Functional balloon as well as preparation method and application thereof

Abstract

The invention relates to the technical field of balloons, and discloses a functional balloon and a preparation method and application thereof.The surface of the functional balloon is loaded with polyglutamic acid, the polyglutamic acid is connected with DNA hydrogel through an amido bond, and a nucleotide sequence is connected with the DNA hydrogel and thrombin. The balloon obtained by the invention can realize a hemostatic effect and reduce bleeding symptoms on the premise of avoiding blood vessel occlusion.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of balloon, in particular to a functional balloon and a preparation method and application thereof. BACKGROUND

[0002] Coronary artery rupture is a serious complication in interventional therapy, which requires rapid hemostasis to avoid pericardial tamponade. Pericardial tamponade refers to the accumulation of blood or fluid in the pericardial cavity, which compresses the heart and causes diastolic restriction, seriously affecting the pumping function of the heart. This condition can lead to hypotension, cardiac tamponade, and even cardiac arrest, which can rapidly lead to shock or death if not promptly intervened.

[0003] In the prior art, once a tubular artery perforation occurs, a compliant balloon is generally placed in the proximal end of the perforation site under the mortgage to limit extravasation, and a covered stent is also used for hemostasis. It is found that the existing hemostasis technology (such as a covered stent) has problems such as difficult positioning and permanent obstruction; and the traditional balloon mainly relies on physical plugging, which cannot meet the hemostasis demand, and bleeding symptoms may still occur when the balloon is removed. SUMMARY

[0004] In order to solve the above technical problems, the present application provides a functional balloon and a preparation method and application thereof. The balloon obtained by the present application can achieve hemostasis effect and reduce bleeding symptoms under the premise of avoiding blood vessel occlusion.

[0005] The present application provides a functional balloon, wherein the surface of the functional balloon is loaded with polyglutamic acid, the polyglutamic acid is connected to a DNA hydrogel through an amide bond, and a nucleotide sequence is connected to the DNA hydrogel and thrombin.

[0006] Further, the carboxyl group of the polyglutamic acid forms an amide bond with the amino group of the DNA hydrogel.

[0007] Further, the nucleotide sequence is shown in SEQ ID NO. 1.

[0008] Further, the preparation method of the DNA hydrogel comprises: Step S11: obtaining repeated long chains RCA-products-1 complementary to DNA template 1; Step S12: obtaining repeated long chains RCA-products-2 complementary to DNA template 2; Step S13: mixing RCA-products-1 and RCA-products-2 in a mass ratio of 1:1, and oscillating to obtain a DNA hydrogel.

[0009] In the present application, by controlling the mass concentration of the solution containing RCA-products-1 and the solution containing RCA-products-2 and adding the volume, as long as it is ensured that after mixing, RCA-products-1 and RCA-products-2 are in a mass ratio of 1:1.

[0010] Further, the time of the oscillation is 25min-35min.

[0011] Further, the preparation method of the DNA template 1 comprises: obtaining the DNA template 1 by PCR method through the DNA linear template 1 and the DNA primer 1.

[0012] Further, the preparation method of the DNA template 2 comprises: obtaining the DNA template 2 by PCR method through the DNA linear template 2 and the DNA primer 2.

[0013] Further, the sequence of the DNA linear template 1 is shown as SEQ ID NO. 2.

[0014] Further, the sequence of the DNA primer 1 is shown as SEQ ID NO. 3.

[0015] Further, the sequence of the DNA linear template 2 is shown as SEQ ID NO. 4.

[0016] Further, the sequence of the DNA primer 2 is shown as SEQ ID NO. 5.

[0017] Further, the pore size of the DNA hydrogel is 50μm-200μm.

[0018] The present application also provides a preparation method of the functional balloon, which comprises: Step S1: preparing a DNA hydrogel; Step S2: connecting the DNA hydrogel obtained in step S1 with the balloon loaded with polyglutamic acid to obtain an intermediate product; Step S3: connecting the DNA hydrogel and thrombin in the intermediate product through nucleotide sequence to obtain a functional balloon.

