SNP marker primer set for identifying authenticity of jackfruit gh sj1405 and gh sjf146 hybrids and application thereof

Abstract

The present application relates to the technical field of molecular breeding, and discloses SNP marker primer groups for identifying the authenticity of jackfruit GHsj1405 and GHsjf146 hybrids and application. The primer groups are used for amplifying the following SNP sites: SNP05 is located at the 5th chromosome and the 3192996th position, and the genotype is A / G; SNP16 is located at the 16th chromosome and the 5352048th position, and the genotype is G / C; SNP24 is located at the 24th chromosome and the 6177443th position, and the genotype is A / G; SNP25 is located at the 25th chromosome and the 1839615th position, and the genotype is A / T; and SNP28 is located at the 28th chromosome and the 19248872th position, and the genotype is T / C. The present application can quickly and effectively identify the authenticity of jackfruit GHsj1405 and GHsjf146 hybrids by using the SNP marker primer groups, and is beneficial to the genetic breeding of jackfruit.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular breeding, and in particular to a SNP marker primer set for identifying the authenticity of a jackfruit GHsj1405 and GHsjf146 hybrid and application thereof. BACKGROUND

[0002] Jackfruit, also known as tree jackfruit or jackfruit, is an important tropical rare fruit tree in China, widely distributed and cultivated in Guangdong, Guangxi, Yunnan, Hainan and other places. Traditional jackfruit breeding techniques are mostly natural population seedling selection, which has problems such as long breeding cycle, time-consuming and labor-intensive, and uncontrollable variation direction. Hybrid breeding technology can realize directional breeding because the variation direction of offspring is controllable, and has gradually been valued and applied in jackfruit breeding.

[0003] Although some insects can assist in jackfruit pollination, it is currently generally believed that jackfruit is a wind-pollinated plant, and self-pollination and cross-pollination can coexist under natural conditions. To achieve artificial and purposeful hybridization, selfing can be prevented by bagging; however, due to the long female flower flowering period of jackfruit and the characteristics of wind-pollination, a certain proportion of selfing or false hybrids of other pollination sources will exist in the offspring of artificial hybridization. Therefore, the identification of hybrid authenticity is of great significance for genetic research on agronomic traits, evolution analysis of germplasm resources, breeding of hybrid new varieties, and establishment of DNA fingerprinting of hybrid varieties, etc. SUMMARY

[0004] The purpose of the present application is to provide a SNP marker primer set for identifying the authenticity of a jackfruit GHsj1405 and GHsjf146 hybrid and application thereof, which can quickly and effectively identify the authenticity of a jackfruit GHsj1405 and GHsjf146 hybrid, and is beneficial to the genetic breeding of jackfruit.

[0005] To achieve the above-mentioned purpose, the present application provides a SNP marker primer set for identifying the authenticity of a jackfruit GHsj1405 and GHsjf146 hybrid, which is used for amplifying the following SNP sites based on the jackfruit reference genome GCA_025403435.1:

[0006] SNP05 is located at position 3192996 on chromosome 5, and the genotype is A / G;

[0007] SNP16 is located at position 5352048 on chromosome 16, and the genotype is G / C;

[0008] SNP24 is located at position 6177443 on chromosome 24, and the genotype is A / G;

[0009] SNP25 is located at position 1839615 on chromosome 25, and the genotype is A / T;

[0010] SNP28 is located at position 19248872 on chromosome 28, and the genotype is T / C.

[0011] Further, the SNP marker primer set is as follows:

[0012] SNP05:

[0013] F1: GAAGGTGACCAAGTTCATGCTataacacacaacgcccctcT;

[0014] F2: GAAGGTCGGAGTCAACGGATTataacacacaacgcccctcC;

[0015] R: acggaggaagaccaagaggg;

[0016] SNP16:

[0017] F1: GAAGGTGACCAAGTTCATGCTacagccaacctaaaagcacacaG;

[0018] F2: GAAGGTCGGAGTCAACGGATTacagccaacctaaaagcacacaC;

[0019] R: gttgggcgaatgtgtgctcg;

[0020] SNP24:

[0021] F1: GAAGGTGACCAAGTTCATGCTtggaggtggtgctgagttgT;

[0022] F2: GAAGGTCGGAGTCAACGGATTtggaggtggtgctgagttgC;

[0023] R: cacaacatcgccggtgacac;

[0024] SNP25:

[0025] F1: GAAGGTGACCAAGTTCATGCTagacttctggacatgttgtgtttatT;

[0026] F2: GAAGGTCGGAGTCAACGGATTagacttctggacatgttgtgtttatA;

[0027] R: acaagtatcccagaccaagca;

[0028] SNP28:

[0029] F1: GAAGGTGACCAAGTTCATGCT agagaatttttgccactgctgaac A;

[0030] F2: GAAGGTCGGAGTCAACGGAT tagaagaatttttgccactgctgaac G;

[0031] R: ccctaaaccaactcggaatgca.

