Bo-white peony root self-incompatible strain screening method and application of identification primer in screening

By extracting the DNA of Paeonia lactiflora L. by the CTAB method and using specific PCR identification primers and electrophoresis analysis, the problem of self-incompatibility screening of Paeonia lactiflora L. was solved, efficient and accurate screening was achieved in the seedling stage, and the quality of the medicinal materials and breeding efficiency were improved.

CN120758653APending Publication Date: 2025-10-10BOZHOU VOCATIONAL & TECHNICAL COLLEGE +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510734903.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-04
Publication Date
2025-10-10

AI Technical Summary

Technical Problem

The self-incompatibility problem of Paeonia lactiflora causes difficulties in reproduction, and the existing technology lacks effective molecular-level screening methods, resulting in variety degeneration and unstable medicinal material quality.

Method used

Genomic DNA of Paeonia lactiflora was extracted by CTAB method, and specific PCR identification primers (5'ACTGGTGGAACGCAGGAAAA3' and 5'TCAAGTGTCACCTTCCTCGC3') were used for PCR amplification. PCR products were analyzed by agarose gel electrophoresis to determine whether the plants were self-incompatible lines.

Benefits of technology

It has achieved the simple and accurate screening of self-incompatible strains at the seedling stage, improved the efficiency of Bobaishao reproduction and the stability of medicinal material quality, reduced costs, and provided a basis for molecular marker-assisted breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120758653A_ABST
    Figure CN120758653A_ABST
Patent Text Reader

Abstract

The invention discloses a method for screening self-incompatible strains of Bo-white peony roots. The method is characterized by comprising the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) of Bo-white peony roots; 2, carrying out a PCR amplification reaction; an identification primer is composed of 5 'ACTGGTGGAACGCAGGAAAA3'and 5' TCAAGTGTCACCTTCCTGC3 ', and an identification primer is composed of 5' ACTGGTGGAACGCAGGAAAA3 'and 5' A PCR reaction system is carried out in a centrifugal tube, the reaction system comprises a PCR buffer solution, magnesium dichloride, deoxyribonucleoside triphosphate, an identification primer, high-fidelity Taq DNA polymerase, a template and sterile ultrapure water, the centrifugal tube is placed in a PCR instrument, and PCR reaction parameters are set; 3, analyzing a PCR amplification product, and judging whether the Bo-white paeony root plant is a self-incompatible strain or not according to the characteristics of the product; the method is simple, reliable and efficient, and samples can be screened from the molecular level in the seedling stage. Meanwhile, the invention discloses application of the identification primer in screening of self-incompatible strains of Bo-white peony roots.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of designing self-incompatibility primers for peony, and in particular to a method for screening self-incompatibility strains of Paeonia lactiflora and the application of identification primers in the screening. Background Art

[0002] White peony root from Bozhou is a premium medicinal herb. Its large size, white color, rich powder, fragrant aroma, and exquisite processing make it a favorite among domestic and international merchants. It is a specialty medicinal herb of Bozhou and one of Anhui's four famous medicinal herbs. Currently, there are two main methods for propagating white peony root from Bozhou: one is to propagate by division from old roots at harvest, which is the authentic Bo white peony. However, long-term asexual propagation has led to serious degradation of the herb, resulting in dwarf plants, low disease and pest resistance, and susceptibility to fungal infection, seriously affecting the quality and yield of the herb. The other method involves directly harvesting seeds from wild white peony, but this method results in a low cross-pollination rate, a fruit set rate of less than 1%, and variable plant and root quality. These production issues have resulted in an unstable and uncontrollable supply of the active ingredients in Bozhou white peony, seriously impacting the future development of Bo white peony, a renowned Anhui medicine. Sexual propagation is a key method for restoring the herb. However, according to researchers' observations over the years, Paeonia lactiflora has a serious self-incompatibility problem, which makes it difficult for it to successfully pollinate naturally. The specific reason is that Paeonia lactiflora has long been propagated vegetatively with root buds, which has led to the degeneration of its sexual reproductive organs, making it unable to bear fruit through self-pollination, and there is a serious self-incompatibility phenomenon in high generations.

[0003] The study of self-incompatibility has long been a hot topic in the field of reproductive development. Sterility has been observed in over 300 plant species. Based on the genetic determination of pollen recognition specificity, self-incompatibility can be divided into two main forms: sporophytic self-incompatibility and gametophytic self-incompatibility. In sporophytic self-incompatibility, the pollen compatibility phenotype is determined by the S genotype of the pollen-producing diploid parent (i.e., the sporophyte); in gametophytic self-incompatibility, the pollen compatibility phenotype is determined by the S genotype of the haploid pollen (i.e., the gametophyte). The most widespread type of self-incompatibility is known as the S nuclease-type. Cytological and molecular biological studies on anther formation and function have been conducted in a variety of crops, including the Poaceae, Solanaceae, and Cruciferae families. These studies have elucidated the period, cytological characteristics, and molecular mechanisms of self-incompatibility in these plants, and explored the abortion process of plant self-incompatibility. Research on the reproductive developmental system of Paeonia lactiflora has progressed from morphological to molecular levels, but little research has been conducted on self-incompatibility in Paeonia lactiflora. The lack of cell and molecular research on self-incompatibility in Paeonia lactiflora (Baibai Paeonia lactiflora) has hampered its development. Currently, there is no research specifically addressing self-incompatibility in Paeonia lactiflora, making it difficult to select plants with self-incompatibility. Therefore, a new, reliable, and efficient method for molecular-level sample screening at the seedling stage is urgently needed. Summary of the Invention

[0004] In view of the above-mentioned defects in the prior art, the present invention provides a method for screening self-incompatible strains of Paeonia lactiflora. The method is simple, reliable and efficient, and can screen samples at the molecular level during the seedling stage.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] The present invention provides a method for screening self-incompatible strains of Paeonia lactiflora, comprising the following steps:

[0007] Step 1: Extract genomic DNA from Paeonia lactiflora plants

[0008] 1) Select fresh peony leaves, clean them and cut them into small pieces;

[0009] 2) Cell lysis: Place the chopped sample into a pre-chilled mortar, add an appropriate amount of liquid nitrogen to submerge the sample, and quickly grind it into a powder. Transfer the powder to a centrifuge tube, add preheated CTAB (cetyltrimethylammonium bromide extraction buffer), mix thoroughly, and keep warm in a water bath to fully lyse the cells.

[0010] 3) Remove impurities: Add a mixture of chloroform and isopropanol to a centrifuge tube, gently invert to mix, then centrifuge to separate the solution, transfer the upper aqueous phase to a new centrifuge tube, and repeat this step to remove protein and polysaccharide impurities;

[0011] 4) Precipitate DNA: add pre-cooled isopropyl alcohol to the aqueous phase, mix gently, then stand still, so that the DNA precipitates, centrifuge the centrifuge tube, and discard the supernatant, leaving the DNA precipitate;

[0012] 5) Wash the DNA: add ethanol to the DNA precipitate, gently invert the centrifuge tube, wash the DNA precipitate, then centrifuge, discard the supernatant, and repeat this step once or twice;

[0013] 6) Dry and dissolve the DNA: dry the washed DNA precipitate at room temperature, and after the ethanol has completely evaporated, add an appropriate amount of TE buffer or sterile water to dissolve the DNA;

[0014] Step two: Perform PCR amplification reaction

[0015] Discrimination primer: 5' ACTGGTGGAACGCAGGAAAA 3' and 5' TCAAGTGTCACCTTCCTCGC 3';

[0016] PCR reaction system: in a centrifuge tube, the reaction system includes PCR buffer, magnesium dichloride, deoxyribonucleotide triphosphate, discrimination primer, high-fidelity Taq DNA polymerase, template, sterile ultrapure water, place the centrifuge tube in a PCR instrument, and set the PCR reaction parameters;

