Non-small cell lung cancer biomarker and application thereof

Abstract

The invention provides a non-small cell lung cancer biomarker and application thereof, and particularly relates to application of a reagent for detecting snoRNA SNORD78 or a fragment thereof in preparation of a kit, and the kit is used for diagnosing non-small cell lung cancer and / or screening non-small cell lung cancer tissues. Samples obtained from healthy paracancerous lung tissues and non-small cell lung cancer patients in different staging stages are screened, analyzed and verified to find that snoRNA SNORD78 or fragments thereof have significant expression difference in healthy lung tissue samples (paracancerous) and non-small cell lung cancer tissue samples; moreover, obvious expression difference also exists in healthy individual tissues of the non-small cell lung cancer and individual tissues of different stages of the non-small cell lung cancer, a new molecular marker is provided for indicating the non-small cell lung cancer and the disease course development thereof, and a new thought is provided for preventing and / or treating the non-small cell lung cancer.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to biomarkers for non-small cell lung cancer and applications thereof. Background Art

[0002] Non-small cell lung cancers (NSCLCs) are a common type of lung cancer. Early detection, diagnosis, and treatment are particularly important for improving the prognosis of patients with lung adenocarcinoma. Circulating cell-free RNA (cfRNA) has shown potential as a new biomarker in liquid biopsies, with the advantages of high detection sensitivity, strong tissue specificity, and relatively low cost. Currently, many studies have shown that different types of extracellular miRNAs can be used as predictive indicators for various cancers. With the advancement of high-throughput sequencing technology, multiple types of RNA fragments in a sample can be simultaneously detected without prior knowledge of sequence information. Exosomal RNA (exRNA) sequencing has become an important means of exploring new biomarkers. In the blood, small non-coding RNAs have specific secondary structures or are protected by RNA-binding proteins, which can remain stable in the blood, thus having the potential to serve as molecular markers for non-invasive detection in body fluids.

[0003] Therefore, discovering new and more efficient markers for non-small cell lung cancer is of great significance for improving early diagnosis rate and optimizing treatment strategies. Summary of the Invention

[0004] The present invention is based on the inventor's discovery and understanding of the following problems:

[0005] Small nucleolar RNAs (snoRNAs), or snoRNAs, are widely present in the nucleolus of eukaryotic cells. Their primary function is to direct the chemical modification of molecules such as rRNA, snRNA, and tRNA, particularly playing a crucial role in ribosome biogenesis. SnoRNAs generally range from 60 to 300 nucleotides in length and are classified into two major categories: C / D box snoRNAs and H / ACA box snoRNAs, which direct 2'-O-methylation and pseudouridylation, respectively. SnoRNAs typically function as snoRNPs (snoRNA-protein complexes) and bind to multiple ribonucleoproteins, such as FBL, NOP56, and NOP58. Recent studies have revealed that some snoRNAs are aberrantly expressed in cancer and possess non-canonical functions in regulating cell proliferation, apoptosis, and metabolism, suggesting their potential role in tumorigenesis and progression.

[0006] The theory of “regional carcinogenesis” holds that normal tissues, under the action of a certain mechanism, will gradually begin the process of canceration at the molecular level, and this change will first appear on the DNA. Based on the theory of “regional carcinogenesis”, the present invention analyzed and screened the omics data of non-small cell lung cancer collected in TCGA, and found that there were significant differences in the expression levels of snoRNA SNORD78 or its fragments in healthy lung tissue samples (near cancer) and non-small cell lung cancer tissue samples of individuals with non-small cell lung cancer, and its expression level was significantly increased with the increase of non-small cell lung cancer stage. After ROC analysis was performed on another group, the screening results were verified. Therefore, the present invention uses snoRNA SNORD78 or its fragments to effectively diagnose non-small cell lung cancer and / or screen non-small cell lung cancer tissues, providing new alternative markers for further development and improvement of molecular diagnostic methods for non-small cell lung cancer.

[0007] Therefore, in a first aspect, the present invention provides the use of snoRNA SNORD78 or fragments thereof in diagnosing non-small cell lung cancer and / or screening non-small cell lung cancer tissue. According to specific embodiments of the present invention, snoRNA SNORD78 or fragments thereof can accurately distinguish between lung cancer tissue and healthy adjacent non-small cell lung cancer tissue, thereby effectively diagnosing non-small cell lung cancer and / or screening non-small cell lung cancer tissue.

[0008] According to an embodiment of the present invention, the above-mentioned use may further include at least one of the following additional technical features:

[0009] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having at least 80% identity thereto. Exemplarily, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.9% or 100% identity thereto.

[0010] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC) and large cell lung carcinoma (LCLC).

[0011] According to an embodiment of the present invention, the reagent includes at least one of a probe, a primer or a transcriptome sequencing reagent.

[0012] In a second aspect of the present invention, the present invention provides the use of a reagent for detecting snoRNA SNORD78 or a fragment thereof in the preparation of a kit for diagnosing non-small cell lung cancer and / or screening non-small cell lung cancer tissue. According to a specific embodiment of the present invention, snoRNA SNORD78 or a fragment thereof can be used to accurately distinguish between patients with non-small cell lung cancer and healthy adjacent lung tissue. Thus, the reagent for detecting snoRNA SNORD78 or a fragment thereof can effectively detect the expression level of snoRNA SNORD78 or a fragment thereof to diagnose non-small cell lung cancer and / or screen non-small cell lung cancer tissue.

