Cyprinid herpesvirus type 3 ORF138 gene inactivated strain as well as preparation method and application thereof

Abstract

The invention belongs to the field of disease prevention and control in aquaculture, and particularly relates to a cyprinid herpesvirus type 3 ORF138 gene inactivated strain as well as a preparation method and application of the cyprinid herpesvirus type 3 ORF138 gene inactivated strain. The invention belongs to the field of disease prevention and control in aquaculture, and particularly relates to a cyprinid herpesvirus type 3 ORF138 gene inactivated strain as well as a preparation method and application of the cyprinid herpesvirus type 3 ORF138 gene inactivated strain. According to the invention, a Koi herpesvirus ORF138 gene deleted strain is constructed, and the strain is purified to obtain the gene recombinant engineering vaccine with immunogenicity. According to the vaccine, the ORF138 gene is knocked out, the toxicity is greatly weakened, the morbidity and death probability of immunized fishes is remarkably reduced, the fishes can be induced to better generate immune response, and the vaccine has an immune effect. In addition, the recombinant genetic engineering vaccine can induce immunized fishes to effectively generate specific antibodies for a long time. Compared with other types of vaccine recombinant genetic engineering vaccines, the recombinant genetic engineering vaccine has the advantage of high immunization rate, and can achieve a better immunization effect in practical application.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of disease prevention and control of aquaculture, and particularly relates to a Cyprinid herpesvirus 3 type ORF138 gene inactivated strain, a preparation method and application thereof. BACKGROUND

[0002] Cyprinid herpesvirus 3 (CyHV-3), also known as Koi herpesvirus (KHV), is the pathogen causing Koi herpesvirus disease (KHVD) in common carp, koi carp and their varieties. CyHV-3 is highly infectious, fast-acting and has a very high mortality rate. Therefore, KHVD is listed as a disease that must be reported by the World Organization for Animal Health (WOAH) and is included in the disease monitoring list of the Asia-Pacific Aquatic Animal Disease Monitoring Quarterly Report (NACA QAAD).

[0003] According to the Food and Agriculture Organization of the United Nations (FAO) database, common carp is the third largest freshwater aquaculture fish in the world and is an important food component in many countries in Asia.

[0004] Although CyHV-3 attenuated vaccines and improved live vaccines show significant protective effects in fish experiments, the attenuated mechanism of the existing attenuated vaccines is not clear, the residual toxicity is uncertain, and there is a risk of virulence returning to strength. Inactivated vaccines prepared with inactivated CyHV-3 as an antigen also have the problem of low immunoprotection rate. Although DNA vaccines and subunit vaccines have the advantages of high immunoprotection rate, stability and the like, they are generally only suitable for individual injection immunization and are not suitable for large-scale vaccination, and have high preparation costs, which have great limitations in actual aquaculture. As a live attenuated vaccine that can selectively delete viral genes, reduce viral virulence, does not cause disease, and can induce immune responses in the host, the recombinant attenuated live vaccine is the best way to protect common carp or koi carp from CyHV-3 infection.

[0005] Because the membrane protein of the virus directly interacts with the host protein, such as connecting the host cell receptor or the virus invading the host, and fusing the host protein in the virus assembly process, elucidating the function of the membrane protein of the virus plays a key role in the research of vaccines. Literature shows that the ORF138 protein of CyHV-3 is predicted to encode a glycosylated type 1 essential membrane protein, and there is no report on the research of KHV ORF138 gene deletion strain as a gene deletion attenuated live vaccine. SUMMARY

[0006] To solve the above technical problems, the technical scheme adopted by the present application is as follows:

[0007] In a first aspect, the present application provides a Cyprinid herpesvirus 3 ORF138 gene inactivation strain, which is a live attenuated virus strain of Cyprinid herpesvirus 3 after deletion of ORF138 gene.

[0008] In some embodiments of the present application, the inactivation includes, but is not limited to, that the ORF138 gene is completely or partially knocked out, the ORF138 gene cannot be expressed, the ORF138 gene is mutated, and the expressed protein does not have normal function.

[0009] In some embodiments of the present application, the sequence of the ORF138 gene is shown in SEQ ID NO: 5.

[0010] In some embodiments of the present application, the Cyprinid herpesvirus 3 ORF138 gene inactivation strain can carry a screening marker.

[0011] In some embodiments of the present application, the screening marker includes at least one of a reporter gene and a selection marker gene.

