A method for identifying the original plant of fructus aurantii based on InDel molecular markers and a special primer combination
By designing specific InDel primer combinations YCC-F/R and SC-F/R, the problem of identifying the original plant of Citrus aurantium was solved, enabling rapid and accurate differentiation of the original plant of Citrus aurantium, which is suitable for the traceability of medicinal materials and ensures the quality of medicinal materials.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2025-08-12
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies are insufficient to efficiently distinguish between sour oranges, sweet oranges, and young Yichang oranges, resulting in unclear origins of the trifoliate orange, which affects efficacy and quality control across the industry chain.
Specific InDel primer pairs YCC-F/R and SC-F/R were designed to identify the original plant of Citrus aurantium by PCR amplification and gel electrophoresis. Primer pair YCC-F/R was used to distinguish Yichang orange from sour orange and sweet orange, while primer pair SC-F/R was used to distinguish sour orange from sweet orange.
It enables rapid and accurate identification of the original plant of Citrus aurantium, reduces costs and time, is suitable for large-scale traceability of medicinal materials, and ensures the uniformity of medicinal material quality.
Smart Images

Figure CN120776043B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and identification of traditional Chinese medicinal materials, specifically involving specific InDel molecular markers, detection methods, and kits for identifying the original plant of Citrus aurantium. Background Technology
[0002] According to the Pharmacopoeia of the People's Republic of China (2020 edition), Aurantii Fructus Immaturus is a plant of the Rutaceae family, specifically Citrus aurantium (Citrus aurantium). Citrus aurantium L.) and its cultivated varieties or sweet orange ( Citrus sinensis The dried young fruit of Osbeck. However, in reality, Yichang oranges (also known as Yichang oranges) are also collected in places like Yichang, Hubei. Citrus ichangensis The sale of young *Citrus aurantium* (swingle) fruits as raw materials for medicinal use has led to a situation where the original plant of *Citrus aurantium* is unclear and its medicinal efficacy is difficult to control. *Citrus aurantium* possesses pharmacological effects such as clearing qi stagnation, resolving phlegm, and dispersing masses. Given consumers' increasing emphasis on health and wellness, its industry has broad development prospects. However, due to the similar morphological characteristics of young fruits of sour oranges, sweet oranges, and Yichang oranges, they are difficult to distinguish, and traditional identification methods suffer from limitations such as low efficiency, long cycles, and high costs. Furthermore, the different secondary metabolites accumulated by sour oranges, sweet oranges, fragrant oranges, and Yichang oranges—such as high accumulation of neohesperidin and naringin in sour oranges, high accumulation of hesperidin in sweet oranges, and high accumulation of naringin in Yichang oranges—pose serious challenges to the traceability of raw materials and quality control of traditional Chinese medicine preparations in the industrialization of medicinal *Citrus aurantium*.
[0003] Currently, molecular marker technologies such as Indel and KASP, which target and analyze genomic polymorphic sites, have been widely applied to the assessment and precise identification of genetic diversity in Citrus germplasm resources, providing technical support for building an efficient plant germplasm identification system. However, systematic research reports on specific molecular markers for different origins of Citrus aurantium have not yet been found, which restricts the standardization of medicinal material origins and the standardization of the industrial chain. Therefore, developing novel molecular marker technologies based on high-throughput sequencing to achieve rapid and accurate identification of Citrus aurantium origins is of key scientific significance and practical value for ensuring the uniformity of medicinal material quality, improving the traceability system, and promoting the sustainable and high-quality development of the Citrus aurantium industry. Summary of the Invention
[0004] The purpose of this invention is to provide a set of specific InDel primer combinations that can accurately distinguish the three major original plants of Citrus aurantium (Yichang orange, sour orange, and sweet orange) and their application methods.
[0005] To achieve the above objectives, the applicant screened a set of specific primer pairs for identifying the original plant of *Citrus trifoliata* through genome resequencing of sweet orange, sour orange, and Yichang orange, including:
[0006] (a) Primer pair YCC-F / R, whose nucleotide sequences are shown in SEQ ID NO:1 and SEQ ID NO:2;
[0007] (b) Primer pair SC-F / R, whose nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:4;
[0008] The primer pair combination is used to distinguish between Yichang orange, sour orange and sweet orange, which are plants of the Rutaceae family.