[0013] According to an embodiment of the present invention, the above-mentioned use may further include at least one of the following additional technical features:

[0014] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0015] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0016] Those skilled in the art will understand that the types of the reagents are not particularly limited, and all reagents that can detect the genes are included in the scope of this application, such as reagents used for detection using PCR technology, high-throughput sequencing (transcriptome sequencing) and other methods. Exemplarily, the reagents include at least one of a probe, a primer or a transcriptome sequencing reagent.

[0017] In a third aspect, the present invention provides a kit. According to an embodiment of the present invention, the kit is used to screen biological samples susceptible to and / or suffering from non-small cell lung cancer, and / or to stage non-small cell lung cancer biological samples, the kit comprising: a reagent suitable for detecting snoRNA SNORD78 or a fragment thereof.

[0018] According to an embodiment of the present invention, the kit may further include at least one of the following additional technical features:

[0019] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0020] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0021] Those skilled in the art will understand that the types of the reagents are not particularly limited, and all reagents that can detect the genes are included in the scope of this application, such as reagents used for detection using PCR technology, high-throughput sequencing (transcriptome sequencing) and other methods. Exemplarily, the reagents include at least one of a probe, a primer or a transcriptome sequencing reagent.

[0022] In a fourth aspect of the present invention, the present invention provides use of a preparation for downregulating the expression level of snoRNA SNORD78 or a fragment thereof in preparing a medicament for treating non-small cell lung cancer.

[0023] According to an embodiment of the present invention, the above-mentioned use may further include at least one of the following additional technical features:

[0024] According to an embodiment of the present invention, the preparation is a preparation based on at least one gene editing method selected from RNA interference, zinc finger nuclease, transcription activator-like effector nuclease, and CRISPR / Cas9.

[0025] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0026] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0027] In a fifth aspect, the present invention provides a drug for preventing and / or treating non-small cell lung cancer. According to an embodiment of the present invention, the drug comprises an agent that downregulates the expression level of snoRNA SNORD78 or a fragment thereof.

[0028] According to an embodiment of the present invention, the above-mentioned drug may further include at least one of the following additional technical features:

[0029] According to an embodiment of the present invention, the preparation is a preparation based on at least one gene editing method selected from RNA interference, zinc finger nuclease, transcription activator-like effector nuclease, and CRISPR / Cas9.

[0030] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0031] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0032] According to an embodiment of the present invention, the drug further comprises a pharmaceutically acceptable excipient or carrier.

[0033] Those skilled in the art will appreciate that the drug may be in the form of oral preparations, injection preparations, pills, sustained-release preparations, implants, or aerosols, and is not particularly limited.

[0034] For example, the drugs include, but are not limited to, drugs for human use and drugs for veterinary use. The aforementioned drugs for veterinary use may be for pets, livestock, or wild animals.

[0035] In a sixth aspect, the present invention provides a method for screening a biological sample for non-small cell lung cancer. According to an embodiment of the present invention, the method comprises: (1) determining the expression level of snoRNA SNORD78 or a fragment thereof in the biological sample; and (2) comparing the expression level of snoRNA SNORD78 or a fragment thereof obtained in step (1) with a predetermined threshold value to determine whether the biological sample is a non-small cell lung cancer biological sample.

[0036] According to an embodiment of the present invention, the above method may further include at least one of the following additional technical features:

[0037] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0038] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0039] According to an embodiment of the present invention, the biological sample includes at least one of saliva, sweat, urine, feces, blood, plasma, serum, cells and tissues.

[0040] According to some specific embodiments of the present invention, the threshold is pre-set. The expression level of snoRNA SNORD78 or a fragment thereof in the biological sample to be screened is compared with the threshold to determine the status of the biological sample to be screened. The threshold can be a numerical value or a numerical range. The threshold setting method is not particularly limited. For example, based on the mean expression level of snoRNA SNORD78 or a fragment thereof in biological samples in a known healthy state or at various stages of non-small cell lung cancer, the threshold corresponding to the biological sample can be set to a 95% confidence interval of the mean.

[0041] It should be noted that, depending on the purpose or requirements, there may be different requirements for the credibility of the sample status determination results, and those skilled in the art may choose different significance levels or thresholds.

[0042] In a seventh aspect, the present invention provides a method for determining whether an individual has non-small cell lung cancer. According to an embodiment of the present invention, the method comprises: (1) determining the expression level of snoRNA SNORD78 or a fragment thereof in a lung tissue sample of the individual; and (2) comparing the expression level of snoRNA SNORD78 or a fragment thereof obtained in step (1) with a predetermined threshold value to determine whether the individual has non-small cell lung cancer.