[0012] In some embodiments of the present application, the reporter gene includes at least one of a fluorescent protein gene, a luciferase gene, and a beta-galactosidase gene.

[0013] In some embodiments of the present application, the selection marker gene includes an antibiotic resistance gene.

[0014] In some embodiments of the present application, the antibiotic resistance gene includes at least one of a penicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, an ampicillin resistance gene, and a puromycin resistance gene.

[0015] In some embodiments of the present application, the Cyprinid herpesvirus 3 ORF138 gene inactivation strain is preserved in the China Center for Type Culture Collection (Wuhan, China, Wuhan University) on May 28, 2025, and is named Cyprinid herpesvirus 3 gene deletion strain KHV-T△ORF138, with a preservation number of CCTCC NO: V202540.

[0016] In a second aspect, the present application provides a method for constructing the Cyprinid herpesvirus 3 ORF138 gene inactivation strain of the first aspect, which includes the following steps:

[0017] Isolating and identifying Cyprinid herpesvirus 3 and inactivating the ORF138 gene.

[0018] In some embodiments of the present application, the method for inactivation comprises at least one of point mutation, homologous recombination, CRISPR / Cas9 system, transcription activator-like effector nuclease technology, and zinc finger nuclease technology.

[0019] In some embodiments of the present application, the method for inactivation is homologous recombination.

[0020] In some embodiments of the present application, the method for homologous recombination comprises the following steps:

[0021] Designing upstream and downstream primers for the ORF138 gene and the left and right arms, and amplifying the ORF138 gene to obtain the ORF138 gene;

[0022] Linking the ORF138 gene and the left and right arms to the homologous recombination vector;

[0023] Designing upstream and downstream primers for deleting the ORF138 gene fragment based on the homologous recombination vector, and amplifying the homologous recombination vector for deleting the ORF138 gene;

[0024] Co-transfecting the homologous recombination vector for deleting the ORF138 gene with the genomic DNA of the carp herpesvirus type 3 to perform homologous recombination.

[0025] In some embodiments of the present application, the homologous recombination vector can have a selection marker, and the selection marker comprises at least one of a reporter gene and a selection marker gene.

[0026] In some embodiments of the present application, the reporter gene comprises at least one of a fluorescent protein gene, a luciferase gene, and a β-galactosidase.

[0027] In some embodiments of the present application, the fluorescent protein gene comprises at least one of a green fluorescent protein, a red fluorescent protein, and a yellow fluorescent protein.

[0028] In some embodiments of the present application, the selection marker gene comprises an antibiotic resistance gene.

[0029] In some embodiments of the present application, the antibiotic resistance gene comprises at least one of a penicillin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, an ampicillin resistance gene, and a puromycin resistance gene.

[0030] A third aspect of the present application provides a carp herpesvirus type 3 virus vaccine, which comprises the carp herpesvirus type 3 ORF138 gene inactivated strain according to the first aspect of the present application.

[0031] In some embodiments of the present application, the carp herpesvirus type 3 virus vaccine comprises a pharmaceutically acceptable excipient.

[0032] In some embodiments of the present application, the pharmaceutically acceptable excipient includes at least one of a solvent, a propellant, a solubilizer, a co-solvent, an emulsifier, a colorant, a binder, a disintegrant, a filler, a lubricant, a wetting agent, an osmotic pressure regulator, a stabilizer, a glidant, a flavoring agent, a preservative, a suspending agent, a coating material, a fragrance, an anti-adhesion agent, an integrating agent, a penetration enhancer, a pH regulator, a buffer, a plasticizer, a surfactant, a foaming agent, an antifoaming agent, a thickening agent, an inclusion agent, a humectant, an absorbent, a diluent, a flocculating agent and a deflocculating agent, a filter aid, a release retardant, and a carrier.

[0033] The above pharmaceutically acceptable excipients are generally recognized for this purpose and are non-active ingredients of a medicament. A compilation of pharmaceutically acceptable excipients can be found in Handbook of Pharmaceutical Excipients, 2ndEdition, Edited by A. Wade and P.J. Weller; Published by American Pharmaceutical Association, Washington and The Pharmaceutical Press, London, 1994; and in the tool book of Chinese Pharmacopoeia-Pharmaceutical Excipients.