[0019] Further, the specific method for obtaining the repeated long-chain RCA-products-1 complementary to the DNA template 1 comprises: The solution containing the DNA template 1, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin (BSA), a solution containing deoxyribonucleotide triphosphates (dNTPs), a sodium chloride solution and sterile water are mixed and oscillated to obtain the repeated long-chain RCA-products-1 complementary to the DNA template 1.

[0020] Further, the preparation method of the solution containing the DNA template 1 comprises: dispersing the DNA template 1 in sterile water.

[0021] Further, the molar concentration of the solution containing the DNA template 1 is 30 nmol / L-100 nmol / L.

[0022] Further, the concentration of the phi29 DNA polymerase is 0.1 U / L-0.3 U / L.

[0023] Further, the concentration of the phi29 DNA polymerase reaction buffer is ×10.

[0024] Further, the concentration of the bovine serum albumin is 200×200.

[0025] Further, the preparation method of the solution containing deoxyribonucleotide triphosphate comprises: dispersing deoxyribonucleotide triphosphate in sterile water.

[0026] Further, the molar concentration of the solution containing deoxyribonucleotide triphosphate is 0.5 mmol / L-1 mmol / L.

[0027] Further, the preparation method of the sodium chloride solution comprises: dispersing sodium chloride in sterile water.

[0028] Further, the molar concentration of the sodium chloride solution is 40 mmol / L-80 mmol / L.

[0029] Further, the ratio of the solution containing the DNA template 1, the phi29 DNA polymerase, the phi29 DNA polymerase reaction buffer, the bovine serum albumin, the solution containing deoxyribonucleotide triphosphate, and the sodium chloride solution is 20:3:10:1:10:10 by volume.

[0030] Further, the sterile water is added to a final volume of 500 μL.

[0031] Further, in the preparation method of the RCA-products-1, the oscillation condition is 200 rpm-450 rpm for 5 h-20 h.

[0032] Further, the specific method for obtaining the repeated long-chain RCA-products-2 complementary to the DNA template 2 comprises: Mixing the solution containing DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, the solution containing deoxyribonucleotide triphosphate, sodium chloride solution and sterile water, shaking, obtaining the repeated long chain RCA-products-2 complementary to DNA template 2.

[0033] Further, the preparation method of the solution containing DNA template 2: dispersing DNA template 2 in sterile water.

[0034] Further, the concentration of the solution containing DNA template 2 is 30 nmol / L-100 nmol / L.

[0035] Further, the ratio of the solution containing DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, the solution containing deoxyribonucleotide triphosphate, sodium chloride solution is 20:3:10:1:10:10 by volume.

[0036] Those skilled in the art should understand that the method of obtaining the repeated long chain complementary to the DNA template is a conventional method, and the specific method in the process of obtaining the repeated long chain RCA-products-2 is the same as that of obtaining the repeated long chain RCA-products-1, the only difference is that the added template is different.

[0037] Further, the preparation method of the DNA template 1 includes: mixing the solution containing DNA linear template 1 with a concentration of 10 μmol / L and the solution containing DNA primer 1 with a concentration of 10 μmol / L at a volume ratio of 1:1, heating at 95℃ for 2 minutes, cooling to 20℃ at a rate of-0.5℃ / 30s after the reaction is completed, then adding 1-6U T4 DNA ligase and reacting at 25℃ for 12 hours.

[0038] Further, the preparation method of the solution containing DNA linear template 1 includes: dispersing DNA linear template 1 in sterile water.

[0039] Further, the preparation method of the solution containing DNA primer 1 includes: dispersing DNA primer 1 in sterile water.

[0040] Further, the preparation method of the DNA template 2 includes: mixing the solution containing DNA linear template 2 and the solution containing DNA primer 2 at a volume ratio of 1:1, heating at 95℃ for 2 minutes, cooling to 20℃ at a rate of-0.5℃ / 30s after the reaction is completed, then adding 1-6U T4 DNA ligase and reacting at 25℃ for 12 hours.

[0041] Further, the step S2, the specific method of connecting the DNA hydrogel obtained in step S1 with the balloon loaded with polyglutamic acid includes: The carboxyl group of the polyglutamic acid is activated by adding carbodiimide and N-hydroxysuccinimide in the PBS buffer solution containing the polyglutamic acid, and after the activation is completed, the DNA hydrogel is added for reaction, the balloon is soaked in the solution after the reaction, and dried at room temperature to realize the connection between the DNA hydrogel and the polyglutamic acid in the intermediate product.

