Carp herpesvirus 3 type orf136 gene inactivation strain and preparation method and application thereof
By constructing a carp herpesvirus type 3 ORF136 gene inactivated strain, knocking out the ORF136 gene using homologous recombination technology and introducing a selection marker, a recombinant engineered vaccine was formed. This solved the problem that the ORF136 gene deletion strain could not be used as an attenuated live vaccine in the existing technology, and achieved a significant reduction in viral infectivity and improved immune protection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
- Filing Date
- 2025-06-13
- Publication Date
- 2026-04-21
AI Technical Summary
In the existing technology, the carp herpesvirus type 3 ORF136 gene deletion strain has not been effective as a gene deletion attenuated live vaccine, and it cannot significantly reduce the infectivity and lethality of the virus, and there is a lack of effective immune protection.
A carp herpesvirus type 3 ORF136 gene inactivated strain was constructed. The ORF136 gene was knocked out in carp herpesvirus type 3 through homologous recombination technology, and selection markers such as fluorescent protein genes were introduced to form a recombinant engineered vaccine. The virus strain was then expanded and purified using cell culture technology.
It significantly reduces the infectivity and lethality of the virus, enhances the immune response and antibody production in fish, provides long-term and effective immune protection, and has a simple preparation method with significant immunizing effects.
Smart Images

Figure BDA0005448825300000061 
Figure BDA0005448825300000081 
Figure BDA0005448825300000082
Abstract
Description
Technical Field
[0001] This invention belongs to the field of disease prevention and control in aquaculture, specifically relating to a carp herpesvirus type 3 ORF136 gene inactivated strain, its preparation method, and its application. Background Technology
[0002] Carp (Cyprinus carpio) is a widely farmed species worldwide and an important food source. Koi (Cyprinus carpio) is a subspecies of carp and a beautiful, colorful ornamental fish. Koi herpesvirus (KHV), officially known as koi herpesvirus type 3 (CyHV-3), is highly contagious and can induce severe outbreaks and mortality in carp or koi. It has now spread to most parts of the world, causing significant economic losses to the carp and koi farming industries.
[0003] CyHV-3 belongs to the order Herpesvirales, family Heteroherpesviridae, and genus Cyprinivirus. It is an enveloped double-stranded DNA virus with a viral particle diameter of 167–200 nm and a genome length of 295 kbp, flanked by two 22 kb terminal repeats. It is currently the largest known herpesvirus genome. CyHV-3 encodes 156 open reading frames (ORFs). Studies have shown that all 156 ORFs are transcribed into RNA during viral infection. Like other herpesviruses, most of its genes can be categorized into immediately expressed genes, early expressed genes, and late expressed genes based on their expression time.
[0004] CyHV-3 viral particles share the same morphological characteristics as other pathogens in the order Herpesviruses, consisting of an envelope, a cortex, and a capsid containing the viral genome. Currently, 46 viral proteins of CyHV-3 have been identified using mass spectrometry, including 16 envelope proteins, 3 capsid proteins, 2 cortical proteins, and 25 unknown proteins.
[0005] Live attenuated vaccines are live virus strains whose virulence has been reduced or eliminated through continuous passage in cell culture (conventional live attenuated vaccines) or through targeted viral genome editing (recombinant live attenuated vaccines). Unlike inactivated subunit, vector, or DNA vaccines, live attenuated vaccines highly represent the natural viral infection in the host. Numerous studies have reported that gene-deleted live attenuated vaccines can effectively and safely protect the host, typically maintaining the natural ability to enter the host. Live attenuated vaccines can induce both cell-mediated and humoral adaptive immune responses, providing a comprehensive range of immune responses and a long duration of immunity. They are among the most important and effective interventions against the spread of viral diseases, thus becoming a hot topic in CyHV-3 vaccine research.