[0017] Step three: analyze the PCR amplification product, and determine whether the Baitian-Shao plant is a self-incompatible strain according to the characteristics of the product:

[0018] a. First, separate and detect the PCR amplification product by agarose gel electrophoresis, prepare an appropriate concentration of agarose gel, specifically, usually select according to the expected product size, if the product size is between (100-1000) bp, use 1.0%-3% agarose gel, mix the PCR product with the DNA electrophoresis buffer, and add it to the prepared agarose gel sample well;

[0019] In the electrophoresis buffer, i.e., the buffer environment composed of tris-hydroxymethyl aminomethane, acetic acid, and ethylenediaminetetraacetic acid, perform electrophoresis at a voltage of 100V-120V, and the electrophoresis time is determined according to the product size and gel length factors, generally, electrophorese for 30-40 minutes or so, when the gel length is 8-10 cm, the bromophenol blue indicator migrates to the appropriate position of the gel;

[0020] b. Observe the band characteristics under a UV lamp

[0021] After electrophoresis, place the gel under UV light for observation. If nucleic acid dyes including ethidium bromide and GoldView are used, the DNA bands will show fluorescence under UV light.

[0022] For PCR products of self-incompatibility-related genes, it is necessary to compare the standard pattern of PCR product electrophoresis patterns of known self-compatible and self-incompatible plants; this standard pattern is determined through preliminary experiments on a large number of known plant types. That is, self-compatibility refers to the fact that the stamens and pistils of one's own flowers can combine with each other to produce seeds, while self-incompatibility refers to the fact that the stamens and pistils of one's own flowers cannot combine with each other, and no seeds are produced, only the peel. Actual field testing is carried out to check whether seeds are produced and to determine whether the plant is self-compatible or self-incompatible. Then, leaves of the corresponding original plants are taken, DNA is extracted, and electrophoresis is performed according to the above conditions. The gel is placed under ultraviolet light for observation to determine the standard pattern of PCR product electrophoresis patterns of the two types of plants.

[0023] c. Judging by the number and size of bands

[0024] First, determine the number of stripes:

[0025] If a single band appears and its size is consistent with the target gene amplification product of a known self-compatible plant, then it is preliminarily judged that the plant may be a self-compatible strain;

[0026] If multiple bands appear, or a band of the same size as the target gene amplification product from a known self-incompatible plant appears, it may indicate that the plant is a self-incompatible strain. For example, the self-incompatibility gene may have different alleles, resulting in PCR amplification of products of different sizes or multiple products.

[0027] d. Band size determination

[0028] Accurately measure the size of the band by comparing it with a DNA marker of known molecular weight. If the product size does not match the expected size of the target gene in self-compatible plants, but matches the size of the product of a self-incompatible gene, then the plant is likely to be a self-incompatible strain.

[0029] e. Band brightness analysis or semi-quantitative analysis

[0030] The brightness of the band can reflect the relative content of the product to a certain extent. Ideally, for homozygous self-compatible or self-incompatible plants, the brightness of the PCR product band of the target gene is relatively consistent.

[0031] However, if the plant is heterozygous, that is, contains both self-compatibility and self-incompatibility-related genes, two bands of different brightness may appear. Assuming that both alleles can be amplified by the identification primers, comparing the band brightness can help determine the plant's genotype and self-compatibility. For example, if one band is significantly brighter than the other, it may indicate that the copy number or expression level of one allele is higher.

[0032] f. Repeated verification and comprehensive judgment

[0033] To ensure the accuracy of the judgment, repeated PCR amplification and electrophoresis analysis should be performed on multiple samples of the same plant, because the experimental process may be affected by various factors, such as DNA quality and PCR reaction conditions, which may cause deviations in single results;

[0034] At the same time, a comprehensive judgment is made based on the plant's phenotype, including pollen germination, phenotypic characteristics related to fruit set and self-compatibility, as well as other molecular biological test results, to ultimately determine whether the Paeonia lactiflora plant is a self-incompatible strain.

[0035] Agarose gel electrophoresis was further performed with a gel concentration of 1%-3% and the addition of nucleic acid gel dye GelRed to the gel; the loading amounts of the test sample and control medicinal material PCR reaction solutions were 6μl-8μl, respectively, and the loading amount of the DNA molecular weight marker was 2μl-5μl, with a concentration of (0.5-0.8)μg / μl; after the electrophoresis, the gel slices were examined on a gel imager or a UV transilluminator; the test sample with the same position as the self-incompatible parent in the gel electrophoresis pattern carried the self-incompatibility gene.

[0036] As a further improvement of the present invention: in step 2), the hexadecyltrimethylammonium bromide extraction buffer is (1-3)% hexadecyltrimethylammonium bromide extraction buffer by mass volume ratio; the insulation time in the water bath is 30 minutes to 60 minutes.

[0037] As a further improvement of the present invention: in step 3), the ratio of the chloroform and isopropanol mixture is (20-30):1 by volume, the centrifugation condition is a speed of (10000-12000) rpm, and the centrifugation time is usually 5 minutes to 10 minutes.

[0038] As a further improvement of the present invention: in step 4), the standing condition is standing at a temperature of 4°C-10°C for 20 minutes-30 minutes; the centrifugation condition is centrifugation at a rotation speed of (9000-11000) rpm.

[0039] As a further improvement of the present invention: in step 5), the concentration of ethanol added is 70%-75%; the centrifugal conditions are: centrifugation at a speed of (10000-12000) rpm, and the centrifugation time is 5 minutes-10 minutes.

[0040] As a further improvement of the present invention: in step 6), 1% to 5% by mass of TE buffer (Tris(hydroxymethyl)aminomethane ethylenediaminetetraacetic acid) buffer is added.

[0041] As a further improvement of the present invention: the identification primers: 5'ACTGGTGGAACGCAGGAAAA3' and 5'TCAAGTGTCACCTTCCTCGC3' are obtained by the following steps:

[0042] Sequence acquisition: First, we need to obtain the relevant gene sequence information of peony, which is obtained through early peony tissue transcriptome sequencing;

[0043] Import software: Import the obtained reference sequence into PrimerPremier5 software in a suitable format, such as FASTA format;

[0044] Parameter setting: Set the parameters for primer design in the software: the primer length is set between (18-25) bp, the GC content is controlled at 40%-60%, and the annealing temperature is set in the desired range of 50℃-60℃. At the same time, try to avoid the formation of dimers and hairpin structures by the primers themselves to ensure the specificity and amplification efficiency of the primers;

[0045] Primer generation and screening: Run the primer design function of the software. The software will generate multiple pairs of candidate primers according to the set parameters and provide detailed parameter information for each pair of primers, including primer sequence, Tm value (melting temperature), GC content, and expected amplification product length. The candidate primers then need to be further screened, specifically by performing a BLAST comparison in the NCBI database to check whether the primers will have non-specific binding with other non-target sequences. Primer pairs with high comprehensive scores, parameters that meet the requirements, and good specificity will be given priority, and the above-mentioned identification primers for peony PCR amplification will be finally determined.

