Construction method, kit and application of autosomal dominant optic atrophy animal model

By mutating the 174th amino acid residue of the mouse Afg3l2 protein to S and using the CRISPR/Cas9 system to construct an Afg3l2 gene mutation animal model, the pathological characteristics of DOA were successfully simulated, solving the problem of the lack of an effective animal model and achieving in-depth research on the pathogenesis of DOA and support for drug screening.

CN120758573APending Publication Date: 2025-10-10HENAN ACADEMY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511016724.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-23
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

The lack of a stable animal model of autosomal dominant optic atrophy with a clear mechanism has made it difficult to deeply explore the pathogenesis of the disease and develop effective treatments.

Method used

By mutating the 174th amino acid residue of the mouse Afg3l2 protein to S, an Afg3l2 gene mutation animal model was constructed using the CRISPR/Cas9 gene editing system to simulate the pathological characteristics of human DOA.

Benefits of technology

The constructed animal model exhibits early characteristic phenotypes of DOA at the visual function, ocular pathology and molecular levels. It is efficient and reproducible, enabling in-depth research on the occurrence and development of the disease and supporting the verification of drug screening and gene therapy programs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758573A_ABST
    Figure CN120758573A_ABST
Patent Text Reader

Abstract

The invention provides a construction method, a kit and application of an autosomal dominant optic atrophy animal model, and relates to the technical field of biology. The construction method comprises the following steps: mutating a mouse Afg3l2 gene, and enabling the 174th amino acid residue of the mouse Afg3l2 protein to be S. The construction method relieves the problem of lack of an autosomal dominant optic atrophy disease animal model in the prior art. The animal model obtained by the construction method can be used for autosomal dominant optic atrophy pathogenesis research, candidate drug screening and gene therapy scheme verification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for constructing an autosomal dominant optic atrophy animal model, a kit and application thereof. Background Art

[0002] The following statements merely provide background information related to the present disclosure and do not necessarily constitute prior art.

[0003] Autosomal dominant optic atrophy (DOA) is a severe optic neuropathy caused by degeneration of optic nerve fibers. It is the most common hereditary optic nerve disease, with an incidence rate of approximately 1:12,000 to 1:25,000. Patients typically experience decreased vision in both eyes, and severe cases may even lead to blindness. Furthermore, effective treatments and strategies for DOA remain elusive.

[0004] In-depth exploration of the pathological mechanisms of DOA, the search for effective and specific therapeutic targets, and the development of targeted treatment options are crucial for effective treatments for DOA. Effective animal models can simulate the disease and reveal disease pathways, assisting in the study of the disease mechanisms of autosomal dominant optic atrophy. More importantly, effective animal models can be used for drug screening and evaluation, including preliminary drug screening, pharmacodynamic studies, drug safety evaluation, drug metabolism studies, and drug interaction studies. A key issue in DOA research is the lack of a simple, easily reproducible animal model. To date, no animal model exists for studying autosomal dominant optic atrophy, hindering in-depth exploration of the pathogenesis of DOA. Therefore, a stable experimental animal model with a clear mechanism is needed.

[0005] In view of this, the present invention is proposed. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for constructing an animal model of autosomal dominant optic atrophy, so as to alleviate the problem of the lack of animal models of autosomal dominant optic atrophy in the prior art.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions: In a first aspect, a method for constructing an autosomal dominant optic atrophy animal model is provided, wherein the method comprises: Afg3l2 Gene mutation, the Afg3l2 The gene mutation changes the amino acid residue 174 of the mouse Afg3l2 protein to S; The amino acid positions of the Afg312 protein are in the direction from N-terminus to C-terminus with reference to the amino acid sequence shown in SEQ ID NO.1.

[0008] In a second aspect, a kit for constructing an autosomal dominant optic atrophy animal model is provided, wherein the kit contains a kit for making mice Afg3l2 Gene mutation reagent, Afg3l2 The gene mutation causes the 174th amino acid residue of the mouse Afg3l2 protein to be S.

[0009] In a third aspect, a method for constructing an autosomal dominant optic atrophy animal model as described in the first aspect, or the use of the kit for constructing an autosomal dominant optic atrophy animal model as described in the second aspect in the evaluation of drugs for autosomal dominant optic atrophy is also provided.

[0010] Compared with the prior art, the present invention has the following beneficial effects: The present invention successfully constructed the first time by mutating the 174th position of mouse Afg3l2 protein to S. Afg3l2 This gene mutation animal model exhibits early-stage phenotypes characteristic of autosomal dominant optic atrophy (DOA) through behavioral, morphological, and molecular biological testing, demonstrating significant visual function, ocular pathology, and molecular phenotypes. Histological analysis revealed that this animal model closely reproduces the typical pathological features of human DOA, specifically alterations in retinal structure and visual function.