[0043] According to an embodiment of the present invention, the above method may further include at least one of the following additional technical features:

[0044] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0045] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0046] According to some specific embodiments of the present invention, the threshold value is pre-set. Exemplarily, the expression level of snoRNA SNORD78 or a fragment thereof in a sample of the individual to be tested is compared with the threshold value to determine the status of the individual to be tested. The threshold value can be a numerical value or a numerical range, and the threshold value setting method is not particularly limited. Exemplarily, based on the mean expression level of snoRNA SNORD78 or a fragment thereof in biological samples of individuals with known healthy status or individuals at various stages of non-small cell lung cancer, the threshold value corresponding to the individual can be set to a 95% confidence interval of the mean value.

[0047] It should be noted that, depending on the purpose or requirements, there may be different requirements for the credibility of the results of determining individual status, and those skilled in the art may choose different significance levels or thresholds.

[0048] In its eighth aspect, the present invention provides a device for determining whether an individual has non-small cell lung cancer. According to an embodiment of the present invention, the device includes: a gene expression level determination unit for determining the expression level of snoRNA SNORD78 or a fragment thereof in a lung tissue sample of the individual; and a comparison unit for comparing the obtained expression level of snoRNA SNORD78 or a fragment thereof with a predetermined threshold value to determine whether the individual has non-small cell lung cancer. The device according to an embodiment of the present invention can accurately determine whether an individual is at high risk for non-small cell lung cancer or has non-small cell lung cancer.

[0049] In a ninth aspect, the present invention provides an electronic device. According to an embodiment of the present invention, the electronic device comprises: a memory storing a computer program; and one or more processors configured to execute the computer program to implement the method for determining whether an individual has non-small cell lung cancer and / or staging non-small cell lung cancer as described in the seventh aspect.

[0050] In a tenth aspect of the present invention, the present invention provides use of a biological model in screening drugs, wherein the biological model carries exogenous snoRNA SNORD78 or a fragment thereof.

[0051] According to an embodiment of the present invention, the above-mentioned use may further include at least one of the following additional technical features:

[0052] According to an embodiment of the present invention, the medicament is used for preventing and / or treating non-small cell lung cancer.

[0053] According to an embodiment of the present invention, the biological model includes at least one of a cell, a tissue, an organoid, and an animal model.

[0054] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0055] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0056] In an eleventh aspect of the present invention, a method for screening a drug is provided. According to an embodiment of the present invention, the drug is used to prevent and / or treat non-small cell lung cancer, the method comprising: administering a candidate drug to a subject, detecting the expression level of snoRNA SNORD78 or a fragment thereof in a lung tissue sample of the subject before and after administration, and wherein the candidate drug that downregulates the expression level of snoRNA SNORD78 or a fragment thereof after administration is suitable for preventing and / or treating non-small cell lung cancer.

[0057] According to an embodiment of the present invention, the method for screening drugs may further include at least one of the following additional technical features.

[0058] According to an embodiment of the present invention, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto.

[0059] According to an embodiment of the present invention, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

[0060] In addition, the subject can be any mammal, such as a human, mouse, pig, or monkey.

[0061] Compared with the prior art, the beneficial effects of the present invention include at least:

[0062] The present invention screens for the differentially expressed gene snoRNA SNORD78 or a fragment thereof by performing differential gene expression analysis on lung cancer tissue and healthy adjacent cancer tissue data from individuals with non-small cell lung cancer. Based on this differential gene, ROC analysis is then performed on lung cancer tissue and healthy adjacent cancer tissue data from another group of individuals with non-small cell lung cancer. It is found that this gene can effectively distinguish between healthy adjacent cancer lung tissue and non-small cell lung cancer tissue. Therefore, it can be used to screen non-small cell lung cancer tissue and, further, can be used as a biomarker for diagnosing non-small cell lung cancer.

[0063] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0065] Figure 1 The results of the analysis of the Log2(CPM+1) values ​​of the snoRNA marker of Example 1 of the present invention between the groups of healthy adjacent lung tissue (normal), individuals with lung adenocarcinoma stage I or II (non-metastatic) (Primary), and individuals with lung adenocarcinoma stage III or IV (metastatic) (Metastasis) are shown;

[0066] Figure 2The results of the analysis of the CPM values ​​of the snoRNA markers of Example 1 of the present invention between the groups of healthy adjacent lung tissue (normal), individuals with lung adenocarcinoma stage I or II (non-metastatic) (Primary), and individuals with lung adenocarcinoma stage III or IV (metastatic) (Metastasis) are shown;

[0067] Figure 3 The figure shows the ROC curve result of the snoRNA marker of Example 2 of the present invention as an indicator for diagnosing lung adenocarcinoma. DETAILED DESCRIPTION

[0068] The embodiments of the present invention are described in detail below, and examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to be used to explain the present invention, but should not be understood as limiting the present invention.

[0069] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Thus, a feature specified as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "plurality" or "multiple" means at least two or two, for example, two, two, three, three, etc., unless otherwise specifically defined.

[0070] In this document, the terms “include”, “have” or “include” are open expressions, that is, they include the contents specified in the present invention but do not exclude other aspects.

[0071] As used herein, the term "optionally" generally means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0072] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0073] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meaning commonly understood by those skilled in the art to which the present invention belongs.

