Recombinant human-derived xviii collagen and use thereof
By constructing recombinant engineered bacteria through genetic engineering, optimizing the molecular conformation of XVIII collagen, and expressing it in Pichia pastoris, the problem of XVIII type collagen being difficult to penetrate the skin was solved, enabling its efficient application in cosmetics and multiple skin care effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- QUZHOU RES INST OF ZHEJIANG UNIV
- Filing Date
- 2025-06-30
- Publication Date
- 2026-07-24
AI Technical Summary
Existing technologies make it difficult to extract type XVIII collagen on a large scale, and its full-length protein has low transdermal efficiency and poses an immunogenicity risk, which limits its application in the cosmetics field.
Recombinant engineered bacteria were constructed using genetic engineering technology, the core functional domain of XVIII collagen was screened, the molecular conformation was optimized, and the bacteria were inserted into the Pichia pastoris expression vector to achieve efficient expression and transdermal penetration, remove immunogenic fragments, and directionally enhance biological activity.
It achieves highly efficient penetration of recombinant human XVIII collagen into the skin, promotes cell repair and anti-aging effects, reduces enterprise costs, and has multiple skin care benefits.
Smart Images

Figure CN120795123B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of cosmetic technology, specifically relating to a recombinant human XVIII collagen and its applications. Background Technology
[0002] Collagen, as a major structural protein of the skin matrix, plays a central role in maintaining skin mechanical strength, water retention, and cell signaling. Among them, type XVIII collagen, a crucial component of the basement membrane, has a full length of 1754 amino acids (with various splicing variants) and unique dual functional characteristics: its N-terminal non-collagenous domain (NC1) forms a triple helix structure through Gly-XY repeat sequences (X and Y are often proline or hydroxyproline), participating in the stability of the epidermal-dermal junction; its C-terminal endostatin domain exhibits significant cell adhesion regulation, promoting keratinocyte migration and epidermal regeneration. Clinical studies have shown that the expression level of type XVIII collagen in the skin basement membrane region significantly decreases with age (-43.5%, p<0.01), which is significantly correlated with aging characteristics such as weakened skin barrier function and loss of elasticity. In this invention, we screened for type XVIII collagen as the main research object.
[0003] XVIII type collagen is expressed in trace amounts (<0.1% of total collagen content) in human tissues. Naturally derived XVIII type collagen is difficult to extract using traditional tissue extraction methods due to complex processes, poor batch stability, high costs, and difficulties in large-scale extraction, as well as the risk of immunogenicity. Furthermore, XVIII type collagen contains multiple functional domains, with a full-length protein molecular weight as high as 150 kDa. Its rigid triple helix structure results in a transdermal permeability of less than 0.5%, making it difficult to penetrate the stratum corneum. Several domains within the full-length protein exhibit functional antagonism, particularly the N-terminal signal peptide, which may inhibit the biological activity of the endostatin domain. These factors have led to a lack of XVIII type collagen products on the market, limiting its research and application. Summary of the Invention
[0004] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.
[0005] In view of the problems existing in the above and / or prior art, the present invention is proposed.
[0006] One objective of this invention is to provide a recombinant human XVIII collagen protein. By constructing a recombinant engineered bacterial expression system through genetic engineering technology, the recombinant micro-molecule XVIII type collagen protein can be penetrated into the skin through topical application, exhibiting a stronger cell repair-promoting ability and applicable to the cosmetics field.
[0007] To solve the above-mentioned technical problems, the present invention provides the following technical solution: a recombinant human XVIII collagen, wherein the amino acid sequence of the recombinant human XVIII collagen is shown in SEQ ID NO.1 and the nucleotide sequence is shown in SEQ ID NO.2.
[0008] Another object of the present invention is to provide a recombinant expression vector comprising a gene encoding recombinant human type XVIII collagen as described above.
[0009] Another object of the present invention is to provide a host cell expressing XVIII collagen, characterized in that: the host cell contains the recombinant humanized XVIII type collagen or the nucleic acid molecule or the expression vector;
[0010] The host cell includes one of Pichia pastoris, Saccharomyces cerevisiae, Escherichia coli, or Bacillus subtilis.
[0011] Another object of the present invention is to provide the application of the recombinant humanized type XVIII collagen produced by host cells as described above in cosmetics.
[0012] As a preferred embodiment of the application of the recombinant human XVIII collagen of the present invention in cosmetics, wherein the recombinant humanized XVIII collagen promotes fibroblast proliferation.
[0013] As a preferred embodiment of the application of the recombinant human XVIII collagen of the present invention in cosmetics, wherein the recombinant humanized XVIII collagen promotes fibroblast scratch healing.