[0042] Further, in the PBS buffer solution containing the polyglutamic acid, the mass concentration of the polyglutamic acid is 10%.

[0043] Further, the ratio of the polyglutamic acid, the carbodiimide, the N-hydroxysuccinimide and the DNA hydrogel is 100:5:2:100 by mass.

[0044] Further, the activation time is 25 min-35 min.

[0045] Those skilled in the art should understand that in order to realize the full activation of the carboxyl group of the polyglutamic acid, stirring can be performed during the activation, and the stirring speed can be adjusted by those skilled in the art according to the actual situation.

[0046] Further, the reaction time is 25 min-35 min, and the pH value of the reaction is 4.7-6.

[0047] Those skilled in the art should understand that in order to realize the full reaction, stirring can be performed during the reaction, and the stirring speed can be adjusted by those skilled in the art according to the actual situation.

[0048] Further, the soaking time is 50 s-70 s.

[0049] Further, in the step S3, the specific method of connecting the DNA hydrogel in the intermediate product and the thrombin by nucleotide sequence includes: The solution containing the nucleotide sequence is added to the intermediate product for primary room temperature reaction, and the thrombin is added for secondary room temperature reaction to obtain the functional balloon.

[0050] Further, the preparation method of the solution containing the nucleotide sequence includes dispersing the nucleotide sequence in sterile water.

[0051] Further, the primary room temperature reaction time is 25 min-35 min.

[0052] Those skilled in the art should understand that during the primary room temperature reaction, the shaking method can be used to promote the full reaction.

[0053] Further, the ratio of the intermediate product to the nucleotide sequence is 500:1 by mass.

[0054] Further, the time of the secondary room temperature reaction is 35min-45min.

[0055] It should be understood by those skilled in the art that, during the secondary room temperature reaction, the reaction can be promoted by oscillation.

[0056] Further, the ratio of the intermediate product to the thrombin is 200:1 by mass.

[0057] The application also provides the use of the functional balloon in coronary artery rupture hemostasis.

[0058] The embodiment of the application has the following technical effects: 1. Firstly, the functional balloon in the application can realize the functions of physical plugging and hemostasis, the balloon can realize physical plugging, and the thrombin on the balloon can act on the bleeding point to achieve the function of hemostasis. In order to achieve the precise action of the thrombin on the bleeding point, the thrombin is connected to the DNA hydrogel through a DNA sequence in the application, and when the balloon reaches the bleeding point, the DNA sequence is broken to release the thrombin to act on the bleeding point. On this basis, when the balloon is full of pressure, the adhesion effect of the DNA hydrogel and the bleeding point can be improved, thereby further reducing bleeding, and the effect of physical hemostasis can be achieved after the balloon is removed. The DNA hydrogel has biocompatibility and can be absorbed in the later stage, so the blocked blood vessel can eventually achieve patency.

[0059] 2. In the application, in order to achieve the precise release of the thrombin, in view of the action environment of the balloon in the application, there is local inflammation MMP-2 at the bleeding point, the DNA sequence in the application is broken under the induction of MMP-2, thereby avoiding the premature release of the thrombin.

[0060] 3. In the application, the polyglutamic acid is loaded on the surface of the balloon, and the polyglutamic acid and the DNA hydrogel are coupled by amide bond chemical covalent coupling, thereby further avoiding the falling of the DNA hydrogel. BRIEF DESCRIPTION OF DRAWINGS

[0061] In order to more clearly illustrate the specific embodiments of the application or the technical solutions in the prior art, the drawings needed in the following specific embodiments or prior art description will be briefly introduced. Obviously, the drawings in the following description are some embodiments of the application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0062] Figure 1 is the electron microscope image of the DNA hydrogel provided by the embodiment 1 of the application. Figure 2 is a color ultrasound of the functional balloon prepared in Embodiment 1 of the present application placed in a blood vessel Figure 1 ; Figure 3 is a color ultrasound of the functional balloon prepared in Embodiment 1 of the present application placed in a blood vessel Figure 2 ; Figure 4 is a color ultrasound of a blood vessel Figure 1 ; Figure 2 is a color ultrasound of a blood vessel Figure 1 . DETAILED DESCRIPTION

[0063] In order to make the objectives, technical solutions and advantages of the present application clearer, the technical solutions of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application.