[0009] Furthermore, a method for identifying the original plant of Citrus aurantium was developed using the primer pair combination, comprising the following steps:
[0010] (1) Extract DNA from the sample to be tested;
[0011] (2) Using the extracted DNA as a template, PCR amplification was performed using the primer pair combination described above.
[0012] (3) Perform gel electrophoresis on the PCR products and distinguish Yichang orange, sour orange and sweet orange, which are plants of Rutaceae family, based on the specific bands.
[0013] The PCR amplification reaction system consisted of: 10 μL 2×Phanta Max Buffer, 0.4 μL dNTPMix, 0.4 μL Phanta Max Super-Fidelity DNA Polymerase, 0.8 μL forward primer, 0.8 μL reverse primer, 1 μL DNA template, and 6.6 μL ddH2O.
[0014] The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.
[0015] Using YCC-F / R as primers, if a single band of 1000 bp is produced by gel electrophoresis, it is identified as Yichang orange; if a double band of 1000 bp and 1200 bp is produced, it is identified as sour orange or sweet orange, thus achieving the germplasm differentiation between Yichang orange and sour orange, and between Yichang orange and sweet orange. Using SC-F / R as primers, if a single band of 1300 bp is produced by gel electrophoresis, it is identified as sour orange; if a double band of 1200 bp and 1300 bp is produced, it is identified as sweet orange, thus achieving the germplasm differentiation between sour orange and sweet orange.
[0016] The present invention also provides a molecular marker kit for identifying the original plant of Citrus aurantium, comprising the primer pair combination, PCR reaction reagents (high-fidelity enzyme, dNTPs, buffer) and positive control DNA (Yichang orange / sour orange / sweet orange genome).
[0017] The beneficial effects of this invention are:
[0018] This invention is the first to develop a dedicated molecular marker combination for the original plant of Citrus aurantium, filling a technological gap in this field. The designed primers exhibit high germplasm specificity, and the method is low-cost and short-cycle. This invention requires only conventional PCR instruments and electrophoresis equipment, without sequencing, making it suitable for large-scale traceability of medicinal materials. The reliability of the primers and method was confirmed by validating 22 samples of Yichang orange, 17 samples of sour orange, and 8 samples of sweet orange covering mainstream cultivated varieties. Attached Figure Description
[0019] Figure 1 Gel electrophoresis image of the original plant of Citrus aurantium amplified using primers YCC-F / R. In the image, A represents Yichang orange; B represents sour orange; C represents sweet orange; M represents marker; sample number and germplasm information are shown in Table 1.
[0020] Figure 2 Gel electrophoresis image of the original plant of Citrus aurantium amplified using primers SC-F / R. In the image, M: Marker; sample number and germplasm information are shown in Table 1.
[0021] Figure 3 A schematic diagram of the process for identifying the original plant of Citrus aurantium using molecular marker primers. Detailed Implementation
[0022] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and not for limiting the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art based on the following embodiments should also be considered to fall within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions or reference books such as *Molecular Cloning: A Laboratory Manual* (New York: Cold Spring Harbor Laboratory, 2017), or according to the methods recommended in the manufacturer's operating manual. Materials in the embodiments that do not specify their source are all commonly used materials in the art and can be obtained commercially.
[0023] 1. Materials and Methods
[0024] 1.1 Reagents and Materials
[0025] Reagents: The high-fidelity enzyme (Phanta Max Super-Fidelity DNA Polymerase) and the PCR kit were purchased from Vazyme Biotech Co., Ltd.; the PCR primers were synthesized by Tsingke Biotechnology Co., Ltd.
[0026] Plant materials: The information of different original plant samples of Fructus Aurantii Immaturus is shown in Table 1.
[0027] Table 1. Information of different original citrus germplasms that can be used to produce Fructus Aurantii Immaturus
[0028]
[0029] 1.2 Experimental methods
[0030] 1.2.1 Design and screening of InDel primers
[0031] Design of InDel primers: Based on the genome resequencing data of sweet orange, sour orange, and Ichang papeda, specific high-quality primer pairs were designed. Sites with large fragment insertions / deletions (InDels) of more than 50 bp were selected to ensure significant polymorphisms. The primer pairs were designed 500 bp upstream and downstream of the insertion / deletion sites using SnpGene4.1.9 software to ensure amplification specificity.