[0032] Further, the application further provides the application of the SNP marker primer group in identifying the authenticity of the jackfruit GHsj1405 and GHsjf146 hybrid.

[0033] Further, the application further provides a kit for identifying the authenticity of the jackfruit GHsj1405 and GHsjf146 hybrid, and the kit comprises the SNP marker primer group.

[0034] Further, the application further provides the application of the kit in identifying the authenticity of the jackfruit GHsj1405 and GHsjf146 hybrid.

[0035] Further, the application further provides a method for identifying the authenticity of the jackfruit GHsj1405 and GHsjf146 hybrid, and the steps are as follows:

[0036] 1) Extracting the total genomic DNA of the sample to be tested;

[0037] 2) Using the SNP marker primer group to perform PCR amplification;

[0038] 3) Sequencing the amplification product to determine the genotype.

[0039] Further, when the genotype of the sample to be tested is A / A or G / G, the SNP05 is used to determine that the sample to be tested is a false hybrid; when the genotype of the sample to be tested is A / G, the sample to be tested is a true hybrid;

[0040] When the genotype of the sample to be tested is G / G or C / C, the SNP16 is used to determine that the sample to be tested is a false hybrid; when the genotype of the sample to be tested is G / C, the sample to be tested is a true hybrid;

[0041] When the genotype of the sample to be tested is A / A or G / G, the SNP24 is used to determine that the sample to be tested is a false hybrid; when the genotype of the sample to be tested is A / G, the sample to be tested is a true hybrid;

[0042] Using SNP25, when the genotype of the sample to be tested is A / A or T / T, it is a false hybrid; when the genotype of the sample to be tested is A / T, it is a true hybrid;

[0043] Using SNP28, when the genotype of the sample to be tested is T / T or C / C, it is a false hybrid; when the genotype of the sample to be tested is T / C, it is a true hybrid.

[0044] That is, when the genotype of the sample to be tested is a homozygous genotype, it is a false hybrid; when the genotype of the sample to be tested is a heterozygous genotype, it is a true hybrid.

[0045] The SNP marker primer group for identifying the authenticity of the jackfruit GHsj1405 and GHsjf146 hybrid and the application have the advantages and positive effects that:

[0046] 1. The present application develops a group of SNP molecular markers that can be used to identify the authenticity of the "GHsj1405" and "GHsjf146" hybrid based on the SNP between the parents through the analysis of the SNP variation sites of the whole genome of the jackfruit parent, which can be used to identify the authenticity of the hybrid of the "GHsj1405" and "GHsjf146" hybrid offspring and establish the DNA fingerprint of the hybrid offspring, and can greatly improve the efficiency of jackfruit hybrid breeding.

[0047] 2. The SNP marker primer group disclosed by the present application can quickly and effectively identify the authenticity of the jackfruit GHsj1405 and GHsjf146 hybrid, which is beneficial to the genetic breeding of jackfruit.

[0048] The technical solutions of the present application will be further described in detail below with the aid of the accompanying drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0049] Figure 1 The figure is the genotyping result of the 5 groups of primers in the embodiment of the present application; wherein A is SNP16, B is SNP05, C is SNP24, D is SNP25, and E is SNP28; the box is the female parent, the triangle is the hybrid, and the circle is the male parent.

[0050] Figure 2 The figure is the genotyping result of the SNP16 on the hybrid offspring of the three pollination methods in the embodiment of the present application, wherein A is natural pollination, B is open + artificial pollination, and C is bagging + artificial pollination; the box is the female parent, the triangle is the hybrid, and the circle is the male parent. DETAILED DESCRIPTION

[0051] The technical solutions of the present application will be further described in detail below with the aid of the accompanying drawings and examples.

[0052] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0053] Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental instruments, equipment, and reagents in the following embodiments that do not specify their sources are all commercially available materials.

[0054] Unless otherwise defined or stated, all technical and scientific terms used in this invention have the same meaning as those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the methods of this invention. It should be noted that, unless otherwise specified, the embodiments and features described in this invention can be combined with each other.

[0055] In this invention, germplasm GHsj1405 was used as the female parent and GHsjf146 as the male parent to construct an F1 hybrid population. The male and female parents, as well as part of the F1 hybrid population, were planted at the Guangdong Ocean University Gardening Base. GHsj1405 was collected from Xuwen, Zhanjiang, Guangdong in 2010, and GHsjf146 was collected from Donghai Island, Zhanjiang, Guangdong in 2014. Both germplasms were preserved at the Guangdong Ocean University Gardening Base as grafted seedlings.

[0056] The hybrids in this invention are F1 hybrids of GHsj1405 and GHsjf146, with the reference genome being GCA_025403435.1.

[0057] Example 1: Obtaining Molecular Markers

[0058] To develop molecular markers that can be used to identify the authenticity of hybrid offspring, this invention first performed genome sequencing on two jackfruit parents, selected homozygous SNP sites that differed between the parents from the whole genome SNP variation sites of the jackfruit parents, and designed a set of SNP molecular marker detection primers on each chromosome using Primer 3. Each set of primers includes 3 primers, named A, B and C respectively. The primer combinations are shown in Table 1.