[0064] In the first aspect, some embodiments of the present application provide a functional balloon, wherein the functional balloon is loaded with polyglutamic acid on the surface, and the polyglutamic acid is connected to a DNA hydrogel through an amide bond, and a nucleotide sequence is connected to the DNA hydrogel and thrombin.

[0065] In some embodiments, the carboxyl group of the polyglutamic acid forms an amide bond with the amino group of the DNA hydrogel.

[0066] In some embodiments, the nucleotide sequence is shown in SEQ ID NO. 1.

[0067] In some embodiments, SEQ ID NO. 1 is: CCCAATCCCAATCCCAATCCCTAACGATCGATCGATGGTTGGTGTGGTTGG.

[0068] In some embodiments, the preparation method of the DNA hydrogel comprises: Step S11: obtaining repeated long chains RCA-products-1 complementary to DNA template 1; Step S12: obtaining repeated long chains RCA-products-2 complementary to DNA template 2; Step S13: mixing RCA-products-1 and RCA-products-2 in a mass ratio of 1:1, and oscillating to obtain the DNA hydrogel.

[0069] In the present application, by controlling the mass concentration of the solution containing RCA-products-1 and the solution containing RCA-products-2 and adding the volume, as long as it is ensured that after mixing, RCA-products-1 and RCA-products-2 are in a mass ratio of 1:1.

[0070] In some embodiments, the time of the oscillation is 25-35 min.

[0071] In some embodiments, the method for preparing the DNA template 1 comprises: obtaining the DNA template 1 by PCR method with the DNA linear template 1 and the DNA primer 1.

[0072] In some embodiments, the method for preparing the DNA template 2 comprises: obtaining the DNA template 2 by PCR method with the DNA linear template 2 and the DNA primer 2.

[0073] In some embodiments, the sequence of the DNA linear template 1 is shown in SEQ ID NO. 2.

[0074] SEQ ID NO. 2 is: TTTTCCCAATCCCAATCCCAATCCCTAACGATCTTTTGTAGGAACATCAAACGACAGCCAG.

[0075] In some embodiments, the sequence of the DNA primer 1 is shown in SEQ ID NO. 3.

[0076] SEQ ID NO. 3 is: H2N-TAACCCAAAACTGGCTGTCGTT -3'.

[0077] In some embodiments, the sequence of the DNA linear template 2 is shown in SEQ ID NO. 4.

[0078] SEQ ID NO. 4 is: CTGGCTGTCGTTTGATGTTCCTACATCGTTTT. In some embodiments, the sequence of the DNA primer 2 is shown in SEQ ID NO. 5.

[0079] SEQ ID NO. 5 is: H2N-GACAGCCAGAAAACGAT-3'.

[0080] In some embodiments, the pore size of the DNA hydrogel is 50-200 μm.

[0081] In the present application, by controlling the pore size of the DNA hydrogel, the degradation rate of the DNA hydrogel can be controlled.

[0082] In some embodiments of the second aspect, the method for preparing the functional balloon further comprises: Step S1: preparing a DNA hydrogel; Step S2: connecting the DNA hydrogel obtained in step S1 with a balloon loaded with polyglutamic acid to obtain an intermediate product; Step S3: connecting the DNA hydrogel and thrombin by nucleotide sequence to obtain a functional balloon.

[0083] In some embodiments, the method for preparing the DNA hydrogel comprises: Step S11: obtaining repeated long chains RCA-products-1 complementary to DNA template 1; Step S12: obtaining repeated long chains RCA-products-2 complementary to DNA template 2; Step S13: mixing RCA-products-1 and RCA-products-2 in a mass ratio of 1:1, and shaking to obtain a DNA hydrogel.

[0084] In some embodiments, the shaking time is 25-35 min.

[0085] In some embodiments, the method for preparing the DNA template 1 comprises: obtaining the DNA template 1 by PCR method using DNA linear template 1 and DNA primer 1.