[0034] In some embodiments of the present application, the dosage form of the vaccine against the type 3 carp herpesvirus includes one of an injection vaccine, an oral vaccine, and a soaking vaccine.

[0035] In a fourth aspect of the present application, the use of the type 3 carp herpesvirus ORF138 gene inactivated strain according to the first aspect of the present application, and / or the vaccine against the type 3 carp herpesvirus according to the third aspect of the present application in the preparation of a product is provided.

[0036] In some embodiments of the present application, the product includes a reagent and / or a drug for the diagnosis, prevention, and treatment of the type 3 carp herpesvirus.

[0037] In some embodiments of the present application, the type 3 carp herpesvirus is a type 3 carp herpesvirus.

[0038] The present application has the following beneficial effects:

[0039] The present application constructs a type 3 carp herpesvirus ORF138 gene deletion strain, and the immunogenicity of the recombinant engineering vaccine is obtained after the strain is purified.

[0040] The recombinant engineering vaccine constructed in the present application knocks out the ORF138 gene, and the virulence is weakened, which significantly reduces the probability of disease and death of the immunized fish, thereby obtaining a better immune effect.

[0041] The recombinant genetically engineered vaccine provided by the present invention is an attenuated vaccine with excellent immunogenicity, which can induce a better immune response in fish and achieve immunization effects. Furthermore, the recombinant genetically engineered vaccine can induce the long-term and effective production of specific antibodies in immunized fish. Furthermore, compared to other types of vaccines, the recombinant genetically engineered vaccine has the advantage of a higher immunization rate, which can achieve better immunization effects in practical applications.

[0042] The preparation method of the recombinant genetic engineering vaccine provided by the present invention is simple: based on the wild-type virus strain of koi herpes virus, the GFP green fluorescent protein gene is used as a screening marker, and a recombinant transfer vector containing the ORF138 gene recombination arm is constructed by genetic engineering technology. The recombinant transfer vector and the wild-type virus are homologously recombined in a common carp brain cell line (CCB) by transfection technology to knock out the ORF138 gene in the wild-type, firstly obtain a KHV-T△ORF138 GFP virus suspension, inoculate CCB cells to directly pick the KHV-T△ORF138 GFP virus strain, and pick about 4 generations to obtain a purified KHV-T△

[0043] ORF138 GFP virus. DNA from the purified KHV-T△ORF138 GFP virus strain was extracted and transfected to obtain purified KHV-T△ORF138 without the GFP marker. Finally, the ORF138-deficient virus strain was expanded using cell culture technology to produce a recombinant genetically engineered vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0045] Figure 1 The results show that KHV-TΔO138GFP virus strain CTL221 was infected with CCB cells.

[0046] Figure 2 The results show that KHV-TΔO138 virus strain and CTF231 virus strain infected CCB cells.

[0047] Figure 3 The results of PCR identification of the purity of KHV-TΔO138 and KHV-TΔO138GFP virus strains are as follows: Lane 1: Marker, Lane 2: Negative control, Lane 3: KHV-TΔO138, Lane 4: KHV-TΔO138GFP.

[0048] Figure 4 These are the results of the live poison challenge experiment on koi in different experimental groups.

[0049] Figure 5 These are the experimental results of the protection rate after immunization and re-challenge. DETAILED DESCRIPTION

[0050] The concept and the technical effects of the present application will be described clearly and completely in combination with the embodiments, so as to fully understand the purposes, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0051] Example 1 Construction of the plasmid of KHV ORF138 gene deletion

[0052] 1. Amplification of KHV type 3 ORF138 gene and left and right arm fragments

[0053] The upstream and downstream primers for amplifying the ORF138 gene and the left and right arms were designed by using Geneious Prime:

[0054] KTO138R-HFF:

[0055] 5'-CGACTCTAGAGGATCCCCAGATGTTCTTGACCTCC-3' (SEQ ID NO: 1);

[0056] KTO138R-HFR:

[0057] 5'-GAATTCGAGCTCGGTACCCAGTGAACGAGCTGATGATG-3' (SEQ ID NO: 2);

[0058] Table 1 ORF138 PCR amplification system

[0059] Component Dosage Water 12.5 μL 2X Xtreme Buffer 25 μL 2 mM dNTPs 10 μL 100 μmol / L KTO138R-HFF 0.25 μL 100 μmol / L KTO138R-HFF 0.25 μL DNA template 1 μL KOD Xtreme Hot Start DNA Polymerase 1 μL

[0060] The conditions for PCR amplification are as follows: 94°C pre-denaturation for 2 min, 98°C denaturation for 10 s, annealing temperature 54°C, time 30 s, extension temperature 68°C, extension for 4 min, 5 cycles, 98°C denaturation for 10 s, annealing temperature 66°C, time 30 s, extension temperature 68°C, extension for 4 min, 30 cycles, and finally 68°C extension for 5 min.

