Application of SNP site marker for predicting Kawasaki disease

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to application of an SNP site marker for predicting Kawasaki disease. The invention aims to identify single nucleotide polymorphism (SNP) sites related to KD pathogenesis on the basis of whole genome association analysis of 1874 Kawasaki disease patients and 6160 Southern Han control individuals. Through fine positioning analysis, rs1071644 in the PLCG2 gene is confirmed to be a potential pathogenic variation for the first time, when the locus is T, the high risk of Kawasaki disease exists, in a verification set, the AUC of the locus is 0.719, and the locus has good prediction performance and can be used as a detection marker for predicting Kawasaki disease.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an application of a SNP site marker for predicting Kawasaki disease. Background Art

[0002] Kawasaki disease (KD) is the most common cause of heart disease in children and can lead to permanent coronary artery damage and long-term complications such as coronary artery aneurysms. Despite the important clinical significance of KD, its genetic mechanism has not been fully elucidated. Genome-wide association studies (GWAS) have become a powerful tool for identifying pathogenic genes for complex trait diseases. Previous studies have identified as many as 62 genes associated with KD susceptibility, including BLK, CASP3, CD40, FCGR2A, HLA region, ITPKC, etc. However, these findings still need to be verified and confirmed in larger samples, especially in East Asian populations, to identify the true causal variants and their molecular mechanisms.

[0003] Therefore, it is necessary to develop new markers for predicting Kawasaki disease. Summary of the Invention

[0004] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0005] The first aspect of the present invention provides the use of the rs1071644 SNP site of the PLCG2 gene as a marker for assisting in predicting susceptibility to Kawasaki disease.

[0006] In some embodiments of the present invention,

[0007] The rs1071644 SNP site of the PLCG2 gene is located at position 101 from the 5' end to the 3' end of the sequence shown in SEQ ID NO: 1. The SNP site polymorphism is T / C. When the site is C, the patient is considered to be at high risk of Kawasaki disease.

[0008] In some embodiments of the present invention, when the SNP site is C, it assists in predicting a high risk of Kawasaki disease.

[0009] The second aspect of the present invention provides the use of a reagent for detecting the rs1071644 site of the PLCG2 gene in the preparation of a product for assisting in predicting susceptibility to Kawasaki disease.

[0010] In some embodiments of the present invention, the rs1071644 SNP site of the PLCG2 gene is located at position 101 from the 5' end to the 3' end of the sequence as shown in SEQ ID NO: 1, and the SNP site polymorphism is T / C. When the site is C, it is considered to be a high-risk group for Kawasaki disease.

[0011] In some embodiments of the present invention, the subjects of the product include humans, and further include Asian populations.

[0012] The third aspect of the present invention provides a product comprising a substance for detecting the rs1071644 SNP site of the PLCG2 gene.

[0013] In some embodiments of the present invention, the substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of: PCR, gene chip method, and nucleic acid sequencing method.

[0014] In some embodiments of the present invention, the product includes at least one of a reagent, a kit, a test paper, a chip, and a system.

[0015] In some embodiments of the present invention, the product includes a probe, such as

[0016] TGAATCACGCATTGTTTTCTCTCAA[T]GGGCGCACGGGCTACGTTTCTGCAGC (SEQ ID NO: 2); and

[0017] TGAATCACGCATTGTTTTCTCTCAA[C]GGGCGCACGGGCTACGTTTCTGCAGC (SEQ ID NO: 3).

[0018] “[]” indicates the position of the SNP mutation site.

[0019] In some embodiments of the present invention, the probe comprises a fluorescent group, and the fluorescent group comprises one of VIC and FAM.

[0020] In some embodiments of the present invention, the test samples of the product include body fluids and tissue samples.

[0021] In some embodiments of the present invention, the body fluid includes blood, lymph, and cerebrospinal fluid.

[0022] A fourth aspect of the present invention provides a system for assisting in predicting susceptibility to Kawasaki disease, comprising a computing device for predicting susceptibility to Kawasaki disease based on the detection results of the rs1071644 SNP site of the PLCG2 gene.

