. On-machine analysis found that under stimulation with 1μg / mL anti-CD3 / 28, Prdm12-deficient CD8+ T cells produced higher levels of effector cytokines IL-2, IFN-γ, and TNF-α ( Figure 2 (H and I). These data confirm that Prdm12 gene expression is involved in T cell activation and negatively regulates the effector function of CD8+ T cells, thus establishing it as a regulator of CD8+ T cell activity. Antibodies (BioLegend) were used for staining, including anti-mouse IL-2 (BioLegend, Cat#503821), anti-mouse TNFα (BioLegend, Cat#506303), and anti-mouse IFNγ (BioLegend, Cat#505829). Data acquisition and analysis: Samples were analyzed using a Fortessa LSR II flow cytometer (Becton Dickinson), and data were processed using FlowJo X software. Statistical analysis was performed using an unpaired two-tailed t-test. Significance levels are defined as *p < 0.05, **p < 0.01, and ***p < 0.001. Data are presented as mean ± SEM.

[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that the technical solutions described in the foregoing embodiments can still be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A modified immune cell, characterized in that: The Prdm12 gene expression of the immune cells is downregulated or eliminated.

2. The modified immune cell according to claim 1, characterized in that The immune cells are selected from T cells, B cells, natural killer cells, granulocytes, mast cells, tumor infiltrating lymphocytes and / or peripheral blood mononuclear cells; Optionally, the engineered immune cell is an immune cell expressing a chimeric antigen receptor.

3. The immune cell according to claim 1 or 2, characterized in that The Prdm12 gene expression is downregulated or eliminated by administering one or more of the following substances to the immune cells: antisense RNA, siRNA, shRNA, CRISPR / Cas system, RNA editing system ADAR, RNA-guided nuclease, zinc finger protease, Mega-TAL nuclease and TALENs; Optionally, the downregulation or elimination of Prdm12 gene expression is performed by administering at least one CRISPR / Cas gene editing system to the immune cells for gene editing.

4. The immune cell according to claim 3, characterized in that The CRISPR / Cas gene editing system comprises at least one gRNA targeting the Prdm12 gene, and the target sequence of the gRNA includes at least one of the sequence shown in SEQ ID NO.10 and the reverse complementary sequence of SEQ ID NO.

10.

5. A gRNA targeting the Prdm12 gene, characterized in that The target sequence of the gRNA is the sequence shown in SEQ ID NO.10, or the reverse complementary sequence of SEQ ID NO.

10.

6. A composition for editing the Prdm12 gene, characterized in that Include: (i) a gRNA or a polynucleotide encoding the gRNA, wherein the target sequence of the gRNA is the sequence shown in SEQ ID NO. 10, or the reverse complementary sequence of SEQ ID NO. 10; (ii) Cas nuclease or a polynucleotide encoding a Cas nuclease.

7. The method for preparing the modified immune cells according to any one of claims 1 to 4, characterized in that: The method comprises obtaining the composition according to claim 6, and introducing the composition into immune cells, thereby downregulating or eliminating the expression of the Prdm12 gene.

8. A delivery system, characterized in that The delivery system comprises an active ingredient and a delivery vector, wherein the active ingredient comprises the gRNA according to claim 5 or the composition according to claim 6; the delivery vector comprises a liposome, a nanoparticle, a gene gun or an electroporation device.

9. Use of the modified immune cell according to any one of claims 1 to 4, or the gRNA according to claim 5, or the composition according to claim 6, or the preparation method according to claim 7, or the delivery system according to claim 8 in the preparation of a drug for treating tumors.

10. A drug for treating tumors, characterized in that: The immune cell comprises the immune cell according to any one of claims 1 to 4.

Images