[0061] PCR product was added with 10 μL of 6 × DNA electrophoresis loading buffer, 90V electrophoresis for 1 h, mixed and then electrophoresis identification, PCR product was about 4289 bp, after comparison with Marker to verify the size was correct, the gel was cut and recovered and purified. The purified PCR product was added with 9 μL of 1 × DNA electrophoresis loading buffer, 90V electrophoresis for 1 h, the size and purity of the purified PCR product were verified, and the correct KTO138R-HFF / HFR PCR purified product was stored at -20 °C.

[0062] 2. Constructing pUC-KTO138R plasmid by using thermal fusion technology

[0063] The pUC19 vector was digested into a linear fragment by using Smal, and the KTO138R-HFF / HFR PCR purified product was connected to the pUC19 vector by using a thermal fusion enzyme mixture to construct the pUC-KTO138R plasmid.

[0064] Table 2 5 × preassembled mixture

[0065]

[0066]

[0067] Table 3 2 × thermal fusion enzyme mixture

[0068]

[0069] Table 4 thermal fusion system

[0070] Component Dosage pUC19 enzyme cut product 0.5 μL KTO138R-HFF / HFR PCR purified product 1 μL Water 8.5 μL 2X Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq® Hot Start Taq ​

[0071] 3. Amplifying the DNA fragment of the deleted 138 gene

[0072] The upstream and downstream primers were designed by using Geneious Prime:

[0073] KTDO138G-HFF:

[0074] 5'-TGTATCTTAAGGGGGATCGACGCCGATGTTCAATTAC-3' (SEQ ID NO: 3);

[0075] KTDO138G-HFR:

[0076] 5'-GTCGACCTCGACGGGATCGTTGATGGTTGGTTGGTTG-3' (SEQ ID NO: 4); to amplify the gene fragment of the deleted ORF138 in the pUC-KTO138R plasmid.

[0077] Table 5 ORF138 PCR amplification system

[0078]

[0079]

[0080] The PCR amplification conditions are: 94°C pre-denaturation 2 min, 98°C denaturation 10 s, annealing temperature 55°C, time 30 s, extension temperature 68°C, extension 6 min, 5 cycles, 98°C denaturation 10 s, annealing temperature 65°C, time 30 s, extension temperature 68°C, extension 6 min, 30 cycles, finally 68°C extension 6 min.

[0081] The PCR product is added with 10 μL of 6×DNA electrophoresis loading buffer, and electrophoresis is performed at 90V for 1 h. After mixing, electrophoresis identification is performed. The PCR product is about 5913 bp. After verifying the size by comparison with the Marker, the gel is cut and recovered for purification. The purified PCR product is added with 9 μL of 1×DNA electrophoresis loading buffer, and electrophoresis is performed at 90V for 1 h. The size and purity of the purified PCR product are verified. The correct KTDO138G-HFF / HFR PCR purified product is stored at -20°C.

[0082] The sequence of the ORF138 gene is as follows:

[0083] ATGAACATCCTGATACTATTACCACTATTGACCTTGTGCGTCTTGTGTGAGGCGAGG

[0084] CGACACAAGTGCTTGAGTCCCGACCACATCAAGAACATCACGTTCTACATAAACCATGC

[0085] CAGGATGGAAAACTATACATGGCCGGCGTCGGTCTGCTCCTGCGACATTGACGATGAAG

[0086] ACTGTCGATGCAACCTACCGAGCCGGTACGATTTTCCGTGGATACCCGTCACATGGATAT

[0087] TTCACGGCGTATGCACAGAACAGAATAACACTAGGGACTACGGCTGGTTCTTTGAGATG

[0088] CAGGCGCTAGCCGCTGAGATACAACCGAGGATAACAGTAGGTGTCGACTGGTCGTGCG

[0089] ACTACCACAT G CCCACCACG GTCGAACACG TCGACTTGAT AGCCGATTACT TTATCAAAA

[0090] AGTATAGCGA CTCCCTTCAC CA CTG AATGCTG GGGCATAACCT ACGGGAGCATA GTGT

[0091] GCAACGTGCT GTCGCGGAGG ACCGGACCTC ACTACGACCC CACCATATTC CGTCTGGTT

[0092] GCTTTGGACG CCGTCGATTA CGATGGACTA CACCGACGGC TCGCCCCCAA TTACTGGTAC

[0093] AAGGACTCTA TGGACGCGTA CTACACGGTC GCGTTCAACA CAGGACCCGT CAGCGACAGC

[0094] CCATCAAGGA GATGGACCTC GTGGTCATGG CGGATTCGCC GCACAATAAT GTCAGCGCC

[0095] AAGGACATTT GGTTGAGGAT GCTCGACAGC TCACAACCCG TCATGTGCTT GAAC TACAC

[0096] AGGAGGAATA TTCACCAAAC GTCACGCGCT GAAATGGTTC AACTACAACG TAGACATGT

[0097] TGCACGGGTACGGGTACACCAACGTGTCCAACAACGGCACGCCGGTAGACTGTGTGTA

[0098] CCATATACCC GTTCCAACCA CCATCAGACC GACGACCACG CCGCGACGGA CGCCCAAGC

[0099] CAACCAGGCC GTTCGACCTC GACACGGAGT TTATGCAGAA CTGGATAGGA GGCTTCGTC

[0100] ATCCTCATGTCGTTCGTCTTCTTTCTGTTTGTCGTGGTGCTGCTGTGCCCCGAACGCAAG

[0101] ACGCCGATGTTCAATTACACCCACAACACCAGGCCGGTCCCCTACATCTACAGGCGACA

[0102] GGTCGCCGCCGAGGCCGCAGCAGCAGCGCCGGCAGCGCCGGACCCACCTCAGGTCTGA

[0103] (SEQ ID NO: 5).

[0104] 4. Construction of ORF138 deletion plasmid without GFP marker

[0105] The ends of KTDO138G-HFF / HFR PCR purified product were blunted and pUC-KTΔO138 plasmid with ORF138 gene deletion was constructed by self-ligation of PCR product using T4 ligase.

[0106] Table 6: Blunting ends of KTDO138G-HFF / HFR PCR purified product system

[0107]

[0108] Table 7: Ligation system

[0109]

[0110] The ligation reaction conditions were: 37°C for 15 min, 20°C for 1 h, and 15°C overnight. The product was transformed into E. coli competent cells and plated, and grown at 37°C overnight. Positive clones were selected and sequenced.

[0111] 5. Construction of ORF138 deletion plasmid with GFP marker

[0112] The linear pBl-GFP vector was obtained by BamHI digestion, and KTDO138G-HFF / HFR PCR purified product was ligated to pBl-GFP vector by hot fusion enzyme mixture to obtain pUC-KTΔO138GFP.

[0113] Table 8: Hot fusion system

[0114]

[0115]

[0116] The thermal fusion program was 50°C for 1 h, decreased to 20°C at a rate of 0.1°C per second, 20°C for 30 min, and 10°C storage. Transformation into E. coli competent cells and plating, growth at 37°C overnight, selection of positive clones and sequencing.

[0117] Example 2 Construction of fluorescent recombinant virus

[0118] 1. Homologous recombination in cells to obtain fluorescent deletion strain

[0119] The pUC-KTΔO138GFP plasmid was co-transfected with the genomic DNA of KHV-3 into common carp brain cells (CCB) using the FuGENE HD Transfection Reagent from Promega, and the transfection system was as follows: TM HD Transfection Reagent transfection reagent, and the transfection system was as follows:

[0120] 1 μg of pUC-KTΔO138GFP plasmid and 2 μg of KHV-T DNA were added to 100 μl of OptiMEM medium, vortexed and centrifuged, 8 μl of transfection reagent was slowly added, centrifuged and placed at room temperature for 20 minutes, the transfection reagent mixture was added to CCB cells, and the medium was changed within 24 hours. After 4 days of transfection, fluorescent plaques were picked under a microscope and stored at -80°C in medium.