[0011] The construction method provided by the present invention is highly efficient and reproducible, and the obtained animal model has significant advantages such as strong clinical phenotype correlation and high genetic stability, which can provide reliable support for the research and treatment of DOA. The DOA animal model obtained by the construction method provided by the present invention provides an ideal platform for the research of DOA, which can deeply study the occurrence and development process of the disease in an in vivo environment. The above animal model is for in-depth study of the genetic mechanism of DOA, with Afg3l2 The relevant mitochondrial metabolic pathways are used as targets to establish new diagnostic and therapeutic strategies, providing an important basis for animal experimental research. This animal model can also be widely used in the screening of candidate drugs and the verification of gene therapy programs, especially in the study of Afg3l2 The role of genes in the development and progression of autosomal dominant optic atrophy. In addition to its important value in studying the genetic mechanism of DOA, Afg3l2 It also plays a key role in neurodegenerative diseases, especially hereditary ataxia (SCA28) and spastic paraplegia (SPG28) that mainly affect the cerebellum and spinal cord. The animal model provided by the present invention also has important potential application value in the research of the above diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0013] Figure 1 Design and construction of CRISPR / Cas9 technology in Example 1 Afg3l2 F174S Schematic diagram of gene mutant mice; Figure 2 For Example 2 (A) Afg3l2 F174S / F174S Mutant mice, Afg3l2 F174S / + mice, Afg3l2 WT Mouse sequencing peak diagram; (B) 0-day-old Afg3l2 F174S / F174S mice, Afg3l2 F174S / + Mice and Afg3l2 WT Comparison of the appearance of mice; (C) 2-week-old Afg3l2 F174S / F174S mice, Afg3l2 F174S / + Mice and Afg3l2 WT Comparison of the appearance of mice (the first and second on the left are Afg3l2 F174S / F174S Mouse, the one on the right Afg3l2 WT Mouse, second from the right Afg3l2 F174S / + mice); Figure 3 For the 7-month-old in Example 2 Afg3l2 F174S / + OCT changes in mutant mice, the left picture is 7 months old Afg3l2 WT Mice and Afg3l2 F174S / + Typical OCT images of mutant mice. The right image shows the statistical analysis results of GCC thickness and GCC / full-layer retinal thickness; scale bar: 200 μm, data are expressed as mean ± standard deviation (n=6), **** P <0.0001; Figure 4 For the 12-month-old in Example 3 Afg3l2 F174S / + OCT changes in mutant mice, the picture shows 12-month-old mice Afg3l2WT mice and Afg3l2 F174S / + Typical OCT images of mutant mice, right panel: statistical analysis of GCC thickness and GCC / total retinal thickness; scale bar: 200 μm, data are presented as mean ± s.d. (n = 6), P <0.0001; Figure 5 A, 7 months old, and B, 12 months old, in Example 4 Afg3l2 F174S / + HE staining results of eyeball sections of mutant mice, left panel: representative images of each month of age, right panel: statistical results of RGC number of two groups of mice; scale bar: 50 μm, data are presented as mean ± s.d. (n≥4), ns (not significant) Afg3l2 WT mice and Afg3l2 F174S / + Typical HE staining images of eyeball sections of mutant mice, right panel: statistical results of RGC number of two groups of mice; scale bar: 50 μm, data are presented as mean ± s.d. (n≥4), ns (not significant) P ≥0.05, P <0.01; Figure 6 A, 7 months old, and B, 12 months old, in Example 4 fg3l2 F174S / + ERG of mutant mice; left panel: under dark-adapted and light-adapted conditions, 7 months old wild type mice and Afg3l2 F174S / + ERG of heterozygous point mutant mice; right panel: statistical results of a, b wave amplitude of two groups of mice under dark-adapted (upper) and light-adapted (lower) conditions, data are presented as mean ± s.d. (n≥6), P ≥0.05; Figure 7 A, 7 months old, and B, 12 months old, in Example 4 fg3l2 F174S / + ERG of mutant mice; left panel: under dark-adapted and light-adapted conditions, 12 months old wild type mice and Afg3l2 F174S / + ERG of heterozygous point mutant mice; right panel: statistical results of a, b wave amplitude of two groups of mice under dark-adapted (upper) and light-adapted (lower) conditions, data are presented as mean ± s.d. (n≥6), P ≥0.05; Figure 8 A, 7 months old, and B, 12 months old, in Example 4 Afg3l2 F174S / + VEP of mutant mice; left panel: 7 months old Afg3l2 WT mice and Afg3l2 F174S / +VEP waveforms of mutant mice; right panel: statistical results of P1 and P2 wave latencies of the two groups of mice; data are expressed as mean ± standard deviation (n ≥ 6), * P <0.05,** P <0.01; Figure 9 For the 12-month-old in Example 4 Afg3l2 F174S / + Visual evoked potentials of mutant mice; left: 12 months old Afg3l2 WT Mice and Afg3l2 F174S / + VEP waveforms of mutant mice; right: statistical results of P1 and P2 wave latencies of the two groups of mice; data are expressed as mean ± standard deviation (n ≥ 6), ** P <0.01; Figure 10 For example 4, the electron microscope observation Afg3l2 WT and Afg3l2 F174S / + Photos of mitochondrial morphology and structure in mouse retina and optic nerve tissue, scale bar: 500 nm; Figure 11 The results of Western blotting (WB) of Afg3l2 protein in the retinal tissue and optic nerve of 2-week-old mice in each group in Example 5 are shown. The left figure shows the immunoblotting of Afg3l2 protein and the internal reference Gapdh. The right figure shows the statistical results of the relative expression of Afg3l2 protein in each group of mice. Data are expressed as mean ± standard deviation (n = 3), ns (not significant). P ≥0.05,* P <0.05; Figure 12 For Example 6 Afg3l2 F174S / + Photographs of ROS detection and staining in mouse retina, scale bar: 300 μm. DETAILED DESCRIPTION

[0014] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0015] As used herein, "and / or" is used to indicate that either or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0016] In this document, unless otherwise stated, arbitrary numbering is used to distinguish one entity or action from another entity or action, and does not necessarily require or imply any actual such relationship, order or importance between these entities or actions, such as numbering i, ii...; first, second..., etc.

[0017] As used herein, the articles "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. For example, "an antibody" refers to one antibody or more than one antibody.

[0018] As used herein, unless otherwise stated, "optionally," "optional," "optional," or "optional" means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0019] Herein, the terms "comprise" or "comprising" are intended to imply the inclusion of stated elements, integers or steps, but not the exclusion of any other elements, integers or steps.

[0020] As used herein, "Cas nuclease" refers to a Cas nuclease that can bind to a target sequence, or cut or nick a target sequence, or mutate a target sequence. The Cas nuclease includes, but is not limited to, a natural Cas nuclease or a polypeptide or complex containing the main functional domain of a Cas nuclease; or a mutated Cas nuclease or polypeptide; or a fusion protein containing a Cas nuclease or a Cas nuclease functional domain fused with other functional regions. The Cas nuclease includes, but is not limited to, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9, or SpCas9; or proteins, polypeptides, or complexes derived from mutations of the above-mentioned Cas nucleases and / or fusions with other functional domains.

[0021] As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of polynucleotides include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers comprising purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. A polynucleotide comprises a portion encoding the above-mentioned antibody or antigen-binding fragment thereof, optionally encoding a sense strand or an antisense strand. A polynucleotide may be naturally occurring, synthetic, recombinant, or any combination thereof.