[0023] In some embodiments of the present invention, the system further comprises one or more of 1) to 3):

[0024] 1) a test result collection device, which may also be referred to as a test result input device, specifically, one or more of a mouse, a keyboard, a touch screen display, one or more buttons, one or more switches, one or more triggers, etc.;

[0025] 2) a diagnostic result output device, which may also be referred to as a diagnostic result display device, and may specifically be one or more of a liquid crystal display (LCD), a light emitting diode (LED) display, a plasma display, a projection display, a touch screen display, and the like;

[0026] 3) A diagnostic result sending device, which can send the result of distinguishing whether the subject is a high-risk or low-risk group to an information communication terminal device that can be viewed by the patient or medical staff.

[0027] The beneficial effects of the present invention are:

[0028] This study, based on a genome-wide association study of 1,874 patients with KD and 6,160 controls from southern Han Chinese, aimed to identify single nucleotide polymorphisms (SNPs) associated with the pathogenesis of KD. Systematic analysis identified 14 KD susceptibility loci, six of which were replicated in this study. Further fine-mapping analysis confirmed for the first time that rs1071644 in the PLCG2 gene was a potential pathogenic variant. This finding was supported by sQTL co-localization and GWAS analysis in two independent cohorts, reaching GWAS significance (OR = 1.27, P = 1.91E-12).

[0029] Furthermore, in the validation set, the AUC of this site was 0.719, which has good predictive performance and can be used as a detection marker for predicting Kawasaki disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0031] Figure 1 Principal component analysis and QQ plots reflect the population structure and P-value distribution of our center's KD GWAS, including: A. Principal component analysis (PCA) scatter plot of GWAS data from 8,079 Han Chinese children with peripheral blood samples; B. PCA scatter plot of GWAS data from 8,034 Han Chinese children after removing outlier samples; C. QQ plot of the KD trait GWAS; D. QQ plot of the KD trait GWAS after removing known susceptibility genes.

[0032] Figure 2A genome-wide association study of Kawasaki disease prioritized PLCG2 as a new susceptibility gene in Asian populations. A. Manhattan plot of a genome-wide association study of Kawasaki disease (KD) in a Han Chinese population; B. Regional association plot of the PLCG2 gene rs1071644 locus. The left vertical axis shows the –log10 P value, the right vertical axis corresponds to the recombination rate (represented by the blue curve), and the horizontal axis indicates the chromosomal position. The color of each variant indicates its linkage disequilibrium coefficient (r) with the lead variant. 2 , see figure legend); Forest plot of the C.rs1071644 (PLCG2) locus in the meta-analysis of GWAS and two independent validation cohorts. Included are genotyping results from our own GWAS cohort (discovery set) and from a southern and northern population using the Sequenom MassARRAY iPLEX Gold System (San Diego, USA).

[0033] Figure 3 The genomic annotation and association signal results of known loci in our center's KD GWAS include: AF. 6 independent genetic loci SNPs verified in this dataset: FCGRA (rs1801274, P = 3.41 × 10^ -13 ), CASP3(rs2696051, P=9.20×10^ -8 ), CD40(rs4810485, P=2.87×10^ -12 ), ITPKC(rs28493229, P=6.02×10^ -7 ), BLK(rs62489069, P=2.13×10^ -15 ) and HLA region (rs9274505, P = 3.08 × 10^ -14 ).

[0034] Figure 4 The genomic annotations and association signals of the suggestive loci in the KD GWAS of our center are shown in Figure 2. Among them, the 6 suggestive loci discovered by AF.GWAS are LINC00221-MIR5195 (rs2266163, P=9.25×10^-8), SLAMF7 (rs17313062, P=9.04×10^ -7 ), KCTD18(rs58671975, P=9.19×10^ -7 ), DCC(rs67750501, P=1.11×10^ -6 ), RPGRIP1 (rs113186054, P=5.55×10^ -6 ) and MIB1-GATA6-AS1 (rs7229476, P = 9.29 × 10^-6 ).

[0035] Figure 5 This is the ROC curve result of the PLCG2 rs1071644 site in the validation set.