[0006] ORF136 is one of the envelope proteins. The ORF136 gene contains a complete open reading frame, 474 bp in length, encoding a protein of 158 amino acids. Literature indicates that the ORF136 protein is primarily located in the cytoplasm. While envelope proteins play crucial roles in viral binding to cell receptors, viral infection of the host, and viral assembly and fusion with the host cell membrane, no existing technology has demonstrated that KHV ORF136 gene-deleted strains can be used as gene-deleted attenuated live vaccines. Summary of the Invention
[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:
[0008] In a first aspect, the present invention provides a carp herpesvirus type 3 ORF136 gene-inactivated strain, wherein the carp herpesvirus type 3 ORF136 gene-inactivated strain is an attenuated virus strain obtained by deleting the ORF136 gene from carp herpesvirus type 3.
[0009] In some embodiments of the present invention, the term "inactivation" includes, but is not limited to: the ORF136 gene being completely or partially knocked out, the ORF136 gene not being expressed, or the ORF136 gene being mutated so that the expressed protein does not have normal function.
[0010] In some embodiments of the present invention, the sequence of the ORF136 gene is shown in SEQ ID NO: 5.
[0011] In some embodiments of the present invention, the carp herpesvirus type 3 ORF136 gene inactivated strain may carry a selection marker.
[0012] In some embodiments of the present invention, the screening marker includes at least one of a reporter gene and a selection marker gene.
[0013] In some embodiments of the present invention, the reporter gene includes at least one of a fluorescent protein gene, a luciferase gene, and a β-galactosidase.
[0014] In some embodiments of the present invention, the selection marker gene includes an antibiotic resistance gene.
[0015] In some embodiments of the present invention, the antibiotic resistance gene includes at least one of penicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, ampicillin resistance gene, and puromycin resistance gene.
[0016] In some embodiments of the present invention, the carp herpesvirus type 3 ORF136 gene-inactivated strain is:
[0017] A second aspect of the present invention provides a method for constructing a carp herpesvirus type 3 ORF136 gene-inactivated strain according to the first aspect of the present invention, comprising the following steps:
[0018] Carp herpesvirus type 3 was isolated and identified, and the ORF136 gene was inactivated.
[0019] In some embodiments of the present invention, the inactivation method includes at least one of point mutation, homologous recombination, CRISPR / Cas9 system, transcription activation-like effector nuclease technology, and zinc finger nuclease technology.
[0020] In some embodiments of the present invention, the inactivation method is homologous recombination.
[0021] In some embodiments of the present invention, the homologous recombination method includes the following steps:
[0022] Upstream and downstream primers were designed targeting the ORF136 gene and its left and right arms to amplify the ORF136 gene.
[0023] The ORF136 gene and its left and right arms were ligated into a homologous recombination vector;
[0024] Based on the design of homologous recombination vectors, upstream and downstream primers for the deletion of the ORF136 gene fragment were used to amplify the homologous recombination vector that deletes the ORF136 gene.
[0025] Homologous recombination was performed by co-transfecting a homologous recombination vector lacking the ORF136 gene with genomic DNA of carp herpesvirus type 3.
[0026] In some embodiments of the present invention, the homologous recombination vector may have a selection marker, which includes at least one of a reporter gene and a selection marker gene.
[0027] In some embodiments of the present invention, the reporter gene includes at least one of a fluorescent protein gene, a luciferase gene, and a β-galactosidase.
[0028] In some embodiments of the present invention, the fluorescent protein gene includes at least one of green fluorescent protein, red fluorescent protein, and yellow fluorescent protein.
[0029] In some embodiments of the present invention, the selection marker gene includes an antibiotic resistance gene.
[0030] In some embodiments of the present invention, the antibiotic resistance gene includes at least one of penicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, ampicillin resistance gene, and puromycin resistance gene.
[0031] In some embodiments of the present invention, the inactivated strain of cyprinid herpesvirus type 3 ORF136 was deposited on May 28, 2025, at the China Center for Type Culture Collection (Wuhan University, Wuhan, China), named cyprinid herpesvirus type 3 gene deletion strain KHV-T△ORF136 Cyprinid herpesvirus 3, with accession number CCTCC NO: V202539.
[0032] A third aspect of the present invention provides a carp herpesvirus type 3 vaccine, wherein the carp herpesvirus type 3 vaccine comprises the carp herpesvirus type 3 ORF136 gene inactivated strain described in the first aspect of the present invention.