[0022] In the present document, unless specifically stated otherwise, the amino acid positions of the Afg3l2 protein herein refer to the amino acid sequence set forth in SEQ ID NO. 1, and the positions are in the direction from N-terminus to C-terminus, and the first amino acid residue at the N-terminus of the amino acid sequence set forth in SEQ ID NO. 1 is the first position. However, it should be noted, and those skilled in the art will appreciate, that different numbering systems can be used for different sequences, for example, if additional amino acid residues are added or removed compared to SEQ ID NO. 1. Thus, when a particular amino acid residue is referred to by its position, the reference is not limited only to the amino acid that is at that exact position when counting from the amino acid sequence of SEQ ID NO. 1, but also refers to the equivalent / corresponding amino acid residue in any and all sequences, even if the residue is not at the same exact position. For example, if a sequence is shorter or longer than SEQ ID NO. 1, or has insertions or deletions compared to SEQ ID NO. 1. For example, if sequence X has 2 amino acid residues deleted at the N-terminus compared to the sequence of SEQ ID NO. 1, then the first position of sequence X is equivalent / corresponding to the third position of the sequence of SEQ ID NO. 1, and when not specifically stated that the amino acid position is referred to with reference to the sequence X, the reference to the third amino acid residue refers to the first position when referring to the amino acid position in sequence X.

[0023] In a first aspect, there is provided a method for constructing an animal model of autosomal dominant optic atrophy, the method comprising causing a mutation in a mouse Afg3l2 The mutation causes the amino acid residue at position 174 of the Afg3l2 protein of the mouse to be S (174S). The amino acid position of the Afg3l2 protein is with reference to the amino acid sequence set forth in SEQ ID NO. 1, in the direction from N-terminus to C-terminus. Afg3l2 The mutation causes the amino acid residue at position 174 of the Afg3l2 protein of the mouse to be S (174S). The amino acid position of the Afg3l2 protein is with reference to the amino acid sequence set forth in SEQ ID NO. 1, in the direction from N-terminus to C-terminus.

[0024] Afg3l2 The Afg3l2 gene plays an important role in maintaining normal physiological functions of the human body. Afg3l2 The Afg3l2 gene is located at the 18p11.21 region of human chromosome 18, encodes AFG3-like protein 2, and is a catalytic subunit of the mitochondrial m-AAA protease complex. The amino acid residue at position 174 of the Afg3l2 protein is S, which belongs to a membrane interdomain domain variation. Behavioral, morphological, and molecular biological tests have confirmed that it significantly exhibits early characteristic phenotypes of autosomal dominant optic atrophy disease in terms of visual function, ocular pathology, and molecular level, and an animal model of autosomal dominant optic atrophy can be successfully constructed.

[0025] In an optional embodiment, the method for constructing an animal model of autosomal dominant optic atrophy comprises causing the codon corresponding to the amino acid residue at position 174 of the Afg3l2 protein of the mouse to be TCT.

[0026] In optional embodiments, the method of constructing comprises obtaining Afg3l2 heterozygous offspring of the genetic mutation, which is experimentally verified to have Afg3l2 F174S / + The heterozygous point mutation mice exhibit normal viability and fertility, and show early degeneration of the retinal nerve fiber layer, and the retinal degeneration has a characteristic of continuous progression; and the retinal ganglion cells are reduced, the retinal nerve fiber layer is thinned, and the nerve conduction function is impaired, which has a characteristic of continuous progression, and the retinal mitochondria have a significant change in morphology.

[0027] In optional embodiments, the method of constructing comprises obtaining Afg3l2 homozygous offspring of the genetic mutation, which is experimentally found to have Afg3l2 F174S / F174S The homozygous mouse model is compared with the wild type, and the homozygous point mutation mice are smaller in size, have delayed development, and have obvious tremor and ataxia.

[0028] In optional embodiments, the method of constructing comprises crossing the neutral mature Afg3l2 protein 174S mutation positive F0 generation mice with wild type mice respectively, performing germ line transmission and F1 generation animal passage test, and obtaining the F1 generation heterozygous mutation mice through verification. The F1 generation heterozygous mutation mice are crossed with wild type individuals to obtain F2 generation heterozygous mutation mice as an autosomal dominant optic atrophy animal model. In optional embodiments, the method of constructing further comprises self-crossing the F2 generation heterozygous individuals to obtain F3 generation homozygous mice.

[0029] In optional embodiments, the subject comprises an organ, a tissue, or a cell from a mouse.

[0030] In optional embodiments, the method of constructing comprises causing the mouse to have Afg3l2 a genetic mutation by at least one gene editing system.

[0031] In optional embodiments, the method of constructing comprises causing the mouse to have Afg3l2 a genetic mutation by at least one CRISPR / Cas gene editing system, and further optionally, causing the mouse to have Afg3l2 a genetic mutation by a CRISPR / Cas9 gene editing system.

[0032] In preferred schemes, the CRISPR / Cas9 gene editing system is used to successfully achieve precise editing of the mouse Afg3l2 gene, and an Afg3l2Gene mutation mouse model. The CRISPR / Cas9 gene editing system possesses high specificity and accuracy, capable of precisely identifying and cleaving target gene sequences, thereby achieving site-specific gene modification. The application of this technology not only improves the efficiency and accuracy of animal model construction but also provides strong technical support for in-depth research on the pathogenesis of DOA and the development of effective treatments. Compared with traditional gene editing technologies, the CRISPR / Cas9 gene editing system offers significant advantages such as ease of operation, low cost, and high efficiency, and is expected to play a significant role in the research and treatment of DOA and other genetic diseases.

[0033] In an optional embodiment, the donor DNA (Donor Oligo) of the CRISPR / Cas gene editing system encodes at least one silent mutation site to prevent gRNA binding to the sequence and re-cutting after homology-directed repair. The silent mutation site refers to the introduction of base substitutions in the target sequence region of the gRNA or the PAM sequence in the donor DNA, excluding the target site for gene editing, and the base substitution does not cause a change in the type of amino acid residue, or the changed amino acid residue has no significant functional effect on the function of the target protein. When the target DNA sequence is edited, the Cas9 protein may still re-recognize and cut the site, resulting in unnecessary re-editing or off-target effects. By introducing silent mutations near the editing site, the binding of the gRNA to the target DNA or the recognition of the Cas9 protein can be disrupted, thereby preventing re-editing and improving the accuracy and efficiency of editing.