[0036] Figure 6 Figure 3. The causal variant rs1071644T>C promotes the elimination of intron-retention alternative splicing in PLCG2. A. Fine-map mapping of the rs1071644 locus in the PLCG2 gene region on chromosome 16; B. Co-localization analysis of the KDGWAS and sQTL sites in the PLCG2 gene in whole blood (Note: Only representative tissue sQTL results are shown; the sQTL signal is consistent across multiple tissues / cells). The upper right subfigure shows the KD GWAS association results, the lower right subfigure shows the sQTL analysis results, and the left subfigure presents the co-localization characteristics of genetic association and sQTL signals; C. Real-time quantitative PCR analysis of PLCG2 intron retention in peripheral blood mononuclear cells of 60 healthy controls (19 with TT genotype, 34 with TC genotype, and 7 with CC genotype); D. DNA agarose gel electrophoresis analysis of PLCG2 intron retention type (PLCG2_IR) and mature transcript (PLCG2_MI) in samples of different genotypes from 11 healthy controls and 10 KD patients (primer P1); E. DNA agarose gel electrophoresis analysis of PLCG2_IR and PLCG2_MI band changes in primary HUVECs of different genotypes after treatment with 3μg / μL LCWE for 24 hours (primer P1); F. 3μg / μL Western immunoblot analysis of PLCG2 protein expression in HUVECs of different genotypes after LCWE treatment for 24 h (β-actin as an internal control, *P < 0.05, **P < 0.01, ***P < 0.001).

[0037] Figure 7 Figure 1: Functional validation of the causal variant rs1071644 as a sQTL for PLCG2, including: A. Colocalization analysis of the rs1071644 locus; B. Phenotype-wide association study showing the strength of association between rs1071644 and multisystem disease categories; C. Schematic diagram of the PLCG2 protein domain composition and the mechanism of the effect of rs1071644 on posttranscriptional regulation; D. Schematic diagram of the structural features of the PLCG2-IR and PLCG2-MI isoforms in HUVECs verified by Sanger sequencing. DETAILED DESCRIPTION

[0038] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0039] Example 1 Genome-wide association analysis of genetic variation in Kawasaki disease

[0040] 1. Sample Description

[0041] This study, based on data from the Guangzhou Women and Children's Medical Center, genotyped 8034 Han Chinese individuals from the discovery cohort. This study was approved by the Ethics Committee of the Guangzhou Women and Children's Medical Center (ethics approval numbers: 2014073009, 2018052702, and 2021093A01) and registered with the Chinese Clinical Trial Registry (registration number: ChiCTR-EOC-17013266, http: / / www.chictr.org.cn / showproj.aspx?proj=22637). Independent validation cohorts were recruited from two medical centers: 946 cases and 776 controls (Southern Han Chinese) were recruited from the Guangzhou Women and Children's Medical Center, and 393 cases and 562 controls (Northern Han Chinese) were recruited from the Beijing Children's Hospital (ethics approval number: 2019-4). Sample sizes for each cohort are summarized in Table 1.

[0042] Table 1 Number of samples in each cohort

[0043]

[0044] 2. Experimental Methods

[0045] 1) Peripheral blood mononuclear cell (PBMC) extraction

[0046] PBMCs are isolated from whole blood using density gradient centrifugation. Blood samples are collected in EDTA-anticoagulant tubes and immediately centrifuged at 1000 rpm. After plasma separation, the remaining blood cells are diluted 1:1 with PBS to reduce viscosity. 4 mL of human peripheral blood lymphocyte separation buffer is added to a 15 mL conical centrifuge tube, and the diluted blood is slowly layered onto the separation buffer along the tube wall. Centrifugation is performed at 1500 rpm for 20 minutes, with acceleration and deceleration rates set at 4 to separate the plasma, PBMCs, and red blood cells. PBMCs are located at the interface between the plasma and separation buffer. Using a sterile pipette, PBMCs are transferred to a new 15 mL centrifuge tube containing 4 mL of PBS. After washing twice with PBS, the PBMCs are resuspended in 1 mL of PBS and transferred to a 1.5 mL EP tube. Centrifugation is performed at 1800 rpm for 5 minutes, and the supernatant is discarded. The PBMC pellet is finally resuspended in an appropriate buffer or frozen at -80°C for subsequent DNA or RNA extraction.