[0033] In some embodiments of the present invention, the carp herpesvirus type 3 vaccine includes pharmaceutically acceptable excipients.
[0034] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of the following: solvents, propellants, solubilizers, cosolvents, emulsifiers, colorants, binders, disintegrants, fillers, lubricants, wetting agents, osmotic pressure regulators, stabilizers, flow aids, flavoring agents, preservatives, suspending agents, coating materials, fragrances, anti-adhesion agents, integrators, penetration enhancers, pH adjusters, buffers, plasticizers, surfactants, foaming agents, defoamers, thickeners, encapsulating agents, humectants, absorbents, diluents, flocculants and anti-flocculators, filter aids, release inhibitors, and carriers.
[0035] The pharmaceutically acceptable excipients mentioned above are generally recognized for use in this purpose and as inactive ingredients in the pharmaceutical preparation. Compilations of pharmaceutically acceptable excipients can be found in reference books such as the *Handbook of Pharmaceutical Excipients* (2nd edition, edited by A. Wade and PJ Weller; published by the American Pharmaceutical Association, Washington and The Pharmaceutical 6Gess, London, 1994) and the *Pharmacopoeia of the People's Republic of China - List of Pharmaceutical Excipients*.
[0036] In some embodiments of the present invention, the dosage form of the carp herpesvirus type 3 vaccine includes one of the following: injectable vaccine, oral vaccine, and immersion vaccine.
[0037] A fourth aspect of the present invention provides the use of the carp herpesvirus type 3 ORF136 gene inactivated strain described in the first aspect of the present invention, and / or the carp herpesvirus type 3 vaccine described in the third aspect of the present invention in the preparation of products.
[0038] In some embodiments of the present invention, the product includes reagents and / or drugs for diagnosing, preventing, and treating carp herpesvirus.
[0039] In some embodiments of the present invention, the carp herpesvirus is carp herpesvirus type 3.
[0040] The beneficial effects of this invention are:
[0041] This invention constructs a koi herpesvirus ORF136 gene deletion strain, and after purification, an immunogenic recombinant engineered vaccine is obtained.
[0042] The recombinant genetically engineered vaccine constructed in this invention knocks out the ORF136 gene, greatly weakening its virulence and significantly reducing the probability of disease and death in immunized fish, thus achieving a better immunization effect.
[0043] The recombinant genetically engineered vaccine provided by this invention is a live attenuated vaccine with good immunogenicity, which can induce a better immune response in fish and achieve an immunizing effect. Furthermore, the recombinant genetically engineered vaccine can induce immunized fish to produce specific antibodies effectively and for a long period. Secondly, compared with other types of vaccines, the recombinant genetically engineered vaccine has the advantage of a high immunization rate, achieving better immunization effects in practical applications.
[0044] The recombinant genetically engineered vaccine preparation method provided by this invention is simple: Based on the wild-type koi herpesvirus strain, using the GFP (green fluorescent protein) gene as a selection marker, a recombinant transfer vector containing the ORF136 gene recombinant arm is constructed using genetic engineering technology. Transfection technology is used to induce homologous recombination between the recombinant transfer vector and the wild-type virus in a common carp brain cell line (CCB). The ORF136 gene is knocked out in the wild-type virus, first obtaining a KHV-T△ORF136 GFP virus suspension. This suspension is then inoculated into CCB cells, and the KHV-T△ORF136 GFP virus strain is directly picked. After approximately four generations, purified KHV-T△ORF136 GFP virus is obtained.
[0045] ORF136 GFP virus. DNA of the purified KHV-T△ORF136 GFP virus strain was extracted and transfected to obtain purified KHV-T△ORF136 without GFP label. Finally, the ORF136-deleted virus strain was expanded using cell culture technology to prepare a recombinant gene recombinant genetic engineering vaccine. Attached Figure Description
[0046] Figure 1 Results of CCB cell infection with KHV-TΔO136GFP virus strain a11111.
[0047] Figure 2 Results of CCB cell infection with KHV-TΔO136 virus strain a131 virus strain.