[0046] As a further improvement of the present invention: Step 2: Perform PCR amplification reaction: The PCR reaction system is carried out in a (200-500) μl centrifuge tube with a total reaction volume of (25-30) μl, the reaction system includes (8-10)×PCR buffer 3 μl, magnesium chloride concentration of 25 mmol / L volume (2.0-2.4) μl, deoxyribonucleoside triphosphate concentration of 10 mmol / L volume (0.5-0.6) μl, identification primer concentration of 30 μmol / L (0.5-0.6) μl each, high-fidelity Taq DNA polymerase 5U / μl volume (0.2-0.4) μl, template 1 μl, sterile ultrapure water (21.8-25) μl, place the centrifuge tube into the PCR instrument, set the PCR reaction parameters: 94℃-95℃ pre-denaturation (4-5) minutes, cycle reaction (33-35 times), denaturation conditions: 94℃-95℃ 30 seconds, annealing temperature 54℃~59℃ 30 seconds, 72℃ time 30 seconds, 72℃ extension (5-10 minutes), storage temperature 4℃-5℃;

[0047] Step 3: Analyze the PCR amplification product and determine whether the Paeonia lactiflora plant is a self-incompatible strain based on the characteristics of the product:

[0048] Step a: PCR product detection: After PCR amplification, take 5-10 μL of PCR product and mix it with DNA buffer, separate and detect it by agarose gel electrophoresis, prepare 1%-3% agarose gel, add an appropriate amount of nucleic acid dye such as ethidium bromide EB or GoldView, spot the mixed PCR product into the gel wells, and run electrophoresis at 100V-120V for 30-40 minutes until the bromophenol blue indicator migrates to the bottom of the gel.

[0049] As a further improvement of the present invention: Step 4) precipitating DNA

[0050] The isopropanol can replace the solvent: the concentration is 70%-100% ethanol, which needs to be pre-cooled; polyethylene glycol PEG: suitable for large molecular weight DNA precipitation, and needs to be combined with NaCl salt solution;

[0051] In the step 5) of cleaning DNA, the ethanol can replace the solvent: 70% ethanol; acetone.

[0052] The present invention also provides an application of the identification primer in screening the self-incompatible strain of Paeonia lactiflora.

[0053] Wherein, as a preference, step 4) precipitating DNA

[0054] Isopropanol can replace the following solvents: ethanol, commonly used 70%-100% ethanol, which needs to be pre-cooled: the effect is slightly lower than isopropanol, but it is easier to evaporate and remove, and is suitable for subsequent experiments that are sensitive to residual solvents; polyethylene glycol (PEG): suitable for precipitation of large molecular weight DNA, and needs to be used with NaCl salt solution;

[0055] In step 5) of DNA cleaning, the ethanol solvent can be replaced by: 70% ethanol: removes salts while reducing DNA dissolution loss, and evaporates quickly; ice-cold anhydrous ethanol: further dehydrates, but may increase DNA brittleness and requires gentle handling; acetone: is highly volatile and dries quickly, but may leave organic impurities and should be used with caution in sensitive experiments; Note: When replacing solvents, the operation should be adjusted according to DNA purity and subsequent uses such as sequencing and cloning to avoid the introduction of interfering substances.

[0056] Preferably, the hexadecyltrimethylammonium bromide extraction buffer is a 2% hexadecyltrimethylammonium bromide extraction buffer in a mass-to-volume ratio; the ratio of the chloroform and isopropanol mixture is 24:1 in a volume ratio; the electrophoresis buffer, i.e., tris(hydroxymethyl)aminomethane, acetic acid and ethylenediaminetetraacetic acid buffer, is purchased directly and is called TAE reagent in English.

[0057] Compared with the prior art, the method for screening self-incompatible strains of Paeonia lactiflora provided by the present invention has the following beneficial effects in terms of patent law:

[0058] 1. The method comprises the following steps: (1) extracting genomic DNA from Paeonia lactiflora plants; and (2) identifying primer sequences:

[0059] 5'ACTGGTGGAACGCAGGAAAA3' and 5'TCAAGTGTCACCTTCCTCGC3'. (3) Perform PCR amplification reaction: Use the extracted genomic DNA as a template, add identification primers and PCR reaction reagents, and perform PCR amplification reaction. (4) Analyze the PCR amplification product: Perform electrophoresis analysis on the PCR amplification product to observe whether a band of the expected size appears. If a band appears at the same position as the self-incompatible parent, it indicates that the white peony root plant may be a self-incompatible strain; if no corresponding band appears, it indicates that the white peony root plant may be a self-compatible strain. In order to further verify the accuracy of the method of the present invention, determined self-incompatible and self-compatible white peony root plants were selected for verification. The plants were screened using the method of the present invention, and the results were consistent with the known self-incompatibility and self-compatibility states, indicating that the method of the present invention has high accuracy. The simple method of screening the self-incompatible strains of white peony root using primers has the advantages of simple operation, rapidity, accuracy, etc., and can be widely used in variety improvement and reproduction of white peony root, providing strong technical support for the development of the white peony root industry.

[0060] 2. This method is easy to operate, low-cost, widely applicable, and produces reliable results, making it easy to promote and apply on a large scale. Therefore, more researchers can learn and master this method, providing new technical means for the study of peony and other plants.

[0061] 3. By extracting DNA from fresh leaves and amplifying it under appropriate primer conditions, the separation of base bands can be used to identify which plants exhibit self-incompatibility during the seedling stage, shortening the time required for subsequent basic research or breeding of peony. This allows researchers to complete their research in a relatively short period of time. The method provided by the present invention allows for the rapid and convenient identification of peony species with self-incompatibility genes, with low economic investment and ease of learning. It is therefore particularly suitable for screening peony self-incompatible plants, providing a basis for the exploration and utilization of genetic diversity, germplasm resources, and molecular marker-assisted breeding of Paeonia lactiflora.

[0062] 4. Accurate gene identification method: Specific PCR primers and high-resolution gel electrophoresis detection methods were used to identify the self-incompatibility gene in Paeonia lactiflora. This method can directly detect and analyze the self-incompatibility gene at the molecular level. Compared with traditional self-incompatibility identification methods based on phenotypic observations (such as pollen germination rate, fruit set rate, etc.), this method is more accurate, rapid and sensitive, providing a precise gene identification method for the genetic breeding of Paeonia lactiflora. It helps to accelerate the screening and cultivation of excellent self-incompatible strains, and has pioneering and innovative significance.

[0063] 5. Multi-Technology Integration: This method combines PCR amplification, high-concentration agarose gel electrophoresis, and the novel nucleic acid gel stain GelRed, leveraging the strengths of each technique to enhance experimental reliability and accuracy. This multi-technique integration provides valuable insights for other areas of plant genetic testing and analysis, inspiring researchers to utilize a comprehensive range of advanced technologies to optimize experimental protocols and achieve more accurate results when faced with complex genetic testing challenges. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 : The method for screening self-incompatible strains of Paeonia lactiflora in Example 1: Under the same conditions, the sample and the self-incompatible parent showed bands at the same position.

[0065] Samples 1 and 2 are different varieties of white peony root. If sample 1 is not identical to the self-incompatible parent and sample 2 is identical to the self-incompatible parent, and bands appear at the same position, it indicates that sample 2 contains the self-incompatibility gene. DNA markers are standard DNA bands, with bands of 100, 200, 300, 400, 500, and 600 bp. DETAILED DESCRIPTION

[0066] In order to make the objects, technical solutions and advantages of the present application clearer, further detailed description will be given below in combination with embodiments, and the illustrative embodiments and the description thereof are only used to explain the present application, but not to limit the present application.

[0067] The application discloses a screening method for self-incompatible strains of radix paeoniae alba, which comprises the following steps: selecting fresh and normally developed leaves of radix paeoniae alba, extracting DNA of radix paeoniae alba by using a CTAB method, obtaining expression sequences of key self-incompatible genes, removing redundancy from the sequences by using a bioinformatics software CD-HIT (Cluster Database at High Identity with Tolerance), and arranging the obtained expression sequences of key self-incompatible genes into a FASTA format, wherein the sequences start with "> sequence name", and the specific base sequence content is arranged after a line break, and the sequence is saved as a text file including input.fasta.