[0047] 2) Quality control and correlation analysis

[0048] Genomic DNA was extracted from peripheral blood and genotyped using the Illumina Infinium Asian Screening Array-24 v1.0 (ASA) platform according to the kit instructions. Illumina GenomeStudio 2.0 was used for genotype calling, and the results were converted to PLINK format. Genotypes were normalized to the 1000 Genomes Project Phase III reference sequence using Genotype Harmonizer. Exclusion criteria included a site success rate less than 92%, a minor allele frequency (MAF) less than 3%, abnormal sex determination, heterozygosity deviating from the mean by more than 3 standard deviations, and failure to meet Hardy-Weinberg equilibrium (P < 1E-04).

[0049] Principal component analysis (PCA) was used to examine population stratification, revealing no significant structural differences between samples. After quality control, 1874 KD cases and 6160 controls were retained. Genotype imputation was performed using IMPUTE2 software, referencing the 1000GenomesPhase 3 database, with parameters set to INFO ≥ 0.9, accuracy ≥ 0.9, and MAF ≥ 3%. The association between SNPs and KD was assessed using a generalized linear model in SNPTEST (v2.5.6), with the first three principal components and sex as covariates. The genomic inflation factor (λGC) was 1.03, indicating a low false-positive rate.

[0050] 3. Experimental results

[0051] Previous studies have identified multiple loci associated with KD genetic effects. To understand the potential pathogenic variants and molecular pathways regulating vasculitis, this study systematically integrated genome-wide studies to identify susceptibility loci associated with KD. A total of 8,079 peripheral blood samples from Han Chinese children were included, and principal component analysis (PCA) was used to assess the population genetic structure ( Figure 1 After removing abnormal samples, 8,034 samples (1,874 KD patients and 6,160 sex-matched healthy controls) were retained for genome-wide association analysis and systematic bioinformatics analysis ( Figure 1 By drawing a QQ plot comparing case-control genotype frequencies, the results showed that the genomic expansion factor λ was 1.03 (see Figure 1 C), after correction of known KD susceptibility genes, the λ value was 1.02 (see Figure 1 (D), suggesting that the emerging loci have underlying susceptibility and that genotypic misclassification or population substructure are not responsible for the differences in expansion factors.

[0052] Through GWAS, this example identified 14 single nucleotide polymorphisms (SNPs) that were significantly associated with KD risk ( Figure 2 Among them, the SNPs located at 8 independent genetic loci include: the reported FCGRA (rs1801274, P = 3.41 × 10^ -13 ), CASP3(rs2696051, P=9.20×10^ -8 ), CD40(rs4810485, P=2.87×10^ -12 ), ITPKC(rs28493229, P=6.02×10^ -7 ), BLK(rs62489069, P=2.13×10^- 15 ) and HLA region (rs9274505, P = 3.08 × 10^ -14 )( Figure 3 In addition, this study discovered two new KD susceptibility loci: PLCG2 (rs1071644, P = 5.08 × 10^ -8 )( Figure 2 Middle B) and FOXP1 (rs12633797, P = 7.51 × 10^ -10 ), and 6 suggestive loci: LINC00221-MIR5195 (rs2266163, P = 9.25 × 10^ -8 ), SLAMF7 (rs17313062, P=9.04×10^ -7 ), KCTD18(rs58671975, P=9.19×10^ -7), DCC(rs67750501, P=1.11×10^ -6 ), RPGRIP1 (rs113186054, P=5.55×10^ -6 ) and MIB1-GATA6-AS1 (rs7229476, P = 9.29 × 10^ -6 )( Figure 4 ).

[0053] The rs1071644SNP site of the PLCG2 gene is located at chr16:81971403 (GRCh37).

[0054] The rs1071644 SNP site of the PLCG2 gene is located at position 101 from the 5' end to the 3' end of the sequence shown in SEQ ID NO: 1. The SNP site polymorphism is T / C. When the site is C, the patient is considered to be at high risk of Kawasaki disease.

[0055] GGCCTAGGGGGCCAGCGTGCTCATGCCTGACTTACAGCAGGCGTTCACTTTCCTTCCCAGATAAGTACATGCAGATGAATCACGCATTGTTTTCTCTCAA[T]GGGCGCACGGGCTACGTTCTGCAGCCTGAGAGCATGAGGACAGAGAAATATGACCCGATGCCACCCGAGTCCCAGAGGAAGATCCTGATGACGCTGACAG (SEQ ID NO: 1).

[0056] “[]” indicates the position of the SNP site, which has a genetic polymorphism of [T / C].