[0034] In an optional embodiment, the construction method comprises introducing a gene editing composition into mouse cells, wherein the gene editing composition comprises: (i) gRNA or a polynucleotide encoding the gRNA.

[0035] (ii) a Cas nuclease or a polynucleotide encoding a Cas nuclease; in an optional embodiment, the Cas nuclease comprises Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9 or mutants thereof and / or proteins, polypeptides or complexes fused with other functional domains.

[0036] (iii) Donor DNA.

[0037] In an optional embodiment, the polynucleotide encoding the gRNA is mRNA or a recombinant vector, and the mRNA or recombinant vector is transformed into a test cell to express the gRNA.

[0038] In an optional embodiment, the polynucleotide encoding the Cas nuclease is mRNA or a recombinant vector, and the mRNA or recombinant vector is transformed into a test cell to express the Cas nuclease.

[0039] In an optional embodiment, the gene editing composition comprises a ribonucleoprotein complex (RNP) formed by a Cas nuclease and gRNA.

[0040] In the construction method, the gene editing composition can be introduced into mice by any conventional method known in the art, such as, but not limited to, liposome introduction, nanoparticle delivery, vector, transfection, heat shock, electrofection, transduction, gene gun, or microinjection.

[0041] In an optional embodiment, the target sequence of the gRNA is as shown in SEQ ID NO.2, or is the reverse complementary sequence shown in SEQ ID NO.2. Afg3l2 sgRNA targeting a gene can be used to target the gene through the CRISPR / Cas gene editing system. Afg3l2 Introducing specific mutations into genes, which can be used to construct Afg3l2 Animal models of gene mutations. Afg3l2 The method of animal models of gene mutations has a high success rate.

[0042] It is understood that the gRNA may also optionally contain conventional backbone sequences known in the art, such as but not limited to sequences constituting hairpin regions and / or linker regions. The specific backbone sequence composition may be determined by those skilled in the art with reference to textbooks, references, process manuals, product descriptions or standard documents, etc. in the art, and the present invention is not limited thereto.

[0043] In an optional embodiment, the silent mutation site encoded by the donor DNA corresponds to the 180th amino acid residue of the Afg3l2 protein; further optionally, the codon corresponding to the 180th amino acid residue of the Afg3l2 protein in the donor DNA is TCG.

[0044] In an optional embodiment, the nucleotide sequence of the donor DNA is shown as SEQ ID NO.3.

[0045] In an alternative embodiment, the mouse cell comprises a fertilized egg.

[0046] In an optional embodiment, the construction method includes: (a) The gRNA with a target sequence as shown in SEQ ID NO. 2, the donor DNA with a nucleotide sequence as shown in SEQ ID NO. 3, and Cas9 are co-injected into mouse fertilized eggs, and positive F0 generation mice are harvested; (b) crossing the positive F0 mice with wild-type mice to harvest F1 generation heterozygous mutant mice, crossing the F1 generation heterozygous mutant mice with wild-type mice to harvest F2 generation heterozygous mutant mice, and using the F2 generation heterozygous mutant mice as an autosomal dominant optic atrophy animal model; further optionally, step (c) is also included: (c) F2 heterozygous mutant mice were self-crossed to obtain F3 homozygous mutant mice, which were used as an animal model of autosomal dominant optic atrophy.

[0047] In a second aspect, a kit for constructing an autosomal dominant optic atrophy animal model is provided, wherein the kit contains a kit for making mice Afg3l2 Gene mutation reagent, Afg3l2 The gene mutation causes the 174th amino acid residue of the mouse Afg3l2 protein to be S.

[0048] In an optional embodiment, the mouse Afg3l2 Reagents for gene mutation include reagents for gene editing.

[0049] In an optional embodiment, the reagent for gene editing includes a reagent for CRISPR / Cas gene editing.

[0050] In an optional embodiment, the reagent for CRISPR / Cas gene editing includes donor DNA, which encodes at least one silent mutation site.

[0051] In an optional embodiment, the kit comprises the gene editing composition described in the first aspect.

[0052] In an optional embodiment, the kit further comprises a kit for identifying Afg3l2 Gene mutation reagent. Afg3l2 The reagents for detecting gene mutations include primers whose nucleotide sequences are shown in SEQ ID NO. 4 and 5. Afg3l2 Reagents for detecting gene mutations include reagents for sequencing.

[0053] In a third aspect, a method for constructing an autosomal dominant optic atrophy animal model as described in the first aspect, or the use of the kit for constructing an autosomal dominant optic atrophy animal model as described in the second aspect in the evaluation of drugs for autosomal dominant optic atrophy is also provided.

[0054] The present invention is further described below by way of specific examples. However, it should be understood that these examples are merely provided for more detailed description and are not to be construed as limiting the present invention in any form.

[0055] Example 1: Afg3l2 F174S Construction of point mutation mouse model In this example, the CRISPR / Cas9 gene editing system was used to design and construct Afg3l2 F174S Gene mutant mice. Specific strategies are shown in Figure 1 ;like Figure 1 As shown, mice Afg3l2 The gene (NM_027130.2) is located on chromosome 18 and has only one transcript. The background strain is C57BL / 6J. F174S is located in exon 5, and exon 5 was selected as the target site. The gRNA targeting vector and donor oligonucleotide were designed. The p.F174S (TTT to TCT) mutation site in the donor oligonucleotide was knocked into exon 5 by homology-directed repair. At the same time, a silent mutation p.S180 = (TCT to TCG) was introduced to prevent the binding and re-cutting of the gRNA to the sequence after homology-directed repair. In this example, C57BL / 6J mice were used for Afg3l2 F174S Construction of site-directed mutation animal model; the C57BL / 6J mice used were purchased from Saiye Biotechnology Co., Ltd. and were 4 weeks old.