[0086] In some embodiments, the method for preparing the DNA template 2 comprises: obtaining the DNA template 2 by PCR method using DNA linear template 2 and DNA primer 2.

[0087] In some embodiments, the sequence of the DNA linear template 1 is shown in SEQ ID NO. 2.

[0088] In some embodiments, the sequence of the DNA primer 1 is shown in SEQ ID NO. 3.

[0089] In some embodiments, the sequence of the DNA linear template 2 is shown in SEQ ID NO. 4.

[0090] In some embodiments, the sequence of the DNA primer 2 is shown in SEQ ID NO. 5.

[0091] In some embodiments, the specific method for obtaining repeated long chains RCA-products-1 complementary to DNA template 1 comprises: The solution containing DNA template 1, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleotide triphosphate, sodium chloride solution and sterile water are mixed and shaken to obtain RCA-products-1 complementary to DNA template 1.

[0092] In some embodiments, the solution containing DNA template 1 is prepared by dispersing DNA template 1 in sterile water.

[0093] In some embodiments, the solution containing DNA template 1 has a molar concentration of 30 nmol / L-100 nmol / L.

[0094] In some embodiments, the phi29 DNA polymerase has a concentration of 0.1 U / L-0.3 U / L.

[0095] In some embodiments, the phi29 DNA polymerase reaction buffer has a concentration of ×10.

[0096] In some embodiments, the bovine serum albumin has a concentration of 200 × 200.

[0097] In some embodiments, the solution containing deoxyribonucleotide triphosphate is prepared by dispersing deoxyribonucleotide triphosphate in sterile water.

[0098] In some embodiments, the solution containing deoxyribonucleotide triphosphate has a molar concentration of 0.5 mmol / L-1 mmol / L.

[0099] In some embodiments, the sodium chloride solution is prepared by dispersing sodium chloride in sterile water.

[0100] In some embodiments, the sodium chloride solution has a molar concentration of 40 mmol / L-80 mmol / L.

[0101] In some embodiments, the solution containing DNA template 1, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleotide triphosphate, sodium chloride solution have a ratio of 20:3:10:1:10:10 by volume.

[0102] In some embodiments, the sterile water is added to a final volume of 500 μL.

[0103] In some embodiments, in the method of preparing RCA-products-1, the shaking is performed at a speed of 200 rpm-450 rpm for 5 h-20 h.

[0104] In some embodiments, the method for obtaining the repeated long chain RCA-products-2 complementary to the DNA template 2 comprises: Mixing the solution containing the DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, the solution containing deoxyribonucleotide triphosphate, sodium chloride solution and sterile water, and shaking to obtain the repeated long chain RCA-products-2 complementary to the DNA template 2.

[0105] In some embodiments, the method for preparing the solution containing the DNA template 2 comprises dispersing the circular DNA template 2 in sterile water.

[0106] In some embodiments, the concentration of the solution containing the DNA template 2 is 30 nmol / L-100 nmol / L.

[0107] In some embodiments, the ratio of the solution containing the DNA template 2, phi29 DNA polymerase, phi29 DNA polymerase reaction buffer, bovine serum albumin, the solution containing deoxyribonucleotide triphosphate, and sodium chloride solution is 20:3:10:1:10:10 by volume.

[0108] In some embodiments, the method for preparing the DNA template 1 comprises mixing the solution containing the DNA linear template 1 at a concentration of 10 μmol / L and the solution containing the DNA primer 1 at a concentration of 10 μmol / L at a volume ratio of 1:1, heating to 95℃ for 2 minutes, cooling to 20℃ at a rate of -0.5℃ / 30s after the reaction is completed, and then adding 1-6 U of T4 DNA ligase and reacting at 25℃ for 12 hours.

[0109] In some embodiments, the method for preparing the solution containing the DNA linear template 1 comprises dispersing the DNA linear template 1 in sterile water.

[0110] In some embodiments, the method for preparing the solution containing the DNA primer 1 comprises dispersing the DNA primer 1 in sterile water.