[0032] Screening of InDel primers: The above InDel marker primer pairs were screened for effectiveness. Finally, two pairs of InDel primers, YCC-F / R and SC-F / R, that could distinguish different original plants of Fructus Aurantii Immaturus were screened out. Among them, YCC-F / R can be used to distinguish Ichang papeda from sour orange and Ichang papeda from sweet orange; SC-F / R can be used to distinguish sour orange from sweet orange. Their nucleotide sequences are as follows:
[0033] YCC-F: CTAATTTTCTTTTGTACTGCGTGC5’- 3’
[0034] YCC-R: AAGTAGCTTAATTCGTTCACAGAC5’- 3’
[0035] SC-F: TAGTGCAACAAGCACCTCTCTTA5’- 3’
[0036] SC-R: GAAACATTTAGTGGTGTTCTCATG5’- 3’
[0037] 1.2.2 PCR amplification and gel electrophoresis analysis methods
[0038] PCR amplification system (20 μL): 10 μL 2×PhantaMax Buffer, 0.4 μL dNTP Mix, 0.4 μL PhantaMax Super-Fidelity DNA Polymerase, 0.8 μL forward primer, 0.8 μL reverse primer, 1 μL DNA template, 6.6 μL ddH2O. The reaction program was: 95℃ pre-denaturation for 5 min; then 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; final extension at 72℃ for 10 min. After amplification, the PCR product was stored at 4℃ for later use.
[0039] Gel electrophoresis analysis: PCR products were analyzed using a DYY-6C gel electrophoresis apparatus. The voltage was set to 80V, the current to 400 mA, and the electrophoresis time to 45 min. Electrophoresis images were saved.
[0040] 2. Experimental Results
[0041] DNA was extracted from the leaves of the above-mentioned original plant of *Citrus aurantium*, and amplified using molecular marker primers YCC-F / R and SC-F / R, respectively. The resulting PCR products were then subjected to agarose gel electrophoresis. Using YCC-F / R as primers, a single product of approximately 1000 bp was produced by amplifying the DNA of *Citrus aurantium*. Figure 1 A), while DNA amplification of lime and sweet orange showed a double-band characteristic at approximately 1000 bp and 1200 bp, respectively. Figure 1 Therefore, the germplasm identification of Yichang orange can be achieved using YCC-F / R primers. Using SC-F / R primers, the amplification of sour orange DNA produces a single band of about 1300 bp, while sweet orange DNA shows double band amplification characteristics at about 1200 bp and 1300 bp (Figure 2). Therefore, the germplasm of sour orange and sweet orange can be distinguished using YCC-F / R primers.
[0042] The above experimental results show that the YCC-F / R primers can specifically identify Yichang orange germplasm from the original plants of Citrus aurantium, such as Yichang orange, sour orange and sweet orange, while the SC-F / R primers can further distinguish between sour orange and sweet orange. This combination of molecular markers provides an effective technical means for the accurate identification of the original plants of Citrus aurantium.
Claims
1. A method for identifying the original plant of Citrus aurantium, characterized in that, Includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR amplification was performed using a specific primer pair combination, wherein the primer pair combination includes: primer pair YCC-F / R, whose nucleotide sequences are shown in SEQ ID NO:1 and SEQ ID NO:2; primer pair SC-F / R, whose nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:4; (3) Perform gel electrophoresis on the PCR products and distinguish between Yichang orange, sour orange and sweet orange (Rutaceae plants) based on specific bands. Using YCC-F / R as primers, if a single band of 1000bp is produced by gel electrophoresis, it is identified as Yichang orange; if a double band of 1000bp and 1200bp is produced, it is identified as sour orange or sweet orange, thus achieving the germplasm differentiation between Yichang orange and sour orange or sweet orange. Using SC-F / R as primers, if a single band of 1300bp is produced by gel electrophoresis, it is identified as sour orange; if a double band of 1200bp and 1300bp is produced, it is identified as sweet orange, thus achieving the germplasm differentiation between sour orange and sweet orange.
2. The method for identifying the original plant of Citrus aurantium as described in claim 1, characterized in that, The PCR amplification reaction system consisted of: 10 μL 2×Phanta Max Buffer, 0.4 μL dNTP Mix, 0.4 μL Phanta Max Super-Fidelity DNA Polymerase, 0.8 μL forward primer, 0.8 μL reverse primer, 1 μL DNA template, and 6.6 μL ddH2O.
3. The method for identifying the original plant of Citrus aurantium as described in claim 1, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 56℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 10 min.