[0056] (1) Design of gRNA target sequence: gRNA-B1 (matching the forward strand of the gene): GTCAATAACTATCTTTCTAAGGG (SEQ ID NO. 2).

[0057] (2) Synthesize Donor Oligo and construct gRNA vector: GTGGAGTCATGATTTACTTCGTGTTCAAGAGCTCTGGGAGAGAAATCACGTGGAAAGAC TCT GTCAATAACTATCTT TCG AAGGGCGTGGTAAGTAATGGGCTGGGGTGTTGCAGATTAGAAGGGGAAATGCAGTTGTGT (the sequence is shown in SEQ ID NO. 3, the underlined sequence is the mutation sequence, and the double-strike sequence is the silent mutation sequence).

[0058] (3) Transcribe the gRNA vector and Cas9 vector in vitro.

[0059] (4) Microinjection and identification of F0 generation mice: The mice Afg3l2Genetic guide RNA, donor oligonucleotides containing the p.F174S (TTT to TCT) mutation and the silent mutation p.S180 (TCT to TCG), and Cas9 were co-injected into fertilized eggs to generate targeted knockout offspring. F0 generation animals were identified by polymerase chain reaction and sequence analysis.

[0060] (5) Breeding and identification of F1 generation mice Neutered, mature, positive F0 mice were crossed with wild-type mice for germline transmission and F1 generation animal propagation. F1 heterozygous mutant mice were verified by PCR and sequencing. F1 heterozygous mutant mice were crossed with wild-type individuals to produce F2 heterozygous mutant mice (i.e., an animal model for autosomal dominant optic atrophy). F2 heterozygous mutant mice were then self-crossed to produce F3 homozygous mutant mice.

[0061] (6) Genotyping of the Phe174Ser allele was performed using the following method: 1-2 mm of tissue was removed from the mouse tail, the tissue was lysed, genomic DNA was extracted, and PCR amplification of the target gene fragment was performed using primers. The resulting 411 bp PCR product was sequenced to detect the mutant allele.

[0062] Table 1 Primer sequences of mouse Afg3l2 gene

[0063] In Table 1, W represents A or T.

[0064] Results: CRISPR / Cas9 technology was used to successfully construct Afg3l2 F174S / + Heterozygous point mutation mice were successfully propagated later. Afg3l2 F174S / + Heterozygous point mutation mice exhibit normal viability and reproductive capacity, normal habits and behaviors similar to those of wild animals. Figure 2 Figure A is a mouse sequencing peak diagram. During the breeding process, in the offspring whose parents were both heterozygous, the ratio of wild-type, heterozygous point mutation, and homozygous point mutation mice was close to 1:2:1, which is consistent with Mendel's law of inheritance ( Figure 2 At the same time, it was found Afg3l2 F174S / F174S The mice died 2 weeks after birth (approximately 16 days old), and throughout their lifespan, compared with wild-type and heterozygous point mutation mice, homozygous point mutation mice were smaller, had developmental delays, and showed significant tremors and ataxia, suggesting that the mutation may have a serious impact on the function of the Afg3l2 protein. Figure 2 Middle C).

[0065] Example 2: Mouse retinal in vivo imaging system (Micron IV) displays retinal structure (1) Anesthesia and pupil dilation: Inject 1.25% premixed tribromoethanol solution via the intraperitoneal route at a dosage of 0.2 mL / 10 g body weight, followed by pupil dilation with compound tropicamide eye drops.

[0066] (2) Positioning of experimental subjects: After the experimental mice reach a deep anesthesia state and their pupils are fully dilated, they are fixed to the operating platform. The eyeball position is precisely calibrated using a three-dimensional adjustment device, and ofloxacin ophthalmic gel is evenly applied to the corneal surface.

[0067] (3) Imaging system calibration: First, white balance the fundus image and gradually advance the microscope lens from its initial position to the target area until the retinal image is clearly displayed on the monitoring interface. Simultaneously optimize the contrast, brightness, and resolution parameters of the optical coherence tomography device.

[0068] (4) Multi-angle scanning imaging: Through the precise eye position adjustment device, the optic disc structure is positioned in the center of the fundus image, while the OCT scanning line accurately covers the middle and upper quadrants of the retina. According to the standardized procedure, the "M" scanning is performed at four axial angles of -45°, 0°, 45°, and 90° to collect images.

[0069] (5) Quantitative analysis of layer thickness: In view of the special characteristics of the rodent retinal structure, the GCC integrated measurement method was used: the combined thickness of the retinal nerve fiber layer (RNFL), ganglion cell layer (GCL), and inner plexiform layer (IPL) was comprehensively evaluated in the 300 μm measurement area on both sides of the optic disc midline. To eliminate the interference of individual differences in total retinal thickness, the ratio of GCC thickness to total retinal thickness was established as a standardized analysis indicator.

[0070] Results: OCT technology was used to systematically evaluate Afg3l2 F174S / + The retinal development characteristics of heterozygous point mutation mice were observed. At 7 months of age, the GCC thickness and the GCC / full-layer retinal thickness ratio of mutant mice were significantly reduced, suggesting that this model has early degeneration characteristics of the optic nerve fiber layer ( Figure 3 Extending the observation period to 12 months of age revealed that the mutant mice continued to exhibit a GCC atrophy phenotype: compared with wild-type controls, the absolute thickness of the GCC decreased, and the GCC / total thickness ratio decreased. This data confirms that: Afg3l2 F174S / + Retinal degeneration caused by point mutations has the characteristics of continuous progression ( Figure 4 ).

[0071] Example 3: HE staining of retinal sections and counting of retinal ganglion cells (1) Sampling: The mouse was dislocated by cervical dislocation and the eyeballs were removed. The eyeballs were briefly washed with saline to remove blood. The eyeballs were fixed in 4% paraformaldehyde overnight.

[0072] (2) Sectioning: The fixed eyeball is dehydrated, transparentized, wax-impregnated, and embedded to produce a paraffin-embedded tissue block. The tissue block is then cut into thin slices using a microtome, usually with a thickness of 8 μm. The slices are placed on a glass slide and baked in an oven to increase the adhesion of the slices to the slide.