[0074] In this article, "molecular marker" is synonymous with "biomarker", which refers to cellular / biochemical or molecular changes that can be detected from biological media, including various body fluids, tissues, cells, feces, hair, exhaled breath, etc., in this article it refers to lung tissue.

[0075] Identity, the present invention, for the purpose of comparing two or more nucleotide sequences, the percentage of "sequence identity" between a first sequence and a second sequence can be calculated by dividing [the number of nucleotides in the first sequence that are identical to the nucleotides at corresponding positions in the second sequence] minus [the total number of nucleotides in the first sequence], and then multiplying by [100%], where each deletion, insertion, substitution or addition of a nucleotide in the second nucleotide sequence - relative to the first nucleotide sequence - is considered a difference at a single nucleotide (position).

[0076] Alternatively, the degree of sequence identity between two or more nucleotide sequences can be calculated using known computer algorithms for sequence alignment, such as NCBI Blast v2.0, using standard settings.

[0077] Some other techniques, computer algorithms and setups for determining the degree of sequence identity are described, for example, in WO 04 / 037999, EP 0 967 284, EP 1 085 089, WO 00 / 55318, WO 00 / 78972, WO 98 / 49185 and GB 2 357 768-A.

[0078] It should be noted that the length of the "snoRNA SNORD78 or its fragment" described in this application is not particularly limited. It can be a complete gene or a fragment of a gene. Furthermore, according to different experimental purposes, relevant nucleic acid fragments of any length can be selected.

[0079] As used herein, the terms "treat" and "alleviate" refer to methods used to obtain a desired pharmacological and / or physiological effect. The effect may be preventive in terms of completely or partially preventing a disease or its symptoms, and / or therapeutic in terms of partially or completely curing a disease and / or the adverse effects caused by the disease. "Treatment" as used herein covers diseases in mammals, particularly humans, and includes: (a) preventing the occurrence of a disease or condition in individuals who are susceptible to the disease but have not yet been diagnosed with the disease; (b) inhibiting the disease, such as arresting the progression of the disease; or (c) alleviating the disease, such as alleviating the symptoms associated with the disease. "Treatment" as used herein covers any medication administered to an individual to treat, cure, alleviate, improve, reduce or inhibit the individual's disease, including but not limited to administering a drug containing the drugs described herein to an individual in need.

[0080] In the present context, the term "pharmaceutically acceptable" means that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients of the formulation and / or the mammal being treated with it. Preferably, "pharmaceutically acceptable" means approved or approvable by a regulatory agency or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[0081] In the present context, the term "pharmaceutically acceptable carrier" can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. Specific examples can be one or more of water, saline, phosphate buffered saline, D-glucose, glycerol, ethanol and combinations thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the drug formulation. Of course, a pharmaceutically acceptable carrier can further include minor amounts of auxiliary substances such as wetting or emulsifying agents, preservatives or buffers, which enhance the shelf life or effectiveness of the agent.

[0082] For example, the medicaments of the present application can be suitable for parenteral administration (e.g. intravenous, subcutaneous, intraperitoneal, intramuscular). These medicaments can be prepared in various forms. For example, liquid, semi-solid and solid dosage forms, etc., including but not limited to liquid solutions (e.g. injection solutions and infusion solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. Typical medicaments are in the form of oral preparations, injection solutions or infusion solutions. The medicaments can be administered orally, by intravenous infusion or injection or intramuscular or subcutaneous injection.

[0083] In the present context, the term "pharmaceutically acceptable excipient" can include any solvent suitable for the particular dosage form of interest. Except to the extent that any conventional excipient is incompatible with the glutamine or derivative thereof disclosed herein, for example, for which its use is contemplated by the present disclosure, its use is contemplated to the extent that it produces any adverse biological effect or interacts in a deleterious manner with any other component(s) of a pharmaceutically acceptable composition.

[0084] In the present context, the staging of non-small cell lung cancer (NSCLC) uses the TNM staging system (developed jointly by the American Joint Committee on Cancer (AJCC) and the International Union Against Cancer (UICC)), the latest version of which is the 9th edition (effective in 2024). The following are the detailed staging and criteria for judgment:

[0085]

[0086] As used herein, "downregulation" is used to describe a change in the expression level of a gene. For example, downregulating the expression level of a gene refers to a decrease in the expression level of the gene. Downregulation is typically determined by comparing the expression level of the gene to a threshold level. For example, downregulation indicates that the expression level of the gene is reduced or significantly reduced compared to the expression level of the gene in a healthy animal that has not undergone any artificial bioengineering.

[0087] In this article, the term "significantly" means statistically significantly higher (or lower) or significantly and substantially higher (or lower) than a specific value, which may be the aforementioned threshold value. For example, compared with the expression level of a specific gene in a healthy adjacent lung tissue group, the expression level of the gene in the non-small cell lung cancer patient group is statistically significantly higher (or lower) or significantly and substantially higher (or lower) than that in the healthy adjacent lung tissue group.

[0088] In this article, a "confidence interval" refers to an estimated interval for a population parameter constructed from a sample statistic. In statistics, a confidence interval for a probability sample is an interval estimate of a population parameter from that sample. A confidence interval indicates the degree to which the true value of the parameter falls within the range of the measured result with a certain probability. A confidence interval provides a measure of confidence in the measured value of the parameter, the "certain probability" required above, and this probability is called the confidence level.