[0068] A command line interface is opened, a CD-HIT software installation directory is entered, and a running command is constructed according to sequence characteristics and redundancy removal requirements. For example, if sequences with a similarity of more than 90% are regarded as redundancy and removed, and an output file is output.fasta, the following command can be used:

[0069] cd-hit-iinput.fasta-o output.fasta-c 0.9-n 5

[0070] After the running command, the software performs clustering analysis on the input sequences according to the set parameters, classifies sequences with high similarity into one class, and selects one representative sequence as a non-redundant sequence and outputs the sequence to the result file. After completion, the non-redundant sequences in the output file can be further analyzed and processed. The key gene SSR sites and sequence information near the key gene of self-incompatibility are obtained by using an SSR search tool software (MISA (Microsatellite Identification Tool) software), and the self-incompatibility key gene sequence file after redundancy removal such as output.fasta is prepared, and it is ensured that the file format meets the requirements of the MISA software.

[0071] The MISA software is run, and appropriate search parameters are set according to the research target and sequence characteristics. For example, for dinucleotide repeat sequences, the minimum repeat number is set to 6 times; for trinucleotide repeat sequences, the minimum repeat number is set to 5 times or more than 5 times, so as to ensure that the SSR sites with certain polymorphism potential are searched.

[0072] During operation, the software will scan the input sequence line by line, identify the SSR sites that meet the set parameters, and record their position, repeat type, number of repeats, and flanking sequence information on both sides. Finally, a text file containing all SSR sites and their related information, such as SSR_results.txt, is generated. Appropriate SSR primers are further designed based on the flanking sequences. Professional primer design software, such as Primer Premier5 or Oligo7, is used here to import the screened SSR sites and their flanking sequences into the software.

[0073] Set the various parameters for primer design in the software, such as the primer length, GC content, annealing temperature range, etc. (GC here is a common term in the primer field). Then run the primer design program. The software will generate multiple pairs of candidate primers for each SSR site based on the set parameters, and provide relevant parameter information of the primers, such as primer sequence, Tm value, GC content, and amplification product length.

[0074] The generated candidate primers were screened and evaluated, and primer pairs with high scores, satisfactory parameters, and no obvious nonspecific binding in BLAST comparisons in databases such as NCBI were prioritized. Finally, the SSR primers used for PCR amplification were determined and further PCR detection was performed. The PCR reaction system and conditions were as follows:

[0075] Reaction system: The total volume is 30 μL, and the reaction system includes 3 μL of 10× PCR buffer, 2.4 μL of 25 mmol / L magnesium chloride concentration, 0.6 μL of 10 mmol / L deoxyribonucleoside triphosphate concentration, 0.2 μL of high-fidelity Taq DNA polymerase 5 U / μL, 1 μL of template, 0.5 μL each of the upstream primer 5'ACTGGTGGAACGCAGGAAAA3' and the downstream primer 5'TCAAGTGTCACCTTCCTCGC3', and double-distilled water is added to make up to 30 μL.

[0076] PCR amplification conditions: first perform pre-denaturation at 94°C for 5 minutes, then enter 35 cycles, each cycle includes denaturation at 94°C for 30 seconds, set the appropriate annealing temperature according to the Tm value of the primer to select 54°C, 55°C, 56°C, 57°C, 58°C or 59°C, and can be between 54°C and 59°C, anneal for 30 seconds, extend at 72°C for 30 seconds, and finally extend at 72°C for 10 minutes, and store at 4°C.

[0077] PCR product detection: After PCR amplification, mix (5-10) μL of PCR product with DNA buffer and separate and detect by agarose gel electrophoresis. Prepare a 1.0%-3% agarose gel and add an appropriate amount of nucleic acid dye such as ethidium bromide (EB) or GoldView. Spot the mixed PCR product onto the gel wells. Electrophorese at 100V-120V for 30-40 minutes until the bromophenol blue indicator migrates to the bottom of the gel. The DNA buffer is the following mixture in the above reaction system, excluding the PCR buffer: magnesium chloride concentration, deoxyribonucleoside triphosphate concentration, high-fidelity Taq DNA polymerase, template, upstream primer 5'ACTGGTGGAACGCAGGAAAA3' and downstream primer 5'TCAAGTGTCACCTTCCTCGC3', and double-distilled water.

[0078] The electrophoresis bands of the PCR products were observed under the ultraviolet gel imaging system, and the polymorphism of the bands between different samples was analyzed. Primer pairs with obvious polymorphic bands, such as different band numbers, positions or brightness, can be preliminarily determined as available molecular marker primers for subsequent screening studies of self-incompatibility of white peony root at the seedling stage. The polymorphisms were screened to available molecular marker primers, and the white peony root self-incompatibility primers were used to screen according to the difference in separated bands at the seedling stage. In the gel electrophoresis pattern of the test sample, the one with the same position as the self-incompatible parent carries the self-incompatibility gene. This provides a theoretical basis for the genetic diversity of white peony root, the mining and utilization of germplasm resources, and molecular marker-assisted breeding. The present invention provides a convenient method for screening white peony root self-incompatibility plants, which can be used to accurately observe which white peony root plants are self-incompatible.

[0079] The self-incompatibility of Paeonia lactiflora provides a basis for genetic diversity, germplasm resource exploration and utilization, and molecular marker-assisted breeding within Paeonia lactiflora. This method significantly reduces experimental expenses and costs, improves experimental efficiency, and simplifies the process, making it of great significance for the study of Paeonia lactiflora self-incompatibility.

[0080] 2. Experimental operation details

[0081] Gel Preparation: Accurately weigh agarose powder according to the desired gel concentration. For a 3% gel, weigh an appropriate amount of agarose. For example, to prepare a 50ml gel, weigh 1.5g of agarose and place it in a conical flask. Add an appropriate amount of 1×TAE electrophoresis buffer (usually about 80% of the total volume, i.e., 40ml). Heat in a microwave until the agarose is completely dissolved and the solution becomes clear.

[0082] Once the solution has cooled to 50°C-60°C, add an appropriate amount of GelRed, a nucleic acid gel stain, at the recommended dilution ratio in the product manual (generally 1:10,000). Mix gently to avoid creating bubbles. Then, slowly pour the solution into the gel mold in the electrophoresis tank and insert a comb, ensuring close contact between the bottom of the comb teeth and the bottom of the mold to prevent leakage or deformation of the sample wells. Let stand at room temperature for approximately 30-45 minutes. Once the gel has completely solidified, carefully remove the comb, remove the gel, and place it in the electrophoresis tank. Add an appropriate amount of 1×TAE running buffer, ensuring that the buffer covers the surface of the gel.

[0083] Sample loading: Mix the test sample (i.e., the unknown self-compatible and self-incompatible peony samples) and the control herb PCR reaction solution (i.e., the known self-compatible or self-incompatible peony samples), along with a DNA molecular weight marker, with a loading buffer, such as 6x loading buffer, in a specific ratio. For the test sample and control herb, the loading volume is 8 μl of PCR reaction solution mixed with 2 μl of loading buffer. For the 0.5 μg / μl DNA molecular weight marker, 2 μl is mixed with 1 μl of loading buffer. Loading buffer: A DNA stain that stains the sample while increasing its density and sedimenting it, ensuring that the sample is electrophoresed at the bottom and does not float. It is commonly called a DNA buffer, and its Chinese name is loading buffer.

[0084] Use a micropipette to carefully and slowly add the mixed sample to the sample wells of the gel. Be careful not to pierce the bottom of the sample wells or cause the sample to overflow from the wells. During the addition process, keep the pipette tip perpendicular to the wells and slowly inject the sample into the bottom of the wells.