[0111] In some embodiments, the method for preparing the DNA template 2 comprises mixing the solution containing the DNA linear template 2 and the solution containing the DNA primer 2 at a volume ratio of 1:1, heating to 95℃ for 2 minutes, cooling to 20℃ at a rate of -0.5℃ / 30s after the reaction is completed, and then adding 1-6 U of T4 DNA ligase and reacting at 25℃ for 12 hours.

[0112] In some embodiments, the method for connecting the DNA hydrogel obtained in step S1 to the balloon loaded with polyglutamic acid in step S2 comprises the following steps: The carboxyl group of the polyglutamic acid is activated by adding carbodiimide and N-hydroxysuccinimide into the PBS buffer solution containing the polyglutamic acid. After the activation is completed, the DNA hydrogel is added for reaction. The balloon is soaked in the solution after the reaction and dried at room temperature to realize the connection between the DNA hydrogel and the polyglutamic acid in the intermediate product.

[0113] In some embodiments, the mass concentration of the polyglutamic acid in the PBS buffer solution containing the polyglutamic acid is 10%.

[0114] In some embodiments, the mass ratio of the polyglutamic acid, the carbodiimide, the N-hydroxysuccinimide and the DNA hydrogel is 100:5:2:100.

[0115] In some embodiments, the activation time is 25 min to 35 min.

[0116] In some embodiments, the reaction time is 25 min to 35 min and the pH value of the reaction is 4.7 to 6.

[0117] In some embodiments, the soaking time is 50 s to 70 s.

[0118] In some embodiments, the method for connecting the DNA hydrogel and the thrombin in step S3 comprises the following steps: The solution containing the nucleotide sequence is added to the intermediate product for primary room temperature reaction. The thrombin is added for secondary room temperature reaction to obtain the functional balloon.

[0119] In some embodiments, the thrombin is hemocoagulase agkistrodon (HCA). The hemocoagulase agkistrodon is a kind of thrombin, which is obtained by isolation and purification from the venom of the agkistrodon acutus. It can dissolve the A titanium in the A subunit to produce soluble fibrin polymer, thereby playing a hemostatic role.

[0120] In some embodiments, the primary room temperature reaction time is 25 min to 35 min.

[0121] In some embodiments, the mass ratio of the intermediate product and the nucleotide sequence is 500:1.

[0122] In some embodiments, the secondary room temperature reaction time is 35 min to 45 min.

[0123] In some embodiments, the ratio of the intermediate product to thrombin by mass is 200:1.

[0124] In a third aspect, the application provides use of the functional balloon in hemostasis of coronary artery rupture.

[0125] The following is described in conjunction with specific examples and comparative examples: Example 1 (1) The DNA hydrogel synthesis method is as follows: A solution containing DNA template 1 with a final concentration of 65 nmol / L, 0.2 U / L phi 29 DNA polymerase, 10x phi 29 DNA polymerase reaction buffer, 200x BSA, 1 mmol / L dNTPs solution, 60 mmol / L NaCl solution and sterile water are mixed. The ratio of the solution containing DNA template 1, phi 29 DNA polymerase, phi 29 DNA polymerase reaction buffer, bovine serum albumin, solution containing deoxyribonucleoside triphosphate, and sodium chloride solution is 20:3:10:1:10:10 by volume. Shake at 300 rpm for 10 h to obtain repeated long-chain RCA-products-1 complementary to DNA template 1.

[0126] The same method is used to obtain repeated long-chain RCA-products-2 complementary to DNA template 2.

[0127] The preparation method of DNA template 1 is as follows: a solution containing DNA linear template 1 with a concentration of 10 μmol / L and a solution containing DNA primer 1 with a concentration of 10 μmol / L are mixed at a volume ratio of 1:1, heated to 95℃ for 2 minutes, and then cooled to 20℃ at a rate of -0.5℃ / 30s. Then 1-6 U T4 DNA ligase is added and reacted at 25℃ for 12 hours.

[0128] The same method is used to obtain DNA template 2.

[0129] The sequence of the DNA linear template 1 is shown in SEQ ID NO. 2.

[0130] SEQ ID NO. 2 is: TTTTCCCAATCCCAATCCCAATCCCTAACGATCTTTTGTAGGAACATCAAACGACAGCCAG.

[0131] The sequence of the DNA primer 1 is shown in SEQ ID NO. 3.