[0073] (3) HE staining: After the eyeball sections are dewaxed and hydrated, they are stained with hematoxylin, differentiated with hydrochloric acid and alcohol, and stained with eosin after turning blue. Finally, they are dehydrated and transparent and then sealed. (4) RGC counting and evaluation: Observe the retinal sections stained with HE under a light microscope. RGCs are located in the inner retinal layer, with large, round nuclei and dark staining. The survival of retinal ganglion cells is assessed by counting the number of RGCs with normal morphology in the ganglion cell layer. Count the number of RGCs within the entire field of view of the section.

[0074] Results: Further evaluation Afg3l2 F174S / + To investigate the effect of the mutation on the retinal structure of mice, HE staining was performed on eyeball sections of 7-month-old and 12-month-old mice to observe the structure of each retinal layer and count the retinal ganglion cells. The results were consistent with those of OCT detection. Afg3l2 F174S / + The retinal structures of point mutation mice are intact, but compared with wild-type mice of the same age, the retinal nerve fiber layer structure of heterozygous point mutation mice is slightly disordered, and the gaps between retinal ganglion cells are larger. Afg3l2 WT Compared with mice aged 12 months Afg3l2 F174S / + The number of retinal ganglion cells in mice decreased. The above results suggest that: Afg3l2 F174S / + The mutation leads to a decrease in retinal ganglion cells and thinning of the optic nerve fiber layer in mice, which is consistent with the characteristics presented by clinical patients, suggesting that this animal model can simulate the in vivo environment of patients with autosomal dominant optic atrophy to further study its pathogenesis ( Figure 5 ).

[0075] Example 4: Visual electrophysiological testing of mouse visual function General experimental preparation process: (1) Dark adaptation treatment: After the experimental mice were placed in a completely dark environment for 12 h, 1.25% tribromoethanol anesthetic was injected intraperitoneally (dose 0.2 mL / 10 g), followed by pupil dilation pretreatment with compound tropicamide.

[0076] (2) Electrode positioning: After the subject reaches the anesthesia standard, he / she is fixed in the prone position, and the ocular surface is evenly covered with ofloxacin ophthalmic gel.

[0077] (3) Flash electroretinogram (FERG) mode: The reference electrode is inserted subcutaneously through the midline between the ears to the midpoint of the orbital periphery. The corneal contact electrode ring is precisely aligned with the center of the pupil, and a ground electrode is set at the tail.

[0078] (4) Flash visual evoked potential (FVEP) mode: The reference electrode is placed in the mouth, and the recording electrode is implanted subcutaneously in the optic nerve projection area through the midline between the ears, and the tail grounding device maintains the same position.

[0079] (5) FERG testing procedure: After completing the body position calibration, the subject was moved steadily into the full-field stimulation device (Ganzfeld), and the baseline potential was monitored in real time until the signal was stable. A white light flash gradient stimulation mode was used, with five levels of light intensity parameters set from 0.001 to 10 cd·s / m². Each stimulation unit was recorded ≥3 times, and the full-layer electrical response signals from retinal bipolar cells to ganglion cells were collected.

[0080] (6) FVEP testing procedure: After the experimental subjects were placed in the experimental apparatus using the same method, the basal electrical signal was monitored until it stabilized. A white light flash (5 cd·s / m²) was used as the evoked stimulus, and the postsynaptic potential characteristic waveform of the visual cortical neuron cluster was obtained through three independent repeated recordings.

[0081] Results: Flash electroretinogram (FERG) and flash visual evoked potential (FVEP) were used to evaluate the visual function of the two groups of experimental mice. Based on the experimental data of 7-month-old mice, the sample size was further expanded, and a 12-month-old group was added to conduct functional evaluation across time points to fully analyze the age-dependent optic nerve degeneration process. FERG records the electrical activity generated by the retina under light stimulation, reflecting the functional status of different retinal cell layers (retinal photoreceptor layer, inner retinal Müller cells and bipolar cells). The visual electrophysiological results showed that Afg3l2 F174S / + Compared with wild-type mice, the waveform and amplitude of dark-adapted and light-adapted FERG in mice did not change significantly, suggesting that Afg3l2 F174S / + Mouse retinal photoreceptor-bipolar cell signal transduction pathway is intact ( Figure 6 and Figure 7 ).

[0082] FVEP mainly reflects the signal transmission efficiency of RGC axons to the lateral geniculate body-visual cortex. Its abnormal changes (such as prolonged latency) indicate damaged integrity of the optic nerve fiber myelin sheath or axonal transport disorder. Afg3l2 F174S / + The latency of the P1 and P2 waves of FVEP in the point mutation group mice was prolonged to varying degrees compared with the wild-type group ( Figure 8 ). Further testing of the FVEP of the two groups of mice at 12 months of age revealed that compared with wild-type mice, the mutant mice had delayed P1 and P2 waves after flash stimulation. The above results suggest that Afg3l2 F174S / + The optic nerve conduction function of point mutation mice is impaired and progresses continuously ( Figure 9 ).

[0083] Digging Further Afg3l2 F174S / + To investigate the potential mechanism of RGC damage caused by mutation, the retinas and optic nerves of 12-month-old mice were observed under electron microscopy. The results showed that Afg3l2 F174S / + The mitochondrial morphology of mice was significantly altered, mainly manifested as severe disorder of the inner mitochondrial membrane (IMM), especially reduced cristae density, blurred cristae structure, and even cristae loss. Afg3l2 WT Mouse mitochondria exhibit a typical oval structure with a clear double membrane structure and neatly arranged internal cristae. Afg3l2 F174S / + The retinal mitochondria of mice underwent significant changes in morphology ( Figure 10 ).