[0089] The scheme of the present invention will be explained below with reference to the examples. Those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in this field or in accordance with the product instructions are used. Reagents or instruments used without indicating the manufacturer are conventional products that can be obtained commercially. Unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

[0090] Example 1 Screening of snoRNA markers

[0091] TCGA (https: / / portal.gdc.cancer.gov / ) is a collection of omics data from 33 cancer types collected and organized by the National Cancer Institute (NCI) and the National Human Genome Research Institute (NHGRI). This example uses data from TCGA for biomarker screening of lung cancer tissue samples and healthy adjacent lung tissue samples from non-small cell lung cancer patients. The specific screening methods involved are as follows:

[0092] 1.1 Research subjects

[0093] The use of individual samples used in this application has been approved by the individuals themselves, as follows:

[0094] A total of 378 lung adenocarcinoma (LUAD) samples and 78 lung squamous cell carcinoma (LUSC) samples were included. Patients were confirmed to have lung adenocarcinoma based on the AJCC biopsy specimen pathological examination and clinical diagnosis inclusion criteria.

[0095] 51 healthy adjacent tumor (HD) samples: Inclusion criteria were: normal adjacent tumor tissues of non-small cell lung cancer tissues, individuals not receiving interferon or other antiviral drug treatment.

[0096] The samples used in Example 1 are as follows:

[0097] 74 lung adenocarcinoma samples and 3 healthy adjacent tumor (HD) samples;

[0098] There were 14 lung squamous cell carcinoma samples and 6 healthy adjacent tumor (HD) samples.

[0099] The samples used in Example 2 are as follows:

[0100] 304 lung adenocarcinoma samples and 15 healthy adjacent normal (HD) samples;

[0101] There were 64 lung squamous cell carcinoma samples and 27 healthy adjacent tumor (HD) samples.

[0102] 1.2 Test methods and experimental process

[0103] The present invention adopts the small RNA sequencing method to perform quantitative detection of snoRNA, which specifically includes the following operations:

[0104] 1.2.1 Extraction of total RNA from tissues using Trizol lysis and alcohol precipitation

[0105] (1) Grind the lung cancer and healthy adjacent tissue blocks collected in section 1.1 rapidly with liquid nitrogen, add 1 mL of Trizol (Thermo Fisher Scientific, lot number 15596026), mix thoroughly, and let stand at room temperature for 5 minutes.

[0106] (2) Add 200 μL of chloroform, shake and mix, let stand at room temperature for 5 minutes, and centrifuge at 12,000 × g for 15 minutes at 4°C;

[0107] (3) Take 500 μL of the supernatant obtained by centrifugation, add 500 μL of isopropanol, mix well, and freeze at -20°C for 30 minutes;

[0108] (4) Centrifuge the above system at 12,000 × g for 15 minutes at 4°C. A small amount of white precipitate will be visible at the bottom of the tube. Discard the supernatant and add 1 mL of 75% (volume percentage) ethanol aqueous solution to the precipitate to wash it. Centrifuge at 12,000 × g for 5 minutes at 4°C.

[0109] (5) Discard the supernatant, retain the pellet and dry it in a clean bench for 5 minutes. Add 10 μL of DNase / RNase-Free Water to the pellet and resuspend it to obtain plasma total RNA for downstream experiments and analysis, or store it in a -80°C refrigerator for future use.

[0110] 1.2.2 Small RNA sequencing library construction

[0111] This section uses the reagents provided by the QIAseq miRNA Library Kit as an example. Those skilled in the art will appreciate that other kits can be substituted. The small RNA sequencing library construction process is as follows:

[0112] ⑴ Connecting adapters and reverse transcription

[0113] ①3' ligation reaction

[0114] a) For low RNA input (≤10 ng) or serum / plasma samples, dilute the NGS 3' adapter in nuclease-free water. See Table 1 for specific dilution ratios.

[0115] Table 1: 3' adapter sequence dilution method

[0116]

[0117] b) Prepare the 3' ligation reaction solution on ice. The reaction system is shown in Table 2.

[0118] Table 2: 3' ligation reaction system

[0119] Components Volume / reaction Nuclease-free water variable 3' linker sequence 1 μL RI 1 μL 3' ligase 1 μL 3' buffer 2μL 2×miRNA Ligation Activator 10 μL Template RNA variable Total 20 μL

[0120] c) Add the template RNA to each tube and mix the 3' ligation reaction solution.

[0121] d) The above system was incubated at 28°C for 1 hour, then at 65°C for 20 minutes, and finally kept at 4°C (for at least 5 minutes).

[0122] ②5' ligation reaction

[0123] a) For low RNA input (≤10 ng) or serum / plasma samples, dilute the 5' adapter with nuclease-free water. See Table 3 for specific dilution ratios.

[0124] Table 3: 5' Linker Dilution

[0125]

[0126] b) Prepare the 5' ligation reaction solution on ice. The reaction system is shown in Table 4.

[0127] Table 4: 5' ligation reaction system

[0128]

[0129]

[0130] c) Incubate at 28°C for 30 minutes, then at 65°C for 20 minutes, and finally hold at 4°C.