[0059] Table 1 Primer Combinations

[0060] ;

[0061] ;

[0062] ;

[0063] Example 2 Screening of molecular markers

[0064] Five parent plants and five F1 plants were selected to screen 28 groups of primers in Table 1.

[0065] The enzyme system was: DNA template (10 ng / µL) 2 µL, 2×PARMS MasterMix 5 µL, primer A (10 µmol / µL) 0.3 µL, primer B (10 µmol / µL) 0.3 µL, primer C (10 µmol / µL) 0.6 µL, deionized water 1.8 µL.

[0066] The reaction program was detected by BioRAD CFX connected fluorescence quantitative instrument: 94℃, 15 min; 94℃, 20 s, 65℃, 1 min, 10 cycles, and the temperature decreased by 0.8℃ per cycle; 94℃, 20 s, 57℃, 1 min, 32 cycles; 30℃, 1 min, and the fluorescence data was read.

[0067] Finally, 5 pairs of primers with stable results and good discrimination were selected for subsequent hybrid authenticity identification, which were SNP05, SNP16, SNP24, SNP25 and SNP28.

[0068] Example 3 Application of molecular markers

[0069] (1) The SNP05, SNP16, SNP24, SNP25 and SNP28 groups of SNP molecular markers were applied to identify the authenticity of the existing jackfruit hybrid offspring, and the same identification results were obtained by the 5 groups of SNP molecular markers. The results are shown in Figure 1 The upper left corner (box) in the figure is the female parent, the middle (triangle) is the hybrid, and the lower right corner (circle) is the male parent.

[0070] (2) The SNP16 was applied to identify the hybrid of jackfruit offspring under three pollination methods of natural pollination, bagging + artificial pollination and open + artificial pollination. The identification results are shown in Table 2. Natural pollination is that the female parent is not treated for pollination; bagging + artificial pollination is that the female inflorescence is bagged before the present bud period, and the male inflorescence of the parent is used for artificial assisted pollination during the present bud period (2-4 mm of stigma exposure); open + artificial pollination is that the female inflorescence is not bagged, and the male inflorescence of the parent is used for artificial assisted pollination during the present bud period (2-4 mm of stigma exposure). After the marker fruit matures, seeds are collected, and after germination on the sand bed, leaf blades are collected for DNA extraction.

[0071] Table 2 Identification results of hybrid authenticity of jackfruit hybrid offspring under different pollination methods

[0072] ;

[0073] The genotyping results of the hybrid offspring of the three pollination methods by SNP16 are as followsFigure 2 In the figure, the upper left corner (box) is the female parent, the middle (triangle) is the hybrid, and the lower right corner (circle) is the male parent.

[0074] The results show that the natural pollination of jackfruit is mainly xenogamy; the bagging and artificial pollination before the present budding stage can greatly improve the artificial hybrid ratio, which is an important way to effectively create jackfruit hybrid varieties.

[0075] Therefore, the application of the above SNP marker primer group for identifying the authenticity of jackfruit GHsj1405 and GHsjf146 hybrids and the application can quickly and effectively identify the authenticity of jackfruit GHsj1405 and GHsjf146 hybrids, which is beneficial to the genetic breeding of jackfruit.

[0076] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit it, although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that: the technical solutions of the present application can still be modified or replaced by equivalents, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. Application of SNP marker primer set in identifying authenticity of jackfruit GHsj1405 and GHsjf146 hybrid F1 generation, characterized in that, The primer set is used for detecting the SNP site with genotype G / C at position 5352048 on chromosome 16 of the jackfruit reference genome GCA_025403435.1; When the genotype of the sample to be tested is G / G or C / C, it is a false hybrid; when the genotype of the sample to be tested is G / C, it is a true hybrid.

2. Use according to claim 1, characterized in that, The SNP marker primer set is as follows: F1: GAAGGTGACCAAGTTCATGCTacagccaacctaaaagcacacaG; F2: GAAGGTCGGAGTCAACGGATTacagccaacctaaaagcacacaC; R: gttgggcgaatgtgtgctcg.

3. Use of a kit comprising the SNP marker primer set as claimed in claim 1 or 2 for identifying the authenticity of Jackfruit GHsj1405 and GHsjf146 hybrid F1 generation, characterized in that, When the genotype of the sample to be tested is G / G or C / C, it is a false hybrid; when the genotype of the sample to be tested is G / C, it is a true hybrid.

4. A method for identifying the authenticity of Jackfruit GHsj1405 and GHsjf146 hybrid F1 generation, characterized in that, The steps are as follows: 1) Extract the total genomic DNA of the sample to be tested; 2) Perform PCR amplification using the SNP marker primer set described in claim 1 or 2; 3) Sequence the amplification product to determine the genotype; When the genotype of the sample to be tested is G / G or C / C, it is a false hybrid; when the genotype of the sample to be tested is G / C, it is a true hybrid.

Images