[0084] Example 5: Stability of Afg3l2 Protein in Mouse Retina 1. Mouse Retina and Optic Nerve Protein Extraction (1) Peeling off the retina and optic nerve: Euthanize the mice by cervical dislocation. Gently remove the bilateral eyeballs using fine forceps and place them in pre-cooled 1× PBS. Under a dissecting microscope, use a blade to make a small incision at the corneal limbus, cut the eyeball along the corneal limbus, and remove the cornea and lens with ophthalmic forceps. Gently peel off the retinal tissue to avoid damage. Use ophthalmic scissors to carefully cut the optic nerve about 1-2 mm away from the eyeball wall. Transfer the separated retina and optic nerve together to pre-cooled 1× PBS, wash to remove the residual vitreous, place in a 1.5 mL EP tube, freeze in liquid nitrogen, and store in a -80℃ freezer for a long time.

[0085] (2) Tissue homogenization: Transfer the retinal tissue to a pre-chilled centrifuge tube. Add 100 μL of potent lysis buffer (containing 1% protease inhibitor) to each retina. Homogenize on ice using an ultrasonic cell disruptor (10% power, 3 s on, 9 s off, for a total of 3 min).

[0086] (3) Protein extraction: The homogenate was lysed at low temperature for 30 min. Centrifuged in a low-temperature high-speed centrifuge at 12,000 rpm for 10 min, and the protein supernatant was collected.

[0087] (4) Standardized protein quantification and sample preparation: A high-sensitivity BCA assay kit (Biyuntian) was used, and a 96-well plate layout was planned based on the standard curve gradient setting and sample replicate requirements. Duplicate wells were set for each sample to be tested, and the BCA working solution (reagent A:B) was accurately prepared at a 50:1 volume ratio according to the requirement of 200 μL / well reaction solution. The solution was vortexed for 30 s.

[0088] (5) Standard curve establishment: An eight-level concentration gradient (0-0.5 mg / mL) was constructed by precise pipetting: Gradual dilution of the standard stock solution: 0, 1, 2, 4, 8, 12, 16, and 20 μL of the standard were taken, respectively. 1× PBS was added to a final volume of 20 μL, corresponding to theoretical concentrations of 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively.

[0089] (6) Sample pretreatment: Add 18 μL of PBS buffer to the detection well in advance, and accurately pipette 2 μL of sample solution using the reverse injection technique to ensure a final volume of 20 μL. This operation can effectively reduce the interference of sample viscosity on the detection.

[0090] (7) Color development and detection: Use a multichannel pipette to add 200 μL of premixed working solution in parallel and incubate in a 37°C constant temperature shaking incubator for 30 min (relative humidity > 60%). This temperature control condition ensures that the copper ion reduction reaction is complete. The absorbance value is measured using a microplate reader at a characteristic absorption wavelength of 562 nm. The standard curve is fitted using a four-parameter nonlinear regression model (R² > 0.99). The mean of the duplicate wells is used to calculate the sample protein concentration.

[0091] (8) Homogenization: Based on the quantitative results, the sample was adjusted to the target concentration using a lysis buffer containing a dual enzyme inhibition system (protease + phosphatase inhibitor) to ensure that the protein loading was consistent between groups.

[0092] (9) Denaturation and aliquoting: Add 5× buffer at a volume ratio of 1:4 and heat-treat in a 95°C metal bath for 10 min to achieve complete denaturation. After aliquoting, freeze at -20°C (avoid repeated freeze-thaw cycles). It is recommended to store in low-protein adsorption tubes.

[0093] 2. Western blot (WB) (1) Electrophoresis: Gel preparation: Select the separation gel concentration according to the molecular weight range of the target protein, and prepare a double-layer system of stacking gel and separation gel according to the standard process.

[0094] Sample loading: Prepare electrophoresis buffer and add it to the electrophoresis tank until the glass plate is just submerged. Wait 5 minutes and observe for leakage. After ensuring the tank is properly sealed, add the remaining electrophoresis buffer to the outer tank up to the mark. Using a fine pipette tip, pipette 20 μg of protein sample into the sample wells according to the pre-calculated concentration. Add a two-color pre-stained protein marker according to experimental requirements. Add an equal volume of buffer to the blank wells to prevent abnormal banding due to current instability.

[0095] Electrophoresis instrument settings: First, use low voltage (80 V) for electrophoresis for about 30 minutes. At this time, the electrophoresis band should flow out of the upper concentrated gel and enter the lower separation gel. At this time, increase the voltage to 120-150 V. The voltage can be adjusted according to the position of the target band and experimental requirements. Continue electrophoresis until the sample approaches the bottom of the gel.

[0096] (2) Transfer (wet transfer method): Prepare electrotransfer solution (one pack of Seville fast electrotransfer powder + 200 mL methanol + 800 mL deionized water). Activate the PVDF membrane with methanol in advance (soak for 30 seconds), cover the membrane on the gel, ensure that the gel is larger than the membrane, and remove any bubbles between the two. Use the "sandwich" method to sandwich the gel and PVDF membrane with thick filter paper and a sponge pad. Place the gel and PVDF membrane in an electrotransfer clamp and tighten it. Place the membrane in a transfer tank and add electrotransfer solution to the indicator line. Place a pre-cooled ice box in the tank and place the entire electrotransfer tank on ice. Transfer the membrane at a constant voltage of 100 V for 90 minutes.

[0097] (3) Blocking: After the transfer is completed, remove the PVDF membrane (the pre-stained protein marker can be clearly displayed at this time) and place it in blocking solution (5% concentration of skim milk powder prepared in 1×TBST) for 2 hours.

[0098] (4) Incubation with primary antibody: Incubate the blocked membrane with diluted primary antibody (according to the ratio recommended in the antibody instructions) at 4°C overnight. The primary antibodies used in this study include GAPDH rabbit / mouse anti-antibody, AFG3L2 rabbit anti-antibody, and Flag mouse / rabbit anti-antibody.

[0099] (5) Incubation with secondary antibody: Wash the membrane three times with TBST; incubate the membrane with HRP-labeled secondary antibody (according to the ratio recommended in the antibody instructions) at room temperature for 2 h; wash the membrane three times with TBST.

[0100] (6) Development: The PVDF membrane was evenly covered with enhanced ECL substrate, and a visible light signal with a wavelength of 428 nm was generated by the catalysis of horseradish peroxidase (HRP) to oxidize luminol. The band was analyzed using ImageJ software.