[0048] Figure 3 To determine the purity of KHV-TΔO136 and KHV-TΔO136GFP viral strains by PCR, the lanes from left to right are: Lane 1: Marker, Lane 2: Negative control, Lane 3: KHV-TΔO136, Lane 4: KHV-TΔO136GFP.
[0049] Figure 4 This study investigated live koi carp challenge experiments in different experimental groups.
[0050] Figure 5 The results of the protection rate experiment after immune re-challenge. Detailed Implementation
[0051] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0052] Example 1: Construction of ORF136 gene deletion plasmid for koi herpesvirus
[0053] 1. Amplification of the ORF136 gene and left and right arm fragments of carp herpesvirus type 3.
[0054] Design upstream and downstream primers for amplifying the ORF136 gene and its left and right arms using Geneious Primer:
[0055] KTO136R-HFF:
[0056] 5'-CGACTCTAGAGGATCCCCGGAGTTGAGTGATCACAGG-3' (SEQ ID NO: 1).
[0057] KTO136R-HFR:
[0058] 5'-GAATTCGAGCTCGGTACCCTACACATTCGAGAGCCAAC-3' (SEQ ID NO: 2).
[0059] Table 1. ORF136 PCR amplification system
[0060] Components dose water 12.5μL 2X Xtreme Buffer 25μL 2mM dNTPs 10μL 100 μmol / L KTO136R-HFF 0.25μL 100 μmol / L KTO136R-HFF 0.25μL DNA template 1μL KOD Xtreme Hot Start DNA Polymerase 1μL
[0061] The PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, annealing temperature 54℃ for 30 s, extension temperature 68℃ for 4 min, 5 cycles; 98℃ denaturation for 10 s, annealing temperature 66℃ for 30 s, extension temperature 68℃ for 4 min, 30 cycles; and a final extension at 68℃ for 5 min.
[0062] PCR products were added to 10 μL of 6× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h. After mixing, the PCR products were identified by electrophoresis. The PCR products were approximately 4011 bp. After confirming the correct size by comparison with the marker, the products were excised and purified. The purified PCR products were then added to 9 μL of 1× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h to verify the size and purity of the purified PCR products. The correct KTO136R-HFF / HFR PCR purified products were stored at -20 °C.
[0063] 2. Constructing the pUC-KTO136R plasmid using thermal fusion technology.
[0064] The pUC19 vector was digested into a linear fragment using SmaI, and the purified KTO136R-HFF / HFR PCR product was ligated into the pUC19 vector using a mixture of thermal fusion enzymes to construct the pUC-KTO136R plasmid.
[0065] Table 2 5× Pre-assembled Mixture
[0066] Components dose 1M Tris (pH 7.5) 500μL 1M magnesium chloride 50μL 10mM dNTPs 100μL 1M DTT 50μL PEG-8000 250mg water 150μL
[0067] Table 3 2× Heat Fusion Enzyme Mixture
[0068]
[0069] Table 4 Thermal Fusion System
[0070] Components dose pUC19 digestion product 0.5μL KTO136R-HFF / HFR PCR purified product 1μL water 8.5μL 2× heat fusion enzyme mixture 10μL
[0071] 3. Amplify the DNA fragment deleting gene 136.
[0072] Designing upstream and downstream primers using Geneious Primer
[0073] KTDO136G-HFF:
[0074] 5'-GTCGACCTCGACGGGATCGCACTTTAGAAAAAATCTAATGATGTATC-3' (SEQ ID NO: 3);
[0075] KTDO136G-HFR:
[0076] 5'-TGTATCTTAAGGGGGATCCTTCATGATGGTCGTCGC-3' (SEQ ID NO:4); amplify the gene fragment in pUC-KTO136R plasmid that lacks ORF136.
[0077] Table 5. ORF136 PCR amplification system
[0078] Components dose water 12.5μL 2X Xtreme Buffer 25μL 2mM dNTPs 10μL 100 μmol / L KTDO136G-HFF 0.25μL 100 μmol / L KTDO136G-HFR 0.25μL pUC-KTO136R (Template) 1μL KOD Xtreme Hot Start DNA Polymerase 1μL
[0079] The PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, annealing temperature 55℃ for 30 s, extension temperature 68℃ for 6 min, 5 cycles; 98℃ denaturation for 10 s, annealing temperature 65℃ for 30 s, extension temperature 68℃ for 6 min, 30 cycles; and a final extension at 68℃ for 6 min.
