Application of OsDrAp1 gene in regulating axillary bud germination of indica rice

Abstract

The application discloses application of an OsDrAp1 gene in regulating axillary bud germination of rices of the same stem, and belongs to the technical field of biotechnology.The nucleotide sequence of the OsDrAp1 gene is shown as SEQ ID NO.1, the germination of the regenerated buds of knockout and overexpression materials of the OsDrAp1 is observed, it is found that the germination rate of the knockout plants is significantly improved, and the germination rate of the overexpression materials is significantly reduced, it is proved that the OsDrAp1 negatively regulates the axillary bud germination of the rices of the same stem, and the OsDrAp1 can be used in breeding research of the rices of the same stem.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to application of an OsDrAp1 gene in regulating axillary bud germination of ratooning rice. BACKGROUND

[0002] Rice is one of the most important food crops in China, and ensuring stable rice yield is of great significance to China's agricultural production. Ratooning rice refers to a planting mode in which, after the first season of rice is harvested, the surviving dormant buds on the rice stem are used to germinate into ratooning tillers under suitable water, temperature, light and nutrient conditions, and then the ratooning tillers are used to produce a second season of rice. Ratooning rice has the advantages of short growth period, high daily yield and high rice quality, and is suitable for planting in rice-growing areas where there is surplus light and temperature resources for one season of rice but insufficient resources for two seasons of rice. The area suitable for planting ratooning rice in China is more than 18 million hectares, and if ratooning rice is planted in the areas suitable for ratooning rice in China, the total rice yield can be increased by about 8%. Therefore, it is of great strategic significance to promote ratooning rice in production. At present, the research on the molecular mechanism of ratooning rice is still in the preliminary exploration stage. Previous studies have reported some QTL sites affecting the ratooning ability of rice, but only two genes have been located, which seriously affects the research and application of ratooning rice. Therefore, it is urgent to find genes related to ratooning rice for ratooning rice breeding.

[0003] DrAp1 (down-regulator associated protein) belongs to the NF-Y transcription factor family, and the DrAp1 / Dr1 complex widely exists in various organisms, including humans, yeast, bread mold, fruit flies, Arabidopsis, rice and wheat. The family of proteins is widely involved in the interaction between plants and microorganisms, root development and stress response. DrAp1 and Dr1 can form a heterodimer, and DrAp1 / Dr1 usually binds to downstream TATA-box binding protein (TBP) to form a larger complex after forming a heterodimer, thereby inhibiting the transcription of promoters with TATA-box genes. SUMMARY

[0004] One of the purposes of the present application is to provide application of an OsDrAp1 gene in regulating axillary bud germination of ratooning rice, wherein the nucleotide sequence of the OsDrAp1 gene is shown as SEQ ID NO. 1.

[0005] In an embodiment of the present application, the regulation is to knock out the above-mentioned OsDrAp1 gene in rice.

[0006] The second purpose of the present application is to provide application of a protein encoded by an OsDrAp1 gene in regulating axillary bud germination of ratooning rice, wherein the nucleotide sequence of the OsDrAp1 gene is shown as SEQ ID NO. 1.

[0007] The third objective of this invention is to provide a method for regulating the germination of axillary buds in rice. When it is necessary to reduce the germination rate of rice axillary buds, the OsDrAp1 gene in rice is overexpressed; when it is necessary to increase the germination rate of rice axillary buds, the OsDrAp1 gene in rice is silenced or knocked out. The nucleotide sequence of the OsDrAp1 gene is shown in SEQ ID NO.1.

[0008] The fourth objective of this invention is to provide the application of the OsDrAp1 gene in rice breeding, and to obtain rice lines with faster axillary bud germination rates by screening rice plants with low expression of the OsDrAp1 gene. The nucleotide sequence of the OsDrAp1 gene is shown in SEQ ID NO.1.

[0009] The fifth objective of this invention is to provide the application of the protein encoded by the OsDrAp1 gene in rice breeding. By screening rice plants with high expression levels of the protein encoded by the OsDrAp1 gene, rice lines with slower axillary bud germination rates can be obtained. The nucleotide sequence of the OsDrAp1 gene is shown in SEQ ID NO.1.

[0010] The fifth objective of this invention is to provide a method for obtaining improved rice with a faster axillary bud germination rate, which includes knocking out the OsDrAp1 gene in rice.