[0131] d) Proceed with reverse transcription immediately.

[0132] ③Reverse transcription

[0133] a) Add 2 μL of RT Start Reagent to each tube.

[0134] b) Incubate at the temperature and time shown in Table 5.

[0135] Table 5: RT start reagent incubation temperature settings

[0136] temperature Duration 75℃ 2 minutes 70℃ 2 minutes 65℃ 2 minutes 60℃ 2 minutes 55℃ 2 minutes 37℃ 5 minutes 25℃ 5 minutes 4℃ ∞

[0137] c) For low RNA input (≤10 ng) or serum / plasma samples, dilute the RT primers in nuclease-free water. Specific dilution ratios are shown in Table 6.

[0138] Table 6: RT Primer Dilution

[0139]

[0140] d) Prepare the reverse transcription reaction system on ice. See Table 7 for the reaction system.

[0141] Table 7: Reverse transcription reaction system

[0142]

[0143]

[0144] e) After incubation at 50°C for 1 hour, the mixture was further incubated at 70°C for 15 minutes and finally maintained at 4°C for at least 5 minutes.

[0145] ⑵QMN magnetic bead preparation and cDNA purification

[0146] ①QMN magnetic bead preparation

[0147] Thoroughly vortex QIAseq magnetic beads and Bead Binding Buffer.

[0148] Add 400 μL of QIAseq magnetic beads (the beads storage buffer is thicker) to a 2 mL centrifuge tube. This amount of beads is sufficient for the cDNA purification and library purification protocols for one sample. After a brief centrifugation, immediately separate the beads onto a magnetic rack.

[0149] When the beads have completely migrated, carefully remove and discard the supernatant.

[0150] Remove the tube from the magnetic rack, carefully pipette 150 μL of Bead Binding Buffer onto the magnetic beads, and vortex thoroughly to completely resuspend the beads. After a brief centrifugation, immediately separate the magnetic beads onto the magnetic rack.

[0151] When the magnetic beads have completely migrated, carefully remove and discard the supernatant. Note: Remove as much supernatant as possible without disturbing the magnetic beads.

[0152] Remove the tube from the magnetic rack, carefully pipette 400 μL of Bead Binding Buffer onto the magnetic beads, and vortex thoroughly to completely resuspend the beads.

[0153] The QMN magnetic beads are ready and we can proceed to cDNA purification.

[0154] ②cDNA purification

[0155] Important: Always ensure that the QMN magnetic beads are thoroughly mixed. This requires working quickly and resuspending the beads immediately before use. If there is a delay during a step, simply vortex the beads.

[0156] Centrifuge the tube or plate containing the cDNA reaction solution.

[0157] Add 143 μL of QMN magnetic beads to the tube or plate. Vortex for 3 seconds and briefly centrifuge again; Note: When using a plate, centrifuge at 2000 rpm for 2 minutes.

[0158] Incubate at room temperature (15-25°C) for 5 minutes.

[0159] Place the tube or plate on the magnetic rack and incubate for approximately 4 minutes until the magnetic beads have completely migrated. Note: Ensure that the magnetic beads have completely migrated before continuing.

[0160] Discard the supernatant, retain the magnetic beads, and keep the tube on the magnetic rack.

[0161] While on the magnetic stand, add 200 μL of 80% ethanol to the tubes or plates and immediately remove and discard the ethanol wash.

[0162] Repeat the ethanol wash process, immediately removing and discarding the ethanol wash solution. Note: To ensure all ethanol is removed, briefly centrifuge (at 2000 rpm if using a plate) and then return the tubes or plates to the magnetic rack. Remove the ethanol using a 200 μL pipette, followed by a 10 μL pipette to remove any residual ethanol.

[0163] Air dry the beads at room temperature for 10 minutes on a magnetic rack; NOTE: Check visually to confirm that the particles are completely dry.

[0164] While on the magnetic stand, elute the beads by adding 17 μL of nuclease-free water; close the tube cap or cover the plate, and remove it from the magnetic stand.

[0165] Carefully pipette up and down until the beads are completely resuspended. Briefly centrifuge and incubate at room temperature for 2 minutes.

[0166] Place the tube or plate back on the magnetic rack and incubate for approximately 2 minutes until the magnetic beads have completely migrated. Note: Ensure that the magnetic beads have completely migrated before continuing.

[0167] Transfer 15 μL of eluted cDNA to a clean tube; store the purified cDNA product in a freezer at -20°C or continue library amplification.

[0168] (3) Library amplification using HT Plate Index

[0169] ①Configure library amplification reaction

[0170] On ice, prepare the library amplification reaction according to the table below.

[0171] Table 8: Library amplification reaction system

[0172]

[0173] ②Configure thermal cycle program

[0174] Set the thermal cycler program according to Table 9, and the number of cycles is set according to the starting amount of RNA (see Table 10).