[0085] Setting up and running the electrophoresis: Connect the electrophoresis instrument to the electrophoresis tank correctly, turn on the instrument, and set appropriate electrophoresis parameters based on the gel length and nucleic acid fragment size. For this experiment, since the nucleic acid fragments are relatively small due to the 3% gel concentration, set the voltage to 100V-120V and the run time to approximately 40-60 minutes. After starting the electrophoresis, closely monitor the migration of the bromophenol blue indicator to ensure proper electrophoresis. Also, monitor the electrophoresis tank for any signs of buffer leakage or depletion; replenish buffer if necessary.

[0086] Gel Detection and Result Interpretation: After electrophoresis, carefully remove the gel and rinse the surface buffer with distilled water. Then, place the gel slice on a gel imager or UV transilluminator for inspection. On the gel imager, open the Bio-Rad Gel Imager Image Acquisition Software and set appropriate detection parameters, such as exposure time and gain, based on the excitation wavelength of the nucleic acid gel stain GelRed (typically 280nm-300nm), to obtain a clear band image. When observing under a UV transilluminator, wear appropriate protective glasses to prevent damage to the eyes caused by ultraviolet rays. Observe and record characteristics such as the position, number, and brightness of the bands.

[0087] 3. Technical difficulties and solutions Technical difficulties in the preparation and operation of high-concentration gel: The gel concentration of 3% is relatively high. The agarose solution is prone to bubbles during the heating and dissolution process, and the gel texture is hard after solidification. The sample wells are prone to deformation or rupture, affecting the sample loading and electrophoresis effects.

[0088] Solutions to technical difficulties in preparing and operating high-concentration gels: When dissolving agarose, heat intermittently over low heat with constant stirring to avoid violent boiling and excessive bubbles. If bubbles occur, gently remove them with a pipette after the solution cools to 80-90°C. Regarding the sample wells, ensure the comb and mold are clean and dry before pouring the gel solution. Insert the comb vertically and slowly to avoid bubbles and deformation. After the gel solidifies, gently remove the comb. If any sample wells are deformed, carefully trim them with a pipette tip.

[0089] Technical difficulties in clearly distinguishing and accurately judging nucleic acid bands: Since self-incompatibility genes may exist in multiple allele forms or have high similarity with other gene sequences, the bands of PCR amplification products on gel electrophoresis may be more complex, making it difficult to accurately determine which bands are specific bands related to self-incompatibility, increasing the difficulty of result judgment.

[0090] Solutions to the technical difficulties of clearly distinguishing and accurately identifying nucleic acid bands: Using a high-resolution gel imager and appropriate nucleic acid gel stains, such as GelRed, can enhance the fluorescent signal and clarity of the bands, making them easier to observe and distinguish. Furthermore, combining the electrophoresis patterns of known self-incompatible parents with DNA molecular weight markers allows for multiple comparisons and analysis of the test sample bands, eliminating interference from nonspecific bands and improving the accuracy of identifying self-incompatibility-related bands. Furthermore, optimizing PCR primer design to increase primer specificity and reduce the generation of nonspecific amplification products can also help simplify the band pattern and facilitate result interpretation.

[0091] Technical difficulties in ensuring the repeatability of the experiment: the PCR amplification process may be affected by various factors such as template DNA quality, primer specificity, PCR reaction conditions, etc., resulting in differences in experimental results of different batches, making it difficult to ensure the repeatability and stability of the experiment, thereby affecting the accurate judgment of the self-incompatibility of Baimaoshao plants.

[0092] Solution to the technical difficulties in ensuring the repeatability of the experiment: Before the experiment, the quality of the template DNA is strictly detected to ensure its purity and integrity. The PCR reaction system and conditions are optimized, and the optimal annealing temperature, primer concentration, Mg 2+ concentration and other parameters are determined by gradient PCR and other methods, and the consistency of these conditions is maintained in each experiment. At the same time, strict quality control is carried out for each link in the experimental process, such as the storage and use of reagents, the calibration of pipettors, etc., to reduce experimental errors and improve experimental repeatability.

[0093] Example 1

[0094] The self-incompatibility strain screening method of Baimaoshao in this embodiment comprises the following steps:

[0095] Step 1: Extracting genomic DNA from Baimaoshao plants;

[0096] 1) Select fresh peony leaves, wash them clean and cut them into small pieces, and make sure the peony leaves are moist;

[0097] 2) Cell lysis: Put the cut sample into a pre-cooled mortar, add an appropriate amount of liquid nitrogen to submerge the sample, grind it into powder quickly, transfer the powder to a centrifuge tube, add preheated CTAB extraction buffer with a mass-volume ratio of (1-3) % cetyltrimethylammonium bromide, preferably 2%, mix well, and incubate in a water bath for 30-60 minutes to allow the cells to be fully lysed;

[0098] 3) Removing impurities: Add a mixture of chloroform and isopropanol to the centrifuge tube, mix gently, then centrifuge at a speed of 10,000-12,000 rpm for 5-10 minutes to separate the layers, and transfer the upper aqueous phase to a new centrifuge tube and repeat the step to remove protein and polysaccharide impurities; wherein the ratio of the chloroform and isopropanol mixture is (20-30):1 by volume;

[0099] 4) DNA precipitation: Add pre-cooled isopropanol to the aqueous phase, mix gently, then stand at 4-10°C for 20-30 minutes to precipitate the DNA, centrifuge the centrifuge tube at a speed of 9,000-11,000 rpm, discard the supernatant, and reserve the DNA precipitate;

[0100] 5) DNA cleaning: Add 70%-75% ethanol to the DNA precipitate, gently invert the centrifuge tube to clean the DNA precipitate, and then centrifuge at (10000-12000) rpm for 5 minutes to 10 minutes, discard the supernatant, and repeat this step once or twice;

[0101] 6) Drying and dissolving DNA: The cleaned DNA precipitate was placed at room temperature to dry. After the ethanol was completely evaporated, 50-100 μl of TE buffer or sterile water was added to dissolve the DNA; wherein the TE buffer is a 1%-5% tris(hydroxymethyl)aminomethane ethylenediaminetetraacetic acid buffer by mass percentage;

[0102] Step 2: Perform PCR amplification reaction;

[0103] Identification primers: 5'ACTGGTGGAACGCAGGAAAA3' and 5'TCAAGTGTCACCTTCCTCGC3'; the identification primers: 5'ACTGGTGGAACGCAGGAAAA3' and 5'TCAAGTGTCACCTTCCTCGC3' were obtained by the following steps:

[0104] Sequence acquisition: First, we need to obtain the relevant gene sequence information of peony, which was obtained by sequencing the transcriptome of peony tissue in the early stage;

[0105] Import software: Import the obtained reference sequence into PrimerPremier5 software in a suitable format, such as FASTA format;

[0106] Parameter setting: Set the various parameters for primer design in the software: the primer length is set between (18-25) bp, the GC content is controlled between 40%-60% (the percentage is the number percentage), the annealing temperature is set in the desired range of 50℃-60℃, and at the same time, try to avoid the formation of dimers and hairpin structures by the primers themselves to ensure the specificity and amplification efficiency of the primers;

[0107] Primer generation and screening: Run the primer design function of the software. The software will generate multiple pairs of candidate primers according to the set parameters and provide detailed parameter information for each pair of primers, including primer sequence, Tm value (melting temperature), GC content, and expected amplification product length. The candidate primers then need to be further screened, specifically by performing a BLAST comparison in the NCBI database to check whether the primers will have non-specific binding with other non-target sequences. Primer pairs with high comprehensive scores, parameters that meet the requirements, and good specificity will be given priority, and the above-mentioned identification primers for peony PCR amplification will be finally determined.