[0101] Results: In order to verify the in vivo stability of Afg3l2 F174S protein, the retinal tissue and optic nerve of 2-week-old mice were stripped for immunoblotting experiments, and the results showed that the expression level of Afg3l2 protein in the mouse retina was significantly reduced, and the expression level of Afg3l2 protein in the homozygous mouse retina was significantly reduced, further proving that the F174S mutation can cause the stability of Afg3l2 Afg3l2 WT , Afg3l2 F174S / + mouse retinal Afg3l2 protein expression level decreased Afg3l2 F174S / F174S significantly, further in vivo confirmed that F174S mutation can cause Afg3l2 F174S protein stability decline Figure 11 .

[0102] Example 6: Detection of reactive oxygen species (ROS) in mouse retina (1) The mouse vitreous cavity was injected with 1 μL of MitoSOX dye with a concentration of 250 μM, and the fluorescence probe could stain the mitochondrial ROS of the mouse retina as red.

[0103] (2) After 2 h, the mouse eyeball was taken out and fixed in 4% PFA on ice for 1 h.

[0104] (3) The eyeball anterior segment was removed under a microscope, and OCT (Optimal Cutting Temperature compound) was used for embedding and liquid nitrogen quick freezing.

[0105] (4) Within 24 h, the eyeball was sectioned using a freezing microtome under light-proof conditions, with a thickness of 15 μm, and was attached to a glass slide.

[0106] (5) The eyeball section was washed with 1xPBS for 3 times, 5 min each time, and the shaking table was set at 80 rpm.

[0107] (6) The section was mounted using DAPI mounting medium, and after air drying, it was moved into a wet box.

[0108] (7) Image scanning was performed using the TissueFAXS panoramic scanning and directional analysis system.

[0109] Results: Further study of the function of mouse retinal mitochondria. The ROS detection results of the mouse eyeball frozen section showed that, compared with Afg3l2 WTCompared with the mice, the ROS accumulation and oxidative stress of the mutant mice were obvious. The results were consistent with the results of the previous in vitro experiments, suggesting that the mutation had a significant impact on the morphology and function of mitochondria. Figure 12 ).

[0110] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, but not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A method for constructing an animal model of autosomal dominant optic atrophy, characterized in that: Including mice Afg3l2 Gene mutation, the Afg3l2 The gene mutation changes the amino acid residue 174 of the mouse Afg3l2 protein to S; The amino acid positions of the Afg312 protein are in the direction from N-terminus to C-terminus with reference to the amino acid sequence shown in SEQ ID NO.

1.

2. The construction method according to claim 1, characterized in that The codon corresponding to the 174th amino acid residue of the mouse Afg3l2 protein is TCT.

3. The construction method according to claim 1, characterized in that The construction method includes obtaining Afg3l2 Gene mutation heterozygous offspring; or, the construction method includes obtaining Afg3l2 Offspring homozygous for the gene mutation.

4. The construction method according to claim 1, characterized in that including using at least one gene editing system to make mice Afg3l2 Gene mutations; Optionally, the mouse is modified by at least one CRISPR / Cas gene editing system. Afg3l2 Gene mutations; Alternatively, mice can be modified using the CRISPR / Cas9 gene editing system. Afg3l2 Gene mutations; Optionally, the donor DNA of the CRISPR / Cas gene editing system encodes at least one silent mutation site.

5. The construction method according to any one of claims 1 to 4, characterized in that The construction method comprises introducing a gene editing composition into mouse cells, wherein the gene editing composition comprises: (i) gRNA or a polynucleotide encoding the gRNA; (ii) a Cas nuclease or a polynucleotide encoding a Cas nuclease; (iii) donor DNA; Optionally, the mouse cell comprises a fertilized egg.

6. The construction method according to claim 5, wherein: The target sequence of the gRNA is as shown in SEQ ID NO.2, or the reverse complementary sequence shown in SEQ ID NO.2; Optionally, the silent mutation site encoded by the donor DNA corresponds to the 180th amino acid residue of the Afg3l2 protein; further optionally, the codon corresponding to the 180th amino acid residue of the Afg3l2 protein in the donor DNA is TCG; Optionally, the nucleotide sequence of the donor DNA is shown in SEQ ID NO.3; Optionally, the Cas nuclease includes Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9, Cas12a, Cas12b, SaCas9 or SpCas9 or their mutants and / or proteins, polypeptides or complexes fused with other functional domains.

7. The construction method according to claim 6, characterized in that: The construction method comprises: (a) The gRNA with a target sequence as shown in SEQ ID NO. 2, the donor DNA with a nucleotide sequence as shown in SEQ ID NO. 3, and Cas9 are co-injected into mouse fertilized eggs, and positive F0 generation mice are harvested; (b) The positive F0 mice were crossed with wild-type mice to obtain F1 generation heterozygous mutant mice, which were then crossed with wild-type mice to obtain F2 generation heterozygous mutant mice. The F2 generation heterozygous mutant mice were used as an animal model of autosomal dominant optic atrophy. Optionally, the construction method further comprises: selfing the F2 generation heterozygous mutant mice to obtain F3 generation homozygous mutant mice, and using the F3 generation homozygous mutant mice as an autosomal dominant optic atrophy animal model.

8. A kit for constructing an autosomal dominant optic atrophy animal model, characterized in that: Contains for mice Afg3l2 Gene mutation reagent, Afg3l2 The gene mutation causes the 174th amino acid residue of the mouse Afg3l2 protein to be S.

9. The kit according to claim 8, characterized in that The mice Afg3l2 Reagents for gene mutation include reagents for gene editing; Optionally, the reagents for gene editing include reagents for CRISPR / Cas gene editing; Optionally, the reagents for CRISPR / Cas gene editing include donor DNA encoding at least one silent mutation site; Optionally, the kit comprises the gene editing composition described in claim 6 or 7.

10. Use of the method for constructing an autosomal dominant optic atrophy animal model according to any one of claims 1 to 7, or the kit for constructing an autosomal dominant optic atrophy animal model according to claim 8 or 9 in the evaluation of drugs for autosomal dominant optic atrophy.