[0011] In one embodiment of the present invention, the method includes the following steps: knocking out the OsDrAp1 gene in rice using a CRISPR / Cas9 genome editing system.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] This invention cloned an NF-YC transcription factor, OsDrAp1, that affects axillary bud germination in ratooning rice through genome-wide association analysis. Using Zhonghua 11 as a case study, this invention constructed OsDrAp1 transgenic material via Agrobacterium-mediated transformation. Phenotypic observation revealed that OsDrAp1 affects the axillary bud germination rate in ratooning rice, thus determining its impact on the growth and development of axillary buds in ratooning rice. Therefore, it can be used for ratooning rice breeding research. Attached Figure Description

[0014] Figure 1 This is a correlation analysis of the sheathing rate of regenerated buds at multiple locations over many years in Example 1. AC represents the GWAS results of the sheathing rate of regenerated buds 14 days after harvest in Sanya, Fuzhou, and Sanya in 2021. The left side is the Manhattan plot, and the right side is the QQ plot. The red arrow is qRBSR11.

[0015] Figure 2 This study analyzes the phenotypic differences of different haplotypes of the five genes in Example 1.

[0016] Figure 3 The results show the observation of axillary bud germination and the statistical results of the sheath emergence rate of the regenerated buds in the OsDrAp1 transgenic material in Example 1. Detailed Implementation

[0017] Example 1

[0018] 1. Genome-wide association analysis yielded QTL loci for regenerated bud sheath emergence rate. qRBSR11

[0019] In Sanya, Hainan and Fuzhou, Fujian, multi-year, multi-location statistical analysis was conducted on the regenerated shoot sheathing rate of 383 rice germplasm resources that could be harvested on time. Genotyping was performed using SNP markers provided in Rice 3K (https: / / snp-seek.irri.org / ), yielding 584,145 SNP markers for population structure and genome-wide association analysis. Bayesian model analysis of population structure revealed that Δk was lowest when K=13, indicating that the population could be divided into 13 subpopulations. Association analysis was performed based on the regenerated shoot sheathing rate phenotypic data combined with molecular data. Figure 1 A total of 499 sites with significant effect values ​​above 4 were found; among them, a stable QTL site, qRBSR11 (Ratoon Buds Sprouting Rate), was detected at a physical location of 20 Mb on chromosome 11 for three consecutive seasons, with -log10(P) values ​​of 5.12, 3.69 and 4.91, respectively.

[0020] 2. qRBSR11 The genes that affect regeneration within the locus are OsDrAp1

[0021] According to predictions from the MSU database qRBSR11 The mapping region contained 21 functionally annotated genes. Rice 3K data were used to annotate the variant types of these 21 genes, revealing 9 missense variants. Since the axillary buds of ratooned rice belong to the shoot apical meristem, RNA-seq data from the ePLANT website were used to analyze the expression levels of these 9 genes in the shoot apical meristem. Five ORFs were found to be highly expressed in the shoot apical meristem, namely… ORF9 , ORF11 , ORF14 , ORF16 , ORF18 Further analysis of 5 ORF Phenotypic differences among different haplotypes in a population were found. ORF11 There were significant differences in the sheath emergence rate phenotypes of different haplotypes and their corresponding regenerated shoots. Figure 2 Therefore, ORF11 ( OsDrAp1was designated as a candidate gene, which encodes a transcription factor of the NF-YC family.

[0022] 3. Functional verification of OsDrAp1 transgenic

[0023] The nucleotide sequence of OsDrAp1 (SEQ ID NO.1) is as follows:

[0024] ATGAGGAAGAAGCTGGGCACCCGCTTCCCCGCGGCACGGATCAAAAAGATCATGCAGGCTGATGAGGACGTTGGCAAGATTGCACTAGCTGTACCTGTTTTAGTATCGAGGGCCCTTGAATTGTTTTTGCAAGATTTAATTGACCGAACTTACGAAATTACACTGCAAAGTGGTGCAAAGACATTGAATTCCTTCCACCTAAAGCAATGTGTGAGGAGGTACAGTTCTTTTGACTTCCTAACTGAGGTTGTCAACAAGGTACCGGACCTCGGTGGCGCTGACTCATGTGGAGATGATAGAGCATTACCCAGAAGAAGAAAAGCCTTGCCAAATGGAAGTGACCCAGAGAATGAGGAATCTCGATCAAGCAAAATGGCCGTAAGAAGTGCAAATATCAGTCCCAGAGGACGTGGGAGAGGTCGAGGTAGAGGGCGAGGACGACCACCCACCAAGCGGAAGGAAGTTGGTTATGTACAATTTGAGGATGAGAGCAGCATGTTTGCTGATCAGGGCGAAGCCTTACCAGGAGAGGAGACGGTTCCAGAGACCATCCATGGCACCGAGAGCGTACCTCCAAGCACACACCCTCCAGCAGAAGCCCCATCGGCAGCAGAGATACCAGCTCCAAATCCAAAGGTGGAAGAAGCGAAAAACGACGACCATCAGCCGGATTGGCCTATGCCAGATGCGATTGGAAACATCGGTGTCGGACCATCCGGTTTTGGACATCTTACGGTGCAAGTTGACGAGGATGAGGACTACGACAACGAGGATTAG

[0025] Using the CRISPR-P 2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR), a knockout target (SEQ ID NO.2: GCTGGGCACCCGCTTCCCCG) was designed in the major functional domain of OsDrAp1. Primers were designed and annealed before being ligated into a CRISPR-Cas9 vector. The vector was then transformed into Escherichia coli, and the plasmid was extracted and transformed into Agrobacterium tumefaciens. The plasmid was then infecting rice (Zhonghua 11) callus tissue to construct OsDrAp1 knockout transgenic material. Primers were designed to amplify the OsDrAp1 CDS and promoter sequences. The amplified sequences were ligated into the pCUbi1390 vector via homologous recombination to construct the pCUbi1390-UBQ-OsDrAp1-FLAG and pCUbi1390-pOsDrAp1-OsDrAp1-FLAG vectors. These vectors were transformed into *E. coli*, and plasmids were extracted and transformed into *Agrobacterium* to infect rice callus tissue, thus constructing OsDrAp1 overexpression and complementation transgenic materials. Each material was planted in plots of 7 plants × 5 rows, with normal field water and fertilizer management. After rice maturity, it was manually harvested, leaving a stub height of 15 cm. Fourteen days after harvest, the sheath emergence rate of the regenerated shoots from the remaining 15 individual plants (excluding the edge rows) in each plot was statistically analyzed. The germination rate of regenerated shoots from OsDrAp1 knockout and overexpression materials was observed. It was found that the germination rate of knockout plants was significantly increased, while the germination rate of overexpression materials was significantly decreased. Figure 3 This demonstrates that OsDrAp1 negatively regulates axillary bud germination in regenerated rice.

[0026] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of the OsDrAp1 gene in regulating axillary bud germination in regenerated rice, characterized by, The nucleotide sequence of the OsDrAp1 gene is shown in SEQ ID NO.

1.

2. The application according to claim 1, characterized in that, The regulation involves knocking out the OsDrAp1 gene as described in claim 1 in rice.

3. A method for regulating the germination of axillary buds in ratooned rice, characterized in that, When it is necessary to reduce the germination rate of rice axillary buds, the OsDrAp1 gene in rice is overexpressed; when it is necessary to increase the germination rate of rice axillary buds, the OsDrAp1 gene in rice is silenced or knocked out; the nucleotide sequence of the OsDrAp1 gene is shown in SEQ ID NO.

1.

4. The application of the OsDrAp1 gene in rice breeding, characterized by: Rice lines with faster axillary bud germination rates were obtained by screening rice plants with low expression of the OsDrAp1 gene. The nucleotide sequence of the OsDrAp1 gene is shown in SEQ ID NO.

1.

5. The application of the protein encoded by the OsDrAp1 gene in rice breeding, characterized by: Rice plants with high expression levels of the protein encoded by the OsDrAp1 gene were screened to obtain rice lines with slower axillary bud germination rates. The nucleotide sequence of the OsDrAp1 gene is shown in SEQ ID NO.

1.

6. A method for obtaining improved rice with a faster axillary bud germination rate, characterized in that, Includes the knockout of the OsDrAp1 gene as described in claim 1 in rice.

7. The method according to claim 6, characterized in that, The method includes the following steps: knocking out the OsDrAp1 gene in rice using the CRISPR / Cas9 genome editing system.

Images