[0132] SEQ ID NO. 3 is: H2N-TAACCCAAAACTGGCTGTCGTT -3'.

[0133] The sequence of the DNA linear template 2 is shown in SEQ ID NO. 4.

[0134] SEQ ID NO. 4 is: CTGGCTGTCGTTTGATGTTCCTACATCGTTTT. The sequence of the DNA primer 2 is shown in SEQ ID NO. 5.

[0135] SEQ ID NO. 5 is: H2N-GACAGCCAGAAAACGAT-3'.

[0136] The RCA-products-1 and the RCA-products-2 are mixed in a mass ratio of 1:1, and shaken for 30 min to obtain the DNA hydrogel. By controlling the mass concentration of the solution containing the RCA-products-1 and the solution containing the RCA-products-2 and adding the volume, as long as the mass ratio of the RCA-products-1 to the RCA-products-2 is 1:1 after mixing.

[0137] The electron microscope image of the DNA hydrogel prepared in this example is shown in FIG. 1. Figure 2

[0138] (2) The carbodiimide and the N-hydroxysuccinimide are added to the PBS buffer solution containing the polyglutamic acid, and the carboxyl group of the polyglutamic acid is activated for 30 min. After the activation is completed, the DNA hydrogel is added, and the reaction is performed at room temperature for 30 min. The pH value of the reaction is 4.7-6. The balloon is soaked (60 s) in the solution after the reaction, and is dried at room temperature to realize the connection between the DNA hydrogel in the intermediate product and the polyglutamic acid.

[0139] The mass concentration of the polyglutamic acid in the PBS buffer solution containing the polyglutamic acid is 10%.

[0140] The ratio of the polyglutamic acid, the carbodiimide, the N-hydroxysuccinimide and the DNA hydrogel is 100:5:2:100 by mass.

[0141] (3) The solution containing the nucleotide sequence is added to the intermediate product, and the reaction is shaken at room temperature for 30 min. The hemocoagulase from Agkistrodon acutus is added, and the reaction is shaken at room temperature for 40 min. The functional balloon is obtained by air drying at room temperature.

[0142] The ratio of the intermediate product and the nucleotide sequence is 500:1 by mass; and the ratio of the intermediate product and the hemocoagulase is 200:1 by mass. ​

[0143] The nucleotide sequence is shown in SEQ ID NO. 1. SEQ ID NO. 1 is: CCCAATCCCAATCCCAATCCCTAACGATCGATCGATGGTTGGTGTGGTTGG.

[0144] Application Example After the functional balloon prepared in Example 1 is placed in the blood vessel of a rabbit, the intravascular color Doppler ultrasound image is as shown in Figure 3 For ease of observation, see Figure 4 , wherein the red part is the functional balloon prepared in Example 1; wherein the color Doppler ultrasound image of the blood vessel of the rabbit is as shown in Figure 5 For ease of clear display, see Figures 2-5 , wherein the blue line is the intima of the blood vessel, and the yellow line is the inner diameter of the blood vessel; in combination with ​ It can be seen that the coating of the functional balloon prepared in the application is mainly combined with the broken part.

[0145] The release rate of thrombin on the surface of the functional balloon prepared in the example is detected, and the detection method adopts a chromogenic substrate method. Specifically, a thrombin-specific chromogenic substrate Tos-Gly-Pro-Arg-pNA is used. Yellow product (pNA) is generated by using thrombin to catalyze the hydrolysis of the substrate. The concentration of active thrombin is quantitatively detected by absorbance (405 nm), and the release rate of thrombin is obtained.

[0146] Among them, the experimental group detects the release rate of thrombin of the functional balloon prepared in Example 1 under the MMP-2 inflammatory microenvironment, in order to detect its specific release; the control group detects the release rate of thrombin of the functional balloon prepared in Example 1 under physiological conditions (without MMP-2), in order to detect its non-specific release, wherein the treatment conditions of the experimental group and the control group are shown in Table 1: Table 1 The release rate of thrombin of the experimental group and the control group is shown in Table 2: Table 2 From the data in Table 2, it can be seen that the functional balloon prepared in Example 1 of the application has stable performance of thrombin under physiological conditions, and the release rate is low; under the MMP-2 inflammatory microenvironment, the release rate of thrombin is ≥80%, thereby proving that the thrombin on the functional balloon prepared in the application can act on the bleeding point and play a hemostatic function.