[0121] 2. Purification of fluorescent recombinant virus

[0122] The picked fluorescent plaques were diluted 10-fold in a 24-well cell plate, and the dilution was diluted to 10 -6 , and multiple single clone plaques were picked in low concentration under an inverted fluorescence microscope and stored at -80°C in medium. The fluorescent plaques were thawed and the picked fluorescent plaques were diluted 10-fold in a 24-well plate, and single clone plaques were continuously selected, and repeated multiple times until no visible CPE was observed in the green fluorescent plaques under an inverted fluorescence microscope, and the purified KHV-TΔO138GFP virus strain CTL221 was obtained.

[0123] The KHV-TΔO138GFP virus strain CTL221 virus strain infected CCB cells under an inverted fluorescence microscope as shown in ​ .

[0124] Example 3 Construction of non-fluorescent recombinant virus

[0125] 1. Homologous recombination in cells to obtain non-fluorescent deletion strain

[0126] The pUC-KTΔO138 plasmid was co-transfected with the genomic DNA of KHV-TΔO138GFP (CTL221) virus strain into common carp brain cells (CCB) using the FuGENETM HD Transfection Reagent, transfection system as follows:

[0127] 100 μl OptiMEM medium was added 1 μg pUC-KTΔO138 plasmid and 2 μg KHV-TΔO138GFP (CTL221) strain of viral genome DNA, vortex and transient centrifugation, slowly add 8 μl transfection reagent, simple centrifugation and placed at room temperature for 20 minutes, the transfection mixture was added to CCB cells, 24 hours within the liquid change. After 4 days of transfection, non-fluorescent lesions were picked under the microscope in the culture medium-80°C.

[0128] 2, purification of non-fluorescent recombinant deletion virus

[0129] The picked non-fluorescent plaque was diluted in a 24 cell hole plate 10 times gradient, diluted to 10 -6 , using an inverted fluorescence microscope, picking multiple single clone plaques in low concentration in the culture medium-80°C, the non-fluorescent plaque was thawed and the picked non-fluorescent plaque was diluted in a 24 cell hole plate 10 times gradient, and the single clone plaque was selected, repeated several times, until no green fluorescence was determined in the non-fluorescent plaque under the inverted fluorescence microscope, and the purified KHV-TΔO138 strain CTF231 was obtained.

[0130] CCB cells infected with KHV-TΔO138 strain CTF231 strain under inverted microscope as ​ shown.

[0131] 3, PCR and sequencing to identify the purity of KHV-TΔO138 strain CTF231 and KHV-TΔO138GFP strain CTL221

[0132] The genomic DNA of KHV-TΔO138 strain CTF231 and KHV-TΔO138GFP strain CTL221 was extracted, and PCR amplification was performed using primer pair KTO138R-HFF (SEQ ID NO: 1), KTO138R-HFR SEQ ID NO: 2).

[0133] Table 9 ORF138 PCR amplification system

[0134] ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​ ​

[0135] PCR amplification conditions: 94℃ pre-denaturation 2 min, 98℃ denaturation 10 s, annealing temperature 54℃, time 30 s, extension temperature 68℃, extension 4 min, 5 cycles, 98℃ denaturation 10 s, annealing temperature 66℃, time 30 s, extension temperature 68℃, extension 4 min, 30 cycles, finally 68℃ extension 5 min.

[0136] The PCR product was added with 10 μL of 6×DNA electrophoresis loading buffer, and electrophoresis was carried out at 90 V for 1 h. After mixing, electrophoresis identification was carried out. The KHV-TΔO138 virus strain CTF231 PCR product was 3264 bp, and the KHV-TΔO138GFP virus strain CTL221 PCR product was 4875 bp, as shown in ​ . The size was verified to be correct by comparison with Marker, and was verified to be correct by sequencing, indicating that the KHV-TΔO138 (CTF231) and KHV-TΔO138GFP (CTL221) virus strains were both purified gene deletion strains.

[0137] The KHV-TΔO138 (CTF231) ORF138 deletion strain without fluorescent labeling was preserved in the China Center for Type Culture Collection (Wuhan, China, Wuhan University) on May 28, 2025, and was named as KHV-TΔORF138 Cyprinid herpesvirus 3, with a preservation number of CCTCC NO: V202540.