[0108] PCR reaction system: in 200 μl centrifuge tube, the total volume of reaction is 30 μl, the reaction system includes 10 x PCR buffer 3 μl, magnesium dichloride concentration is 25 mmol / L, volume 2.4 μl, dNTP concentration 10 mmol / L volume 0.6 μl, identification primer 30 μmol / L each 0.5 μl, high fidelity Taq DNA polymerase 5 U / μl volume 0.2 μl, template 1 μl, sterile ultrapure water 21.8 μl. The centrifuge tube is placed in PCR instrument, and the PCR reaction parameters are as follows: 95 ℃ pre-denaturation for 4 minutes, 33 cycles of reaction, denaturation condition or parameter: 95 ℃ for 30 seconds, 54-59 ℃ for 30 seconds, 72 ℃ for 30 seconds, 72 ℃ extension for 5 minutes;

[0109] Step three: analyze PCR amplification product, and determine whether the bai shao plant is self-incompatible strain according to the characteristics of the product:

[0110] a. First, separate the PCR amplification product by agarose gel electrophoresis, and prepare the agarose gel with appropriate concentration. Specifically, generally select according to the expected product size. If the product size is between (100-1000) bp, use 1.0%-3% agarose gel. Mix the PCR product with the loading buffer and add it to the loading well of the gel. Both 1.0% agarose gel and 3% agarose gel can be used.

[0111] Under the environment of electrophoresis buffer including TAE or TBE buffer, perform electrophoresis at a voltage of 100 V-120 V. The electrophoresis time is determined according to the product size and gel length factors. Generally, electrophorese for about 30-40 minutes when the gel length is 8 cm-10 cm, and the bromophenol blue indicator migrates to the appropriate position of the gel.

[0112] b. Observe the band characteristics under the ultraviolet lamp

[0113] After electrophoresis, place the gel under the ultraviolet lamp. If nucleic acid dyes including EB and GoldView are used, the DNA band will show fluorescence under ultraviolet light.

[0114] For the PCR product of the self-incompatibility related gene, it is necessary to compare the standard mode of the PCR product electrophoretogram of the known self-compatible and self-incompatible plants. The standard mode is determined by the previous experiment on a large number of known types of plants, that is, self-compatible refers to the anther and pistil of the self flower can combine with each other to produce seeds, and self-incompatible refers to the anther and pistil of the self flower cannot combine with each other, and no seeds are produced, only pericarp. Through field detection, it is determined whether the plant is self-compatible or self-incompatible, and then the corresponding original plant leaves are taken to extract DNA, and the electrophoresis detection is carried out according to the above conditions. Place the gel under the ultraviolet lamp to determine the standard mode of the PCR product electrophoretogram of the two types of plants.

[0115] c. Judging by the number and size of bands

[0116] First, determine the number of stripes:

[0117] If a single band appears and its size is consistent with the target gene amplification product of a known self-compatible plant, then it is preliminarily judged that the plant may be a self-compatible strain;

[0118] If multiple bands appear, or a band of the same size as the target gene amplification product from a known self-incompatible plant appears, it may indicate that the plant is a self-incompatible strain. For example, the self-incompatibility gene may have different alleles, resulting in PCR amplification of products of different sizes or multiple products.

[0119] d. Band size determination

[0120] Accurately measure the size of the band by comparing it with a DNA marker of known molecular weight. If the product size does not match the expected size of the target gene in self-compatible plants, but matches the size of the product of a self-incompatible gene, then the plant is likely to be a self-incompatible strain.

[0121] e. Band brightness analysis or semi-quantitative analysis

[0122] The brightness of the band can reflect the relative content of the product to a certain extent. Ideally, for homozygous self-compatible or self-incompatible plants, the brightness of the PCR product band of the target gene is relatively consistent.

[0123] However, if the plant is heterozygous, that is, contains both self-compatibility and self-incompatibility-related genes, two bands of different brightness may appear. Assuming that both alleles can be amplified by the primers, comparing the band brightness can help determine the plant's genotype and self-compatibility. For example, if one band is significantly brighter than the other, it may indicate that the copy number or expression level of one allele is higher.

[0124] f. Repeated verification and comprehensive judgment

[0125] To ensure the accuracy of the judgment, repeated PCR amplification and electrophoresis analysis should be performed on multiple samples of the same plant, because the experimental process may be affected by various factors, such as DNA quality and PCR reaction conditions, which may cause deviations in single results;

[0126] At the same time, a comprehensive judgment is made based on the plant's phenotypes, such as pollen germination and fruit set rate, which are related to self-compatibility, as well as other molecular biological test results, to ultimately determine whether the Paeonia lactiflora plant is a self-incompatible strain.

[0127] According to the agarose gel electrophoresis method, the gel concentration is 3%, and the nucleic acid gel stain GelRed is added to the gel; the sample volume of the PCR reaction solution of the test sample and the control medicinal material is 8 μl respectively, the sample volume of the DNA molecular weight marker is 2 μl, and the concentration is 0.5 μg / μl. After the electrophoresis is completed, the gel slice is examined on a gel imager or a UV transilluminator. In the gel electrophoresis pattern of the test sample, the one with the same position as the self-incompatible parent carries the self-incompatibility gene.

[0128] Related experimental instruments and product models are as follows:

[0129] Electrophoresis instrument: The Bio-Rad PowerPac Basic electrophoresis instrument was selected. This model of electrophoresis instrument can provide stable and accurate DC voltage output and is suitable for various nucleic acid electrophoresis experiments. Its voltage adjustment range is wide, usually 0V-300V, which can meet the electrophoresis requirements of different gel concentrations and fragment sizes. The output current and power are also relatively stable, which can ensure the consistency and repeatability of the electrophoresis process.

[0130] Electrophoresis tank: The Bio-Rad Mini-Sub Cell GT electrophoresis tank was used. Its compact design and efficient buffer circulation system ensure uniform electric field distribution during electrophoresis, preventing issues such as localized overheating or uneven electric fields that can cause band deformation. The tank's gel tray is appropriately sized, suitable for the small gel volumes used in this experiment, such as the 3% gel concentration mini-gel preparation and electrophoresis. It also offers excellent compatibility with the electrophoresis instrument and is easy to install and operate.

[0131] Gel Imager: The UVP GelDoc-It 310 gel imager is used. This imager features a high-resolution CCD camera that clearly captures the fluorescent signals of nucleic acid bands on the gel. Its high sensitivity allows detection of even faint nucleic acid bands, and it offers a variety of filter options suitable for detecting different fluorescent dyes, such as GelRed. The imager's powerful image analysis software allows for precise measurement and analysis of band brightness, size, and position, facilitating subsequent data processing and result interpretation.

[0132] UV transilluminator: As a backup test device, we used a Shanghai Jingke UV-754 UV transilluminator. It provides a stable UV light source, facilitating preliminary band observation and qualitative analysis of gels without a gel imager. The UV transilluminator's wavelength range is suitable for excitation of nucleic acid stains (such as GelRed) and has a light intensity adjustment function that can be adjusted according to actual observation needs.

[0133] See also Figure 1As shown, the gel electrophoresis pattern of the test sample is compared with the electrophoresis pattern of the known self-incompatible parent. If a band appears in the test sample at the same position as the self-incompatible parent, such as the band in Sample 2, which is located at the same position as the parent, then the test sample is preliminarily judged to carry the self-incompatibility gene. If the band in Sample 1 is located at a different position than the parent, then the test sample is preliminarily judged not to carry the self-incompatibility gene. At the same time, the approximate molecular weight of the band in the test sample can be determined in combination with the band position of a DNA molecular weight marker to further verify the accuracy of the results.