[0080] PCR products were added to 10 μL of 6× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h. After mixing, electrophoresis was performed to identify the PCR product, which was approximately 6247 bp. After confirming the correct size by comparison with the marker, the product was excised and purified. The purified PCR product was then added to 9 μL of 1× DNA electrophoresis loading buffer and electrophoresed at 90 V for 1 h to verify the size and purity of the purified PCR product. The correct KTDO136G-HFF / HFR PCR purified product was stored at -20 °C.
[0081] The sequence of the ORF136 gene is as follows:
[0082] ATGAAGGCCTCTAAACTGCTGCTGGTTACATGGGTGGCTTTCGCGGCCGGCCAGAACGC
[0083] CACCACCCTGGCTCCGCTCGCCGCCACTAACGGCACAACAACCATGAACTCTACCTGGT
[0084] CCTCTACCGCTTCAGTCATGAACTCTACTACCTGGTCCTCTACTATGAACTCTACCTGGTC
[0085] CACCACCACCGCGGCGAGCGGCGACTCTTGGTGGCGCCCAGAAGAGGTGCTGTCTAGG
[0086] TGTAGGGACCAGGCCGGACTGAACTGGCTGGGGGTGCGCTCAGGGTATGGTGGTGGTGA
[0087] TGGTCATCTTCGCTATCATCTTTGCCATCATCGTGATCGTCGTGGTGTGGGTGCTGATGCA
[0088] CGTCGTGATCGCCCGTCGCGACCCAGCCGGCGCGGCAGGGCCAGGAGCCATGTCTGCA
[0089] TCCTACAACAGGGGGCTACGTCGAGGATGAAGACGACGTCGTGCACTTTAGAAAATCTAA (SEQ ID NO: 5).
[0090] 4. Construct a GFP-label-free ORF136 deletion plasmid
[0091] The ends of the purified KTDO136G-HFF / HFR PCR product were padded with the ORF136 gene deleted, and the plasmid was constructed using T4 ligase.
[0092] Table 6. End-completion system for KTDO136G-HFF / HFR PCR purification products
[0093]
[0094] Table 7 Connection System
[0095]
[0096] The ligation reaction conditions were: 37℃ for 15 min, 20℃ for 1 h, and ligation overnight at 15℃. The cells were transformed into competent E. coli cells, plated, and grown overnight at 37℃. Positive clones were selected and sequenced.
[0097] 5. Construct a GFP-labeled ORF136 deletion plasmid
[0098] The linear pBl-GFP vector was obtained by digestion with BamHI, and the KTDO136G-HFF / HFR PCR purified product was ligated into the pBl-GFP vector to obtain pUC-KTΔO136GFP.
[0099] Table 8: Thermal Fusion System
[0100]
[0101] The heat fusion program was as follows: reaction at 50°C for 1 hour, then decreasing to 20°C at a rate of 0.1°C per second, reacting at 20°C for 30 minutes, and storing at 10°C. The cells were transformed into competent E. coli cells, plated, and grown overnight at 37°C. Positive clones were selected and sequenced.
[0102] Example 2 Construction of fluorescent recombinant virus
[0103] 1. Intracellular homologous recombination yields fluorescently inactivated strains
[0104] pUC-KTΔO136GFP plasmid was co-transfected with genomic DNA of carp herpesvirus type 3 into common carp brain cells (CCB) using Promega's FuGENE assay. TM HD Transfection Reagent transfection reagent, transfection system as follows:
[0105] Add 1 μg pUC-KTΔO136GFP plasmid and 2 μg KHV-T DNA to 100 μl of OptiMEM medium, vortex and briefly centrifuge, slowly add 8 μl of transfection reagent, centrifuge briefly and incubate at room temperature for 20 minutes, then add the transfection reagent mixture to CCB cells, changing the medium within 24 hours. Four days after transfection, pick fluorescent lesion plaques under a microscope and store them in culture medium at -80℃.