[0138] Example 4: Live challenge experiment of brocade carp and protection rate experiment of immunization and re-challenge

[0139] Brocade carps with an average body length of 10 cm ± 2 cm were selected as test fish, and the KHV-TΔO138 gene deletion recombinant virus strain CTF231 was used for live challenge experiment of brocade carps. The KHV-TΔO138 gene deletion recombinant virus experimental group, wild type virus group, and M199 culture medium control group were set up, with 60 fish in each group. 200 μL of KHV-TΔO138 gene deletion recombinant virus liquid with a TCID50 of 10 -5.35 , 120 μL of wild type virus liquid with a TCID50 of 10 -5.57 , and 200 μL of M199 culture medium were respectively injected into the abdominal cavity of the fish. The survival rate was counted every day for 28 days of cultivation. The results are shown in ​ . The survival rate of the KHV-TΔO138 gene deletion recombinant virus experimental group after 28 days of cultivation was 41.67%, and the survival rate of the wild type virus strain after 28 days of cultivation was 6.67%, indicating that the toxicity of the KHV-TΔO138 gene deletion recombinant virus was significantly reduced compared with the wild type virus.

[0140] The above-mentioned KHV-TΔO138 gene deletion recombinant virus experimental group survived koi were attacked by wild type strain with the concentration, and 60 koi were set as control group, cultured for 28 days, and the protection rate was counted every day. The results are shown in Table 1. ​ As shown in Table 1, the protection rate of KHV-TΔO138 gene deletion recombinant virus experimental group was 100%, while the control group was not immunized by attenuated vaccine, and all koi died after being attacked by wild type strain for 28 days. It is indicated that koi can produce high efficient immune protection effect by using KHV-TΔO138 gene deletion recombinant virus strain a131 for immunization.

[0141] In summary, KHV-TΔO138 gene deletion recombinant virus strain can be used as attenuated vaccine candidate strain for controlling and preventing KHV-3.

[0142] The embodiments of the present application are described in detail above with reference to the drawings, but the present application is not limited to the above-described embodiments, and various changes can be made within the knowledge of those skilled in the art without departing from the spirit of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A cyprinid herpesvirus type 3 ORF138 gene inactivated strain, characterized by: The cyprinid herpesvirus type 3 ORF138 gene inactivated strain is an attenuated virus strain obtained by inactivating the cyprinid herpesvirus type 3 ORF138 gene; The sequence of the ORF138 gene is shown in SEQ ID NO:

5.

2. The ORF138 gene-inactivated strain of herpesvirus cyprinid type 3 according to claim 1, characterized in that: The ORF138 gene inactivated strain of cyprinid herpesvirus type 3 carries a screening marker.

3. The ORF138 gene-inactivated strain of herpesvirus cyprinid type 3 according to claim 2, characterized in that: The screening marker includes at least one of a reporter gene and a selection marker gene.

4. The ORF138 gene-inactivated strain of herpesvirus cyprinid type 3 according to claim 1, wherein: The cyprinid herpesvirus 3 ORF138 gene-inactivated strain was deposited in the China Center for Type Culture Collection (Wuhan University, Wuhan, China) on May 28, 2025, with the name of cyprinid herpesvirus 3 gene-deleted strain KHV-T△ORF138 Cyprinidherpesvirus 3, and the deposit number is CCTCC NO: V202540.

5. A method for constructing a herpesvirus cyprinid type 3 ORF138 gene inactivated strain, comprising the following steps: Isolate and identify carp herpesvirus type 3, and inactivate the ORF138 gene.

6. The method according to claim 5, characterized in that: The inactivation method includes at least one of point mutation, homologous recombination, CRISPR / Cas9 system, transcription activator-like effector nuclease technology, and zinc finger nuclease technology.

7. A cyprinid herpesvirus type 3 virus vaccine, characterized in that: The cyprinid herpesvirus type 3 virus vaccine comprises the cyprinid herpesvirus type 3 ORF138 gene inactivated strain according to any one of claims 1 to 4.

8. The herpesvirus-3 vaccine according to claim 7, wherein: The herpesvirus cyprinid type 3 virus vaccine includes pharmaceutically acceptable excipients.

9. The herpesvirus-3 vaccine according to claim 7, wherein: The dosage form of the cyprinid herpesvirus type 3 vaccine includes one of an injection vaccine, an oral vaccine, and an immersion vaccine.

10. Use of the ORF138 gene-inactivated strain of herpesvirus cyprinid type 3 according to any one of claims 1 to 4, or the herpesvirus cyprinid type 3 vaccine according to any one of claims 7 to 9 in the preparation of products; The products include reagents and / or drugs for diagnosing, preventing and treating cyprinid herpes virus.

Images