[0134] Example 2

[0135] This embodiment is basically the same as embodiment 1, except that the PCR reaction system is carried out in a 300 μl centrifuge tube with a total reaction volume of 25 μl. The reaction system includes 3 μl of 8×PCR buffer, 2.0 μl of 25 mmol / L magnesium dichloride concentration, 0.5 μl of deoxyribonucleoside triphosphate concentration of 10 mmol / L, 0.6 μl of each of the identification primers at a concentration of 30 μmol / L, 0.4 μl of high-fidelity Taq DNA polymerase 5 U / μl, 1 μl of template, and the balance of sterile ultrapure water. The centrifuge tube is placed in a PCR instrument, and the PCR reaction parameters are set as follows: pre-denaturation at 95°C for 5 minutes, 35 cycles of reaction, denaturation conditions: 94°C for 30 seconds, annealing temperature at 59°C for 30 seconds, 72°C for 30 seconds, extension at 72°C for 10 minutes, and storage temperature at 5°C. Among them, PCR buffer is common knowledge in the art and is a reagent included in each reaction system or kit, generally including MgCl2. 2+ , K + Wait for some protective agents.

[0136] PCR product detection: After PCR amplification, mix 10 μL of PCR product with DNA buffer and separate and detect by agarose gel electrophoresis. Prepare a 2% agarose gel and add an appropriate amount of nucleic acid dye such as ethidium bromide (EB) or GoldView. Spot the mixed PCR product into the gel wells and run electrophoresis at 120V for 40 minutes until the bromophenol blue indicator migrates to the bottom of the gel.

[0137] Example 3

[0138] This example is basically the same as Example 1, except that the PCR reaction system is carried out in a 500 μl centrifuge tube with a total reaction volume of 28 μl. The reaction system includes 3 μl of 9×PCR buffer, 2.2 μl of magnesium dichloride concentration of 25 mmol / L, 0.5 μl of deoxyribonucleoside triphosphate concentration of 10 mmol / L, 0.6 μl of each identification primer concentration of 30 μmol / L, 0.4 μl of high-fidelity Taq DNA polymerase 5 U / μl, 1 μl of template, and the balance of sterile ultrapure water. The centrifuge tube is placed in a PCR instrument, and the PCR reaction parameters are set as follows: pre-denaturation at 95°C for 4 minutes, 34 cycles, denaturation conditions: 94°C for 30 seconds, annealing temperature at 58°C for 30 seconds, 72°C for 30 seconds, extension at 72°C for 7 minutes, and storage temperature at 4°C.

[0139] PCR product detection: After PCR amplification, take 5 μL of PCR product and mix it with DNA buffer, and separate and detect it by agarose gel electrophoresis. Prepare 1.8% agarose gel, add an appropriate amount of nucleic acid dye such as ethidium bromide EB or GoldView, and spot the mixed PCR product into the gel wells. Electrophoresis is carried out at 110V for 35 minutes until the bromophenol blue indicator migrates to the bottom of the gel. Among them, PCR buffer is common knowledge in the field and is a reagent in each reaction system or kit, generally including Mg 2+ , K + Wait for some protective agents.

[0140] Example 4

[0141] This embodiment is basically the same as Example 1, except that the ratio of the chloroform and isopropanol mixture is 24:1 by volume; the cetyltrimethylammonium bromide extraction buffer is 2% cetyltrimethylammonium bromide extraction buffer by mass volume ratio, and this value range makes the effect most prominent.

[0142] It should be understood that the purposes of these embodiments are only used to illustrate the present invention and are not intended to limit the scope of protection of the present invention. In addition, it should also be understood that after reading the technical contents of the present invention, those skilled in the art can make various changes, modifications and / or variations to the present invention, and all of these equivalent forms also fall within the scope of protection defined by the appended claims of this application. It is known from common technical knowledge that the present invention can be implemented by other embodiments that do not deviate from its spirit or essential features. Therefore, the above-mentioned disclosed embodiments, in all respects, are only illustrative and are not exclusive. All changes within the scope of the present invention or within the scope equivalent to the present invention are encompassed by the present invention.

Claims

1. A method for screening self-incompatible strains of Paeonia lactiflora, characterized in that The following steps are involved: Step 1: Extract genomic DNA from Paeonia lactiflora plants 1) Select fresh peony leaves, clean them and cut them into small pieces; 2) Cell lysis: Place the chopped sample into a pre-chilled mortar, add an appropriate amount of liquid nitrogen to submerge the sample, and quickly grind it into a powder. Transfer the powder to a centrifuge tube, add preheated CTAB (cetyltrimethylammonium bromide extraction buffer), mix thoroughly, and keep warm in a water bath to fully lyse the cells. 3) Remove impurities: Add a mixture of chloroform and isopropanol to a centrifuge tube, gently invert to mix, then centrifuge to separate the solution, transfer the upper aqueous phase to a new centrifuge tube, and repeat this step to remove protein and polysaccharide impurities; 4) DNA precipitation: Add pre-cooled isopropanol to the aqueous phase, gently invert to mix, and then let it stand to precipitate the DNA. After centrifuging the tube, pour off the supernatant and retain the DNA precipitate; 5) Wash DNA: Add ethanol to the DNA precipitate, gently invert the centrifuge tube to wash the DNA precipitate, then centrifuge, discard the supernatant, and repeat this step once or twice; 6) Drying and dissolving DNA: Place the cleaned DNA precipitate at room temperature to dry. After the ethanol has completely evaporated, add an appropriate amount of TE buffer (Tris(hydroxymethyl)aminomethane ethylenediaminetetraacetic acid) buffer or sterile water to dissolve the DNA. Step 2: Perform PCR amplification reaction Identification primers: 5′ACTGGTGGAACGCAGGAAAA3′ and 5′TCAAGTGTCACCTTCCTCGC3′; PCR reaction system: Performed in a centrifuge tube. The reaction system includes PCR buffer, magnesium dichloride, deoxyribonucleoside triphosphates, identification primers, high-fidelity Taq DNA polymerase, template, and sterile ultrapure water. Place the centrifuge tube in a PCR instrument and set the PCR reaction parameters. Step 3: Analyze the PCR amplification product and determine whether the Paeonia lactiflora plant is a self-incompatible strain based on the characteristics of the product: a. First, separate and detect the PCR amplification products by agarose gel electrophoresis. Prepare an agarose gel of appropriate concentration, usually based on the expected product size. If the product size is between 100-1000 bp, use 1.0%-3% agarose gel. Mix the PCR product with DNA electrophoresis buffer and add it to the prepared agarose gel sample wells. In an electrophoresis buffer solution composed of tris(hydroxymethylaminomethane), acetic acid, and ethylenediaminetetraacetic acid, electrophoresis is performed at a voltage of 100V-120V. The electrophoresis time is determined by the product size and gel length. Generally, the electrophoresis is performed until the bromophenol blue indicator migrates to the appropriate position of the gel. For example, when the gel length is 8cm-10cm, the electrophoresis time is about 30 minutes to 40 minutes. b. Observe the stripe characteristics under ultraviolet light After electrophoresis, place the gel under UV light for observation. If nucleic acid dyes including ethidium bromide and GoldView are used, the DNA bands will show fluorescence under UV light. For PCR products of self-incompatibility-related genes, it is necessary to compare the standard pattern of PCR product electrophoresis patterns of known self-compatible and self-incompatible plants; this standard pattern is determined through preliminary experiments on a large number of known plant types. That is, self-compatibility refers to the fact that the stamens and pistils of one's own flowers can combine with each other to produce seeds, while self-incompatibility refers to the fact that the stamens and pistils of one's own flowers cannot combine with each other, and no seeds are produced, only the peel. Actual field testing is carried out to check whether seeds are produced and to determine whether the plant is self-compatible or self-incompatible. Then, leaves of the corresponding original plants are taken, DNA is extracted, and electrophoresis is performed according to the above conditions. The gel is placed under ultraviolet light for observation to determine the standard pattern of PCR product electrophoresis patterns of the two types of plants. c. Judging by the number and size of bands First, determine the number of stripes: If a single band appears and its size is consistent with the target gene amplification product of a known self-compatible plant, then it is preliminarily judged that the plant may be a self-compatible strain; If multiple bands appear, or a band of the same size as the target gene amplification product from a known self-incompatible plant appears, it may indicate that the plant is a self-incompatible strain. For example, the self-incompatibility gene may have different alleles, resulting in PCR amplification of products of different sizes or multiple products. d. Band size determination Accurately measure the size of the band by comparing it with a DNA marker of known molecular weight. If the product size does not match the expected size of the target gene in self-compatible plants, but matches the size of the product of a self-incompatible gene, then the plant is likely to be a self-incompatible strain. e. Band brightness analysis or semi-quantitative analysis The brightness of the band can reflect the relative content of the product to a certain extent. Ideally, for homozygous self-compatible or self-incompatible plants, the brightness of the PCR product band of the target gene is relatively consistent. However, if the plant is heterozygous, that is, contains both self-compatibility and self-incompatibility-related genes, two bands of different brightness may appear. Assuming that both alleles can be amplified by the identification primers, comparing the band brightness can help determine the plant's genotype and self-compatibility. For example, if one band is significantly brighter than the other, it may indicate that the copy number or expression level of one allele is higher. f. Repeated verification and comprehensive judgment To ensure the accuracy of the judgment, repeated PCR amplification and electrophoresis analysis should be performed on multiple samples of the same plant, because the experimental process may be affected by various factors, such as DNA quality and PCR reaction conditions, which may cause deviations in single results; At the same time, a comprehensive judgment is made based on the plant's phenotype, including pollen germination, phenotypic characteristics related to fruit set and self-compatibility, as well as other molecular biological test results, to ultimately determine whether the Paeonia lactiflora plant is a self-incompatible strain. Agarose gel electrophoresis was further performed with a gel concentration of 1%-3% and the addition of nucleic acid gel dye GelRed to the gel; the loading amounts of the test sample and control medicinal material PCR reaction solutions were 6μl-8μl, respectively, and the loading amount of the DNA molecular weight marker was 2μl-5μl, with a concentration of (0.5-0.8)μg / μl; after the electrophoresis, the gel slices were examined on a gel imager or a UV transilluminator; the test sample with the same position as the self-incompatible parent in the gel electrophoresis pattern carried the self-incompatibility gene.