[0106] 2. Purification of fluorescent recombinant virus
[0107] The selected fluorescent lesion plaques were serially diluted 10-fold in 24-well plates to a final concentration of 10. -6 Using an inverted fluorescence microscope, multiple monoclonal plaques were picked at low concentrations and stored in culture medium at -80°C. After freezing and thawing, the selected fluorescent plaques were serially diluted 10-fold in 24-well plates. The process of selecting monoclonal plaques was repeated multiple times until no visually detectable CPE was found in the green fluorescent plaques under an inverted fluorescence microscope, thus obtaining the purified KHV-TΔO136GFP virus strain a11111.
[0108] KHV-TΔO136GFP virus strain a11111 virus strain infected CCB cells under an inverted fluorescence microscope Figure 1 As shown.
[0109] Example 3 Construction of non-fluorescent recombinant virus
[0110] 1. Intracellular homologous recombination yields non-fluorescent inactivated strains.
[0111] The pUC-KTΔO136 plasmid and the genomic DNA of the KHV-TΔO136GFP(a11111) viral strain were co-transfected into common carp brain cells (CCB) using Promega's FuGENE assay. TM HD Transfection Reagent transfection reagent, transfection system as follows:
[0112] Add 1 μg of pUC-KTΔO136 plasmid and 2 μg of genomic DNA of the KHV-TΔO136GFP(a11111) viral strain to 100 μl of OptiMEM medium, vortex and briefly centrifuge, slowly add 8 μl of transfection reagent, centrifuge briefly and incubate at room temperature for 20 minutes, then add the transfection mixture to CCB cells, changing the medium within 24 hours. Four days after transfection, pick non-fluorescent plaques under a microscope and store them in culture medium at -80°C.
[0113] 2. Purification of non-fluorescent recombinant deletion virus
[0114] The selected non-fluorescent lesion plaques were serially diluted 10-fold in 24-well plates to a final concentration of 10. -6 Using an inverted fluorescence microscope, multiple monoclonal plaques were picked at low concentrations and stored in culture medium at -80°C. Non-fluorescent plaques were then freeze-thawed and serially diluted 10-fold in 24-well plates. Monoclonal plaques were picked and the process was repeated multiple times until no green fluorescence was detected in the non-fluorescent plaques under an inverted fluorescence microscope, thus obtaining the purified KHV-TΔO136 virus strain a131.
[0115] KHV-TΔO136 a131 virus strain infected CCB cells under an inverted microscope, as shown in the image. Figure 2 As shown.
[0116] 3. PCR and sequencing were used to identify the purity of the KHV-TΔO136 virus strain and the KHV-TΔO136GFP virus strain.
[0117] DNA was extracted and purified from KHV-TΔO136 virus strain a131 and KHV-TΔO136GFP virus strain a11111, and identified by PCR using KTO136R-HFF / HFR primers.
[0118] KTO136R-HFF:
[0119] 5'-CGACTCTAGAGGATCCCCGGAGTTGAGTGATCACAGG-3' (SEQ ID NO: 1).
[0120] KTO136R-HFR:
[0121] 5'-GAATTCGAGCTCGGTACCCTACACATTCGAGAGCCAAC-3' (SEQ ID NO: 2).
[0122] Table 9 Identification System
[0123] Components dose water 12.5μL 2X Xtreme Buffer 25μL 2mM dNTPs 10μL 100 μmol / L KTO136R-HFF 0.25μL 100 μmol / L KTO136R-HFF 0.25μL DNA template 1μL KOD Xtreme Hot Start DNA Polymerase 1μL
[0124] The PCR amplification conditions were as follows: 94℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, annealing temperature 54℃ for 30 s, extension temperature 68℃ for 5 min, 5 cycles; 98℃ denaturation for 10 s, annealing temperature 66℃ for 30 s, extension temperature 68℃ for 5 min, 30 cycles; and a final extension at 68℃ for 5 min.