[0014] As a preferred embodiment of the application of the recombinant human XVIII collagen of the present invention in cosmetics, wherein the recombinant humanized XVIII collagen reduces β-galactosidase staining in fibroblasts.
[0015] As a preferred embodiment of the application of the recombinant human XVIII collagen of the present invention in cosmetics, wherein the recombinant humanized XVIII collagen reduces the expression level of the MMP-1 gene in fibroblasts.
[0016] As a preferred embodiment of the application of the recombinant human XVIII collagen of the present invention in cosmetics, wherein the recombinant humanized XVIII collagen increases the expression level of the COLA-1 gene in fibroblasts.
[0017] Compared with the prior art, the present invention has the following beneficial effects:
[0018] This invention designs and screens the core functional domains of XVIII collagen, and constructs a recombinant engineered bacterial expression system using genetic engineering technology. This allows recombinant micro-molecule XVIII collagen to penetrate the skin through topical application, which is of great significance for advancing the application of collagen in the skincare field. This invention artificially designs target genes, removes immunogenic fragments of XVIII collagen, optimizes molecular conformation to improve transdermal efficiency, and directionally enhances the biological activity of specific functional domains. These domains are then inserted into a Pichia pastoris expression vector to express recombinant XVIII collagen core molecular fragments with high biological performance, achieving efficient expression in a heterologous host. Attached Figure Description
[0019] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:
[0020] Figure 1 This is a schematic diagram of the construction of recombinant Pichia pastoris plasmid in Example 1 of the present invention;
[0021] Figure 2 The results of PCR identification of the positive clone strain in Example 1 of this invention;
[0022] Figure 3 The images show SDS-polyacrylamide gel electrophoresis results of recombinant Pichia pastoris cultured in shake flasks and induced for expression in Example 1 of this invention. (a) represents reduction electrophoresis, where M: Marker; 1: before induction; 2: after 20 h of induction; 3: after 28 h of induction; 4: after 48 h of induction; 5: after 72 h of induction; and (b) represents non-reduction electrophoresis, where M: Marker; 1: before induction; 2: after 24 h of induction; 3: after 48 h of induction; 4: after 72 h of induction; and 5: after 72 h of induction.
[0023] Figure 4 The results of Western Blot identification of recombinant Pichia pastoris after shake-flask culture and induced expression in Example 1 of this invention;
[0024] Figure 5SDS-polyacrylamide gel electrophoresis of recombinant Pichia pastoris cultured in shake flask and induced expression in Example 1 of this invention; M: Marker; 1: Empty Pichia pastoris precipitate with repeatedly frozen and thawed protein; 2: Recombinant Pichia pastoris precipitate with repeatedly frozen and thawed protein; 3: Empty Pichia pastoris supernatant protein; 4: XVII collagen recombinant Pichia pastoris supernatant protein;
[0025] Figure 6 The effect of Pichia pastoris lysate on fibroblast proliferation in Example 2 of this invention;
[0026] Figure 7 This illustrates the effect of XVIII collagen-yeast lysate on fibroblast proliferation in Example 2 of the present invention.
[0027] Figure 8 The results of the cell scratch experiment in Example 2 of this invention;
[0028] Figure 9 The results of the anti-aging experiment in Example 2 of this invention;
[0029] Figure 10 The expression levels of MMP-1 and COLA-1 were verified by qPCR in Example 2 of this invention. Detailed Implementation
[0030] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.
[0031] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.
[0032] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.
[0033] Unless otherwise specified, all raw materials used in the examples are commercially available.
[0034] Example 1
[0035] Step 1: Gene Design and Synthesis
[0036] Gene design: The amino acid sequence of recombinant humanized type XVIII collagen is shown in SEQ ID NO.1.
[0037] The optimized nucleotide sequence based on Pichia pastoris codon preference is shown in SEQ ID NO.2.
[0038] Step 2: Construction and expression of the recombinant expression vector
[0039] (1) Using the PIC9K plasmid as a backbone, the DNA fragment of SEQ ID NO.2 above was inserted to finally obtain the Pic9k-CX-03 recombinant expression vector;
[0040] (2) The correct Pic9k-CX-03 was introduced into DH5α host cells, and after amplification, the Pic9k-CX-03 expression vector was extracted;
[0041] (3) The Pic9k-CX-03 plasmid was linearized with SalI restriction enzyme. The linearized Pic9k-CX-03 plasmid was then introduced into Pichia pastoris GS115 via electroporation and plated on MD plates. After two MD plate tests and one G418 resistance screening, at least five cloned strains were finally obtained. Positive clonal spots obtained from the second plate test were used for PCR verification. The primers used for PCR are as follows:
[0042] AOX1 upstream primer J2: GACTGGTTCCAATTGACAAGC
[0043] AOX1 downstream primer J1: GCAAATGGCATTCTGACATCC
[0044] α-guided peptide upstream primer J3: TACTATTGCCAGCATTGCTGC
[0045] PCR conditions are shown in Table 1.