[0057] The reagent used to detect the SNP site was a ThermoFisher probe (Assay ID: C___9510619_10, Catalog #4351379), wherein the sequence of the probe is shown in SEQ ID NO: 2, 3.

[0058] TGAATCACGCATTGTTTTCTCTCAA[T]GGGCGCACGGGCTACGTTTCTGCAGC (SEQ ID NO: 2); and

[0059] TGAATCACGCATTGTTTTCTCTCAA[C]GGGCGCACGGGCTACGTTTCTGCAGC (SEQ ID NO: 3).

[0060] Example 2 Validation of markers

[0061] To exclude the influence of heterogeneity between the southern and northern Chinese populations, this study used two independent cohorts to verify the allele frequency difference of rs1071644. After validation based on independent samples from the southern population (1,722 cases) and the northern population (955 cases), the integration of all samples further confirmed the effect of the PLCG2 (rs1071644) risk variant. The results showed that this locus was significantly associated with the risk of KD (OR = 1.27, 95% CI: 1.19-1.35; P = 1.91×10^ -12 ), and the C allele significantly increases disease susceptibility ( Figure 2 (C). Notably, the association with FOXP1 (rs12633797) could not be replicated due to the presence of a short tandem repeat (STR) motif (TTTT) within its target sequence. This repeat element may induce DNA polymerase slippage during PCR amplification, leading to heterogeneous product length and nonspecific amplification, thereby interfering with allele-specific recognition by the TaqMan probe.

[0062] Furthermore, ROC curve analysis was performed based on 955 patients from Beijing and 1722 patients from Guangzhou. Figure 5 The area under the curve reached 0.716, with good specificity and sensitivity.

[0063] Example 3rs1071644 exerts a causal variant effect by regulating PLCG2 intron-retaining alternative splicing

[0064] 1. Experimental methods

[0065] 1) Fine-mapping and positioning analysis

[0066] This study, based on KD GWAS summary data, performed fine-mapping analysis on regions containing functional pleiotropic variants within relatively independent linkage disequilibrium (LD) blocks. In this example, causal blocks containing PLCG2 were selected. The GWAS results for each block were converted to the input format of the fine-mapping tool used and aligned and normalized with variants of the same coordinates and alleles in a reference panel. Complementary alleles were also normalized. An LD matrix was constructed by calculating the Pearson correlation coefficient between each SNP within the block. FINEMAP (v1.4) was used to analyze the summary statistics within each block against the matched LD matrix. The analysis assumed that each block contained only one pathogenic variant, and FINEMAP recommended parameters were used. The tool outputs the posterior probability (PP) of each variant being causal. In this example, the potential pathogenic variants within the PP value were recorded.

[0067] 2) sQTL co-localization analysis

[0068] This example analyzes whether there is a co-functional effect between KD pleiotropic variants and cross-tissue sQTL data in the GTEx V7 database. Taking peripheral blood (620 unrelated donors) data as an example, co-localization analysis was used to obtain the posterior probabilities of multiple hypotheses (PPH0-PPH4): PPH0 indicates no association with any trait; PPH1 refers to association with gene splicing but does not affect KD risk; PPH2 represents association with KD but does not affect splicing; PPH3 refers to association with both KD and splicing but with different causal mutations; PPH4 is the splicing and KD risk in the target region driven by the same variant. This example focuses on genes with PPH4 ≥ 0.75. Co-localization analysis was performed using the R packages "coloc" (v5.2.3) and "locuscomparer" (v1.0.0).

[0069] 3) Meta-analysis of KD-related GEO datasets

[0070] Four KD-related datasets (GSE68004, GSE73461, GSE73463, and GSE63881) were downloaded from the GEO database (https: / / www.ncbi.nlm.nih.gov / geo / ), all based on the GPL10558 platform. The R package "limma" (v3.50.3) was used to analyze the differential expression of target genes between KD patients and healthy controls in each dataset.

[0071] 2. Experimental results

[0072] To identify potential functional genetic variants that affect the risk of Kawasaki disease, this study used the Bayesian statistical fine-mapping tool FINEMAP to analyze the PLCG2 locus after excluding complex associations in the HLA region. The results showed that rs1071644 (posterior probability PP = 0.62, Figure 6 A) was identified as a potential causal variant in the relevant region. Based on a systematic analysis of 4,756 GWAS samples from the Phenotype Group Association Study (PheWAS) (data from https: / / atlas.ctglab.nl / ), it was found that rs1071644 was most strongly associated with the Kawasaki disease phenotype. Specifically, the rs1071644 site of the PLCG2 gene is closely associated with KD-related phenotypes such as vascular / cardiac dysfunction and mean platelet volume ( Figure 7 Middle B).