[0147] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the above embodiments, those skilled in the art should understand that the technical solutions recorded in the above embodiments can still be modified, or some or all of the technical features can be replaced by equivalents; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the technical solutions of the embodiments of the present application.

Claims

1. A functional balloon, characterized in that: The surface of the functional balloon is loaded with polyglutamic acid, the polyglutamic acid is connected to the DNA hydrogel via an amide bond, and the nucleotide sequence connects the DNA hydrogel and thrombin.

2. The functional balloon according to claim 1, characterized in that The carboxyl group of the polyglutamic acid forms an amide bond with the amino group of the DNA hydrogel; the pore size of the DNA hydrogel is 50 μm-200 μm; The nucleotide sequence is shown in SEQ ID NO.

1.

3. The functional balloon according to claim 1, characterized in that The preparation method of the DNA hydrogel comprises: Step S11: obtaining repetitive long-chain RCA-products-1 complementary to DNA template 1; Step S12: obtaining repetitive long-chain RCA-products-2 complementary to DNA template 2; Step S13: RCA-products-1 and RCA-products-2 were mixed at a mass ratio of 1:1 and shaken to obtain a DNA hydrogel; The preparation method of the DNA template 1 includes: obtaining the DNA template 1 by a PCR method using a DNA linear template 1 and a DNA primer 1; The preparation method of the DNA template 2 includes: obtaining the DNA template 2 by a PCR method using a DNA linear template 2 and a DNA primer 2; The sequence of the DNA linear template 1 is shown in SEQ ID NO. 2; The sequence of the DNA primer 1 is shown in SEQ ID NO.3; The sequence of the DNA linear template 2 is shown in SEQ ID NO.4; The sequence of the DNA primer 2 is shown in SEQ ID NO.

5.

4. The method for preparing the functional balloon according to any one of claims 1 to 3, characterized in that: The preparation method comprises: Step S1: preparing DNA hydrogel; Step S2: connecting the DNA hydrogel obtained in step S1 to a balloon loaded with polyglutamic acid to obtain an intermediate product; Step S3: connecting the DNA hydrogel and thrombin in the intermediate product through nucleotide sequences to obtain a functional balloon.

5. The preparation method according to claim 4, characterized in that In step S2, the specific method of connecting the DNA hydrogel obtained in step S1 to the balloon loaded with polyglutamic acid includes: Carbodiimide and N-hydroxysuccinimide are added to a PBS buffer solution containing polyglutamic acid to activate the carboxyl group of the polyglutamic acid. After the activation is completed, DNA hydrogel is added to react, and the balloon is immersed in the reacted solution and dried at room temperature to achieve the connection between the DNA hydrogel and the polyglutamic acid in the intermediate product.

6. The preparation method according to claim 5, characterized in that In the PBS buffer solution containing polyglutamic acid, the mass solubility of polyglutamic acid is 10%; The ratio of the polyglutamic acid, carbodiimide, N-hydroxysuccinimide and DNA hydrogel is 100:5:2:100 by mass.

7. The preparation method according to claim 5, characterized in that The activation time is 25 min-35 min; the reaction time is 25 min-35 min, and the pH value of the reaction is 4.7-6; The soaking time is 50s-70s.

8. The preparation method according to claim 4, characterized in that In step S3, the specific method of connecting the DNA hydrogel and thrombin in the intermediate product through the nucleotide sequence includes: A solution containing a nucleotide sequence is added to the intermediate product and reacted at room temperature once; thrombin is added and reacted at room temperature twice to obtain a functional balloon.

9. The preparation method according to claim 8, characterized in that The time of the room temperature reaction is 25min-35min; The ratio of the intermediate product to the nucleotide sequence is 500:1 by mass; The time of the secondary room temperature reaction is 35min-45min; The ratio of the intermediate product to thrombin is 200:1 by mass.

10. Use of the functional balloon according to any one of claims 1 to 3 or the functional balloon obtained by the preparation method according to any one of claims 4 to 9 in hemostasis of coronary artery rupture.

Images