2. The method for screening self-incompatible strains of Paeonia lactiflora according to claim 1, wherein: Step 2), the hexadecyltrimethylammonium bromide extraction buffer is (1-3)% hexadecyltrimethylammonium bromide extraction buffer by mass volume ratio; the insulation time in the water bath is 30 minutes to 60 minutes.

3. The method for screening self-incompatible strains of Paeonia lactiflora L. according to claim 1, wherein: In step 3, the ratio of the chloroform and isopropanol mixture is (20-30):1 by volume, the centrifugation condition is a rotation speed of (10000-12000) rpm, and the centrifugation time is usually 5 minutes to 10 minutes.

4. The method for screening self-incompatible strains of Paeonia lactiflora according to claim 1, wherein Step 4) The standing condition is to stand at a temperature of 4°C-10°C for 20 minutes-30 minutes; the centrifugation condition is to centrifuge at a speed of (9000-11000) rpm.

5. The method for screening self-incompatible strains of Paeonia lactiflora L. according to claim 1, wherein: Step 5) adding ethanol at a concentration of 70%-75%; centrifugation conditions: centrifugation at a speed of (10000-12000) rpm for 5 minutes to 10 minutes.

6. The method for screening self-incompatible strains of Paeonia lactiflora L. according to claim 1, wherein: Step 6) Add TE buffer (Tris(hydroxymethyl)aminomethane ethylenediaminetetraacetic acid) buffer 1%-5% by mass.

7. The method for screening self-incompatible strains of Paeonia lactiflora according to claim 1, wherein: The identification primers: 5'ACTGGTGGAACGCAGGAAAA3' and 5'TCAAGTGTCACCTTCCTCGC3' were obtained by the following steps: Sequence acquisition: First, we need to obtain the relevant gene sequence information of peony, which is obtained through early peony tissue transcriptome sequencing; Import software: Import the obtained reference sequence into Primer Premier5 software in a suitable format, such as FASTA format; Parameter setting: Set the parameters for primer design in the software: the primer length is set between (18-25) bp, the GC content is controlled at 40%-60%, and the annealing temperature is set in the desired range of 50℃-60℃. At the same time, try to avoid the formation of dimers and hairpin structures by the primers themselves to ensure the specificity and amplification efficiency of the primers; Primer generation and screening: Run the primer design function of the software. The software will generate multiple pairs of candidate primers according to the set parameters and provide detailed parameter information for each pair of primers, including primer sequence, Tm value (melting temperature), GC content, and expected amplification product length. The candidate primers then need to be further screened, specifically by performing a BLAST comparison in the NCBI database to check whether the primers will have non-specific binding with other non-target sequences. Primer pairs with high comprehensive scores, parameters that meet the requirements, and good specificity will be given priority, and the above-mentioned identification primers for peony PCR amplification will be finally determined.

8. The method for screening self-incompatible strains of Paeonia lactiflora L. according to claim 1, wherein: Step 2: Perform PCR amplification reaction: The PCR reaction system is carried out in a (200-500) μl centrifuge tube with a total reaction volume of (25-30) μl. The reaction system includes (8-10)×PCR buffer 3 μl, magnesium chloride concentration of 25 mmol / L volume (2.0-2.4) μl, deoxyribonucleoside triphosphate concentration of 10 mmol / L volume (0.5-0.6) μl, identification primer concentration of 30 μmol / L (0.5-0.6) μl each, high-fidelity Taq DNA polymerase 5U / μl volume (0.2-0.4) μl, template 1 μl, sterile ultrapure water (21.8-25) μl, place the centrifuge tube into the PCR instrument, set the PCR reaction parameters: 94℃-95℃ pre-denaturation (4-5) minutes, cycle reaction (33-35 times), denaturation conditions: 94℃-95℃ 30 seconds, annealing temperature 54℃~59℃ 30 seconds, 72℃ time 30 seconds, 72℃ extension (5-10 minutes), storage temperature 4℃-5℃; Step 3: Analyze the PCR amplification product and determine whether the Paeonia lactiflora plant is a self-incompatible strain based on the characteristics of the product: Step a: PCR product detection: After PCR amplification, take 5-10 μL of PCR product and mix it with DNA buffer, separate and detect it by agarose gel electrophoresis, prepare 1%-3% agarose gel, add an appropriate amount of nucleic acid dye such as ethidium bromide EB or GoldView, spot the mixed PCR product into the gel wells, and run electrophoresis at 100V-120V for 30-40 minutes until the bromophenol blue indicator migrates to the bottom of the gel.

9. The method for screening self-incompatible strains of Paeonia lactiflora L. according to claim 1, wherein: Step 4) Precipitate DNA The isopropanol can replace the solvent: the concentration is 70%-100% ethanol, which needs to be pre-cooled; polyethylene glycol PEG: suitable for large molecular weight DNA precipitation, and needs to be combined with NaCl salt solution; In the step 5) of cleaning DNA, the ethanol can replace the solvent: 70% ethanol; acetone.

10. The application of the above identification primers in the screening of self-incompatible strains of Paeonia lactiflora.