[0073] Co-localization analysis revealed that rs1071644 is located in a high linkage disequilibrium region in the KD GWAS data, and based on the GTEx database (https: / / gtexportal.org / home / ), it was confirmed that this site has a strong alternative splicing regulatory effect on the PLCG2 gene ( Figure 6 Middle B). RefSeq Gene and Ensembl database annotations show that the human PLCG2 gene contains 8 functional domains, and its intron 27 retention type splicing is specifically regulated by the rs1071644 genotype ( Figure 7 In particular, GTEx data showed that the rs1071644-C allele was significantly associated with efficient splicing of intron 27 of PLCG2 in whole blood and related tissues (P = 1.17 × 10^ -70 ), and this result was verified in peripheral blood mononuclear cell (PBMC) samples of 60 healthy controls with different rs1071644 genotypes in our center (independent of experimental samples outside the above cohort) (P<0.001, Figure 6 Reverse transcription polymerase chain reaction (RT-PCR, P1+P2 primers) and DNA agarose gel electrophoresis analysis of clinical samples (11 healthy controls, 10 KD patients, and clinical samples independent of the above cohort) and HUVECs in a KD model (LCWE-induced) showed that samples carrying the rs1071644-T allele significantly promoted the splicing of intron 27 of PLCG2, resulting in decreased expression of the mature splicing isoform (PLCG2_MI) and increased expression of the intron-retaining isoform (PLCG2_IR) ( Figure 6 Western blot further confirmed that the expression level of PLCG2 protein was higher in HUVECs with the rs1071644-CC genotype and was significantly upregulated in the LCWE-induced KD-like model ( Figure 6 The above evidence collectively indicates that rs1071644 acts as a splicing quantitative trait locus (sQTL) and plays a causal role by regulating the retention-type alternative splicing of intron 27 of PLCG2.

[0074] The sequences of primers P1 and P2 are as follows:

[0075] P1F: CTGTGCGGTTCTCAGATG (SEQ ID NO: 4);

[0076] P1R: TGTCCTCATGCTCTCAGG (SEQ ID NO: 5);

[0077] P2F: CAGATGGTGGCACTCAAT (SEQ ID NO: 6);

[0078] P2R: CTCTAATGGACGACGATGTA (SEQ ID NO: 7).

[0079] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. Application of the rs1071644 SNP site of the PLCG2 gene as an auxiliary marker for predicting susceptibility to Kawasaki disease.

2. The use according to claim 1, characterized in that: The rs1071644 SNP site of the PLCG2 gene is located at position 101 from the 5' end to the 3' end of the sequence shown in SEQ ID NO: 1, and the polymorphism of the SNP site is T / C.

3. The use according to claim 1, characterized in that: When the SNP site is C, it assists in predicting a high risk of Kawasaki disease.

4. Application of reagents for detecting the rs1071644 SNP site of the PLCG2 gene in the preparation of products to assist in predicting susceptibility to Kawasaki disease.

5. A product comprising a substance for detecting the rs1071644 SNP site of the PLCG2 gene.

6. The product according to claim 5, characterized in that: The substance comprises a substance used in one or more detection techniques or methods selected from the group consisting of: PCR, gene chip method, and nucleic acid sequencing method.

7. The product according to claim 6, characterized in that: The product includes at least one of a reagent, a test kit, a test paper, a chip, and a system.

8. The product according to claim 7, characterized in that: The product includes a detection probe; The sequences of the probes are shown in SEQ ID NOs: 2 and 3.

9. A system for assisting in predicting susceptibility to Kawasaki disease, characterized by: The system comprises a computing device for predicting Kawasaki disease susceptibility according to a detection result of the rs1071644 SNP site of the PLCG2 gene.

10. The system according to claim 9, characterized in that: The system further includes one or more of 1) to 3): 1) Test result collection device; 2) diagnostic result output device; 3) Diagnosis result sending device.

Images