[0175] Table 9: Library amplification procedure

[0176] stage time temperature Insulation 15 minutes 95℃ Three-step loop (repeat N times) -transsexual 15 seconds 95℃ -annealing 30 seconds 60℃ -extend 15 seconds 72℃ Insulation 2 minutes 72℃ refrigeration ∞ 4℃

[0177] Table 10: Library amplification cycle number

[0178]

[0179]

[0180] ③Perform library amplification reaction

[0181] Place the prepared library amplification reaction system in a thermal cycler and run it. After the run, refrigerate at 4°C for at least 5 minutes.

[0182] ④Library purification

[0183] a) Centrifuge the amplified product of the library briefly to ensure that the solution settles to the bottom.

[0184] b) Add 37.5 μL of QMN magnetic beads to each well, shake for 3 seconds, and then quickly centrifuge; incubate the supernatant at room temperature for 5 minutes.

[0185] c) Place the plate on a magnetic stand and let it sit for about 4 minutes until the beads are completely aggregated.

[0186] d) Add 65 μL of QMN magnetic beads to the transferred 72.5 μL supernatant, shake for 3 seconds, and then quickly centrifuge; incubate the supernatant at room temperature for 5 minutes.

[0187] e) Place the beads on the magnetic stand again until they are completely aggregated.

[0188] f) Discard the supernatant, retain the magnetic beads and keep the plate on the magnetic stand. Add 200 μL of 80% ethanol to the magnetic beads, then immediately remove and discard.

[0189] g) Repeat the ethanol wash; air-dry the beads for approximately 10 minutes, ensuring they are completely dry to the naked eye.

[0190] h) Elute the DNA with 17 μL of nuclease-free water and remove the plate from the magnetic stand. Gently pipette to ensure the beads are fully suspended, centrifuge briefly, and incubate at room temperature for 2 minutes.

[0191] i) Place the beads on the magnetic stand again and let them sit for about 2 minutes until the beads are completely aggregated.

[0192] j) Transfer 15 μL of eluted DNA to a new plate to prepare the final miRNA sequencing library.

[0193] k) Store the library at -20°C or proceed to the Library Pre-Sequencing QC step. Libraries with insert fragment lengths that meet expectations can be sequenced.

[0194] The small RNA sequencing data processing pipeline cfPeak was constructed based on our laboratory's previous research.

[0195] Preprocessing was performed using cfPeak (https: / / github.com / HUNNNGRY / cfPeak), including removal of library adapters in sequencing reads, sequential alignment to human transcriptome small RNA annotations including miRNA and snoRNA, scanning of fragmented signal peaks using cfPeak or other classic peak region recognition methods, and relative quantification of the signal peak content on all human transcriptome small RNAs including miRNA and snoRNA in the sample according to the total number of reads aligned to the human genome.

[0196] 1.3 Screening of snoRNA markers

[0197] Tumors and adjacent tissues were distinguished based on the TCGA-LUAD numbers 01 and 11. Only 01A was selected for the tumor, and only a single tumor sample was retained for each patient. In order to make the experimental results more detailed, this example also staged the tumor tissue, and the grouping of tumor tissue was mainly based on the TNM staging. TNM stage I or II was considered non-metastatic, and samples in TNM stage III or IV were considered metastatic. SnoRNAs differentially expressed in non-metastatic versus adjacent tissues or metastatic versus non-metastatic tumor tissues were defined as having an edgeR differential expression-corrected P value of less than 0.01 and a log-transformed fold change absolute value greater than 0.6.

[0198] This example screened for candidate snoRNAs with the highest adjusted P-values ​​based on the following criteria: significantly higher expression in TNM stage I / II / III / IV tumors relative to adjacent adjacent tissues. The results showed that snoRNA SNORD78 had the highest adjusted P-value, and its specific sequence is shown in SEQ ID NO: 1.

[0199] AACAAATGATTTTGTGGAAGTTCTGAT (SEQ ID NO: 1).

[0200] In addition, this example statistically analyzed the CPM (Count Per Million) value of snoRNA SNORD78 for LUAD and LUSC in non-small cell lung cancer and two common cancers, hepatocellular carcinoma (LIHC) and head and neck squamous cell carcinoma (HNSC). The CPM value was directly calculated by the cpm() function of the EdgeR v3.28.1R package. The results are shown in Figure 2. Figure 1 As shown in the figure, CPM value can significantly distinguish lung cancer tissue from healthy adjacent tissue of non-small cell lung cancer, and can also significantly distinguish high and low stages of LUSC tumors; Figure 2 The results showed that the integrated coverage of sequencing reads of healthy adjacent lung tissue of non-small cell lung cancer, lung cancer tissue in the non-metastatic stage, and lung cancer tissue samples in the metastatic stage also showed obvious differences and clear fragment boundaries, that is, snoRNA SNORD78 can effectively distinguish between lung cancer tissue samples and adjacent tissue samples of non-small cell lung cancer. The threshold of log2CPM is 1.2786. When this value is greater than 1.2786, the tissue can be judged as non-small cell lung cancer tissue. If it is lower than this value, the tissue is judged as healthy lung tissue.