[0125] PCR products were added to 10 μL of 6× DNA electrophoresis loading buffer, and electrophoresis was performed at 90 V for 1 h. After mixing, electrophoresis was performed to identify the products. The PCR product size of KHV-TΔO136 virus strain a131 was 4011 bp, and the PCR product size of KHV-TΔO136 GFP virus strain a11111 was 5209 bp. Figure 3 As shown, the size was verified to be correct by comparison with the marker and by sequencing, indicating that both KHV-TΔO136(a131) and KHV-TΔO136GFP(a11111) virus strains are purified gene deletion strains.
[0126] The ORF136 deletion strain KHV-TΔO136(a131) without fluorescent label was deposited at the China Center for Type Culture Collection (Wuhan University, Wuhan, China) on May 28, 2025, with the name Cyprinid herpesvirus 3 gene deletion strain KHV-T△ORF136 Cyprinid herpesvirus 3 and accession number CCTCC NO: V202539.
[0127] Example 4: Koi carp live challenge experiment and protection rate experiment after immunization and re-challenge.
[0128] Koi carp with an average body length of 10cm ± 2cm were selected as experimental fish. Live challenge experiments were conducted on koi carp using the KHV-TΔO136 gene-deleted recombinant virus strain a131. Three groups were set up: a KHV-TΔO136 gene-deleted recombinant virus experimental group, a wild-type virus group, and an M199 culture medium control group. Each group contained 60 fish, and each group was intraperitoneally injected with 200μL of a TCID50 of 10-1. -5.35 KHV-TΔO136 gene deletion recombinant viral fluid, 120 μL TCID50 10 -5.57 Wild-type virus solution and 200 μL M199 medium were used. After 28 days of culture, the survival rate was recorded daily, and the results are as follows: Figure 4 As shown, the survival rate of the KHV-TΔO136 gene-deleted recombinant virus experimental group was 81.67% after 28 days of culture, while all wild-type strains died within 18 days, indicating that the KHV-TΔO136 gene-deleted recombinant virus had significantly lower virulence compared to the wild-type virus.
[0129] Koi surviving from the above recombinant virus experimental group were challenged with a high concentration of the wild-type virus strain, and a control group of 60 koi was set up. The koi were cultured for 28 days, and the protection rate was recorded daily. The results are as follows: Figure 5 As shown, the protection rate of the KHV-TΔO136 gene-deleted recombinant virus experimental group was 100%, while all koi in the control group, which had not been immunized with attenuated vaccine, died 28 days after being challenged with the wild-type strain. This indicates that immunizing koi with the KHV-TΔO136 gene-deleted recombinant virus strain a131 can produce a highly effective immune protection effect.
[0130] In conclusion, the KHV-TΔO136 gene-deleted recombinant virus strain can serve as a candidate strain for an attenuated vaccine to control and prevent carp herpesvirus type 3.
[0131] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. A carp herpesvirus type 3 ORF136 gene-inactivated strain, characterized in that: The inactivated strain of carp herpesvirus type 3 ORF136 was deposited at the China Center for Type Culture Collection on May 28, 2025, with the name KHV-T△ORF136 Cyprinid herpesvirus 3 and accession number CCTCC NO: V202539.
2. A carp herpesvirus type 3 vaccine, characterized in that: The carp herpesvirus type 3 vaccine comprises the carp herpesvirus type 3 ORF136 gene inactivated strain as described in claim 1.
3. The carp herpesvirus type 3 vaccine according to claim 2, characterized in that: The carp herpesvirus type 3 vaccine includes pharmaceutically acceptable excipients.
4. The carp herpesvirus type 3 vaccine according to claim 2, characterized in that: The dosage form of the carp herpesvirus type 3 vaccine includes one of the following: injectable vaccine, oral vaccine, or immersion vaccine.
5. The use of the carp herpesvirus type 3 ORF136 gene inactivated strain according to claim 1 and the carp herpesvirus type 3 vaccine according to any one of claims 2 to 4 in the preparation of the product; The product is a medication for the prevention of carp herpesvirus.
Citation Information
Patent Citations
Recombinant expression protein of 1301 ORF136 genes of herpesvirus cyprinid type 3, antibody and application of antibody
CN107056898A
Polyclonal antibody for resisting cyprinid herpesvirus type 3 ORF136 protein and application of polyclonal antibody
CN118344467A