[0201] Example 2 Validation of snoRNA SNORD78 Gene Marker

[0202] In order to verify the analysis results in Example 1, this example further compares validation group samples from TCGA, screened with the same inclusion criteria and different from Example 1, specifically: 304 lung adenocarcinoma samples, 15 healthy adjacent cancer (HD) samples; 64 lung squamous cell carcinoma samples, 27 healthy adjacent cancer (HD) samples. Specifically, both the cancerous tissue and the healthy adjacent cancer tissue were split into a training set (discovery set) and a test set at a ratio of 4:1. This example statistically analyzed the relative expression of the snoRNA SNORD78 gene in lung cancer tissue samples and adjacent cancer tissue samples from patients with non-small cell lung cancer. The acquisition and processing of the validation group sequencing data were performed with reference to Example 1. The detection method for the relative expression of the snoRNA SNORD78 gene was a conventional detection method in the art. Finally, the area under the ROC (Receiver-operating characteristic) curve AUC was estimated. The larger the AUC value, the higher the diagnostic ability, and the AUC value was used to reflect the diagnostic ability of the marker for lung adenocarcinoma.

[0203] Specific results such as Figure 3As shown in the figure, in the training set with balanced split of confounding clinical factors, the confusion matrix of the log2CPM thresholds of the most significantly differentially expressed candidate markers in the set was statistically analyzed, and the AUROC was 0.848 and the AUPR was 0.982; while in the remaining independent test set, the AUROC was 0.770 and the AUPR was 0.972; the results showed that the marker has a certain potential to distinguish normal adjacent cancer tissues from tumor tissues.

[0204] In the description of this specification, reference to the terms "one embodiment," "some embodiments," "an embodiment," or "a specific embodiment" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment are included in at least one embodiment of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment. Moreover, the specific features, structures, materials, or characteristics described can be combined in any suitable manner in any one or more embodiments. In addition, those skilled in the art may combine and combine different embodiments and features of different embodiments described in this specification without any contradiction.

[0205] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.

Claims

1. Use of a reagent for detecting snoRNA SNORD78 or a fragment thereof in preparing a kit, characterized in that: The kit is used for diagnosing non-small cell lung cancer and / or screening non-small cell lung cancer tissues.

2. The use according to claim 1, characterized in that The snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto; Optionally, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma; Optionally, the reagents include at least one of probes, primers, or transcriptome sequencing reagents.

3. A kit, characterized in that The kit is used for screening biological samples susceptible to and / or suffering from non-small cell lung cancer, and / or screening non-small cell lung cancer tissues, and the kit contains reagents suitable for detecting snoRNA SNORD78 or a fragment thereof.

4. The kit according to claim 3, wherein The snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto; Optionally, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma; Optionally, the reagents include at least one of probes, primers, or transcriptome sequencing reagents.

5. Use of a preparation for downregulating the expression level of snoRNA SNORD78 or a fragment thereof in the preparation of a medicament for treating non-small cell lung cancer.

6. The use according to claim 5, characterized in that The preparation is based on at least one gene editing method selected from RNA interference, zinc finger nuclease, transcription activator-like effector nuclease, and CRISPR / Cas9; Optionally, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto; Optionally, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma.

7. A drug for preventing and / or treating non-small cell lung cancer, characterized in that: The medicine comprises an agent for downregulating the expression level of snoRNA SNORD78 or a fragment thereof.

8. The drug according to claim 7, characterized in that The preparation is based on at least one gene editing method selected from RNA interference, zinc finger nuclease, transcription activator-like effector nuclease, and CRISPR / Cas9; Optionally, the snoRNA SNORD78 has the nucleotide sequence shown in SEQ ID NO: 1 or a nucleotide sequence having at least 80% identity thereto; Optionally, the non-small cell lung cancer includes at least one of lung adenocarcinoma, lung squamous cell carcinoma and large cell carcinoma; Optionally, the drug further comprises a pharmaceutically acceptable excipient or carrier.

9. A method for screening biological samples for non-small cell lung cancer, characterized in that: include: (1) determining the expression level of snoRNA SNORD78 or a fragment thereof in the biological sample; (2) comparing the expression level of the snoRNA SNORD78 or its fragment obtained in step (1) with a predetermined threshold value to determine whether the biological sample is a non-small cell lung cancer biological sample.

10. A method for determining whether an individual has non-small cell lung cancer, characterized in that include: (1) determining the expression level of snoRNA SNORD78 or a fragment thereof in a lung tissue sample of the individual; (2) comparing the expression level of the snoRNA SNORD78 or its fragment obtained in step (1) with a predetermined threshold value to determine whether the individual suffers from non-small cell lung cancer.

11. A device for determining whether an individual has non-small cell lung cancer and / or staging non-small cell lung cancer, characterized in that: include: a gene expression level determination unit, configured to determine the expression level of snoRNA SNORD78 or a fragment thereof in a lung tissue sample of the individual; A comparing unit is used to compare the obtained expression level of the snoRNA SNORD78 or a fragment thereof with a predetermined threshold value, so as to determine whether the individual suffers from non-small cell lung cancer and / or to stage the non-small cell lung cancer.

12. An electronic device, characterized in that: include: a memory having a computer program stored thereon; and one or more processors, configured to execute the computer program to implement the method of determining whether an individual has non-small cell lung cancer and / or staging non-small cell lung cancer according to claim 10.

Images