[0046] Table 1
[0047] The agarose gel electrophoresis results of the PCR are shown below. Figure 2 As shown. Figure 2 It can be seen that the positive clone strains were identified by PCR, and the electrophoresis results of the amplification products were consistent with the expected fragment size, indicating that the target gene has been successfully integrated into the host genome.
[0048] Step 3: Induction and expression of recombinant XVIII collagen
[0049] Take 1 ml of the cloned strain from step 2 and add it to 50 ml of YPD medium. Add 1 ml of glycerol and incubate in a shaker (30℃, 220 rpm). When the OD value reaches 10, centrifuge to collect the bacterial cells and transfer them to BMMY medium. Add 0.5% methanol every 24 hours (to maintain induction) and monitor the OD value. Collect the supernatant (secretory expression) after the first 24 hours, and collect the supernatant every 4 hours thereafter. Perform SDS-PAGE electrophoresis and Western blot identification experiments to screen and verify the engineered bacteria that highly express humanized type XVIII collagen.
[0050] Electrophoresis image of humanized type XVIII collagen SDS protein as shown in Figure Figure 3 As shown, Figure 3 It can be seen that no target protein expression was detected before methanol induction; the target protein band began to appear 28 h after methanol induction, and the protein expression level increased significantly by 72 h.
[0051] The Western blot protein electrophoresis image of humanized type XVIII collagen is shown below. Figure 4 As shown, Figure 4 It can be seen that no specific bands were detected in the cloned bacteria before induction; after 48 hours of induction, a specific band of the target protein was detected at 18 kDa. The band was clear and consistent with the expected molecular weight, indicating that the protein was successfully expressed.
[0052] Step 4: Preparation of Pichia pastoris fermentation lysate filtrate
[0053] After fermentation, add PMSF (or other protease inhibitors) at a final concentration of 1 mM to prevent protein degradation. Place the pre-induction and post-induction precipitates of empty Pichia pastoris and recombinant Pichia pastoris in a -80°C freezer for 30 minutes until completely solidified, then transfer to a 37°C water bath (or room temperature) and gently shake until completely thawed (about 30 minutes). Repeat the freeze-thaw cycle 6 times, centrifuge at 12000×g for 20 minutes at 4°C, and collect the supernatant (containing intracellular products).
[0054] SDS-PAGE was used to detect protein concentration and integrity.
[0055] SDS-PAGE electrophoresis image of Pichia pastoris lysate after repeated freeze-thaw cycles. Figure 5 As shown, Figure 5 It can be seen that, compared with empty Pichia pastoris, the target protein band appeared in the supernatant of recombinant Pichia pastoris near 18 kDa, while no target protein band appeared in the precipitates of either empty or recombinant Pichia pastoris, indicating that the target protein is secreted extracellularly for expression.
[0056] Example 2
[0057] The properties of Pichia pastoris fermentation lysate filtrate and Pichia pastoris fermentation lysate filtrate + humanized type XVIII collagen were tested:
[0058] (1) CCK8 assay to detect the effect of samples on cell proliferation and viability
[0059] HFF cells in good logarithmic growth phase were selected and seeded in 96-well cell culture plates. After digestion with 0.25% trypsin and centrifugation, the cells were resuspended in DMEM medium containing 10% fetal bovine serum and counted. Cells were cultured at 200 μL (8 × 10⁶ cells / well). 3 Cells were seeded at a density of cells / well into 96-well plates, with a control group and a sample group included in the experiment. Eight concentration gradients were set up for the samples. 100 μL each of empty Pichia pastoris fermentation lysate filtrate and Pichia pastoris fermentation lysate filtrate containing humanized type XVIII collagen were serially diluted with PBS according to Table 2 below.
[0060] Table 2
[0061] 2 μL (1%) PBS was added to each well in the control group; 2 μL (1%) of the corresponding concentration of sample was added to each well in the sample group, with three replicates for each concentration. Cells were cultured in an incubator (37℃, 5% CO2) for 48 h, then 10 μL of CCK-8 working solution was added, and the cells were incubated in the dark for approximately 2 h. Absorbance was measured at 450 nm to assess relative cell viability. Cell viability greater than 80% was considered cytotoxic; otherwise, cytotoxicity was considered present.
[0062] The bar chart showing the effect of Pichia pastoris lysate on cell proliferation is shown below. Figure 6 As shown, Figure 6 It can be seen that Pichia pastoris lysate has cell proliferation effect on fibroblasts at concentrations of 3-12.5 μg / ml, with the best proliferation-promoting effect at a concentration of 6.25 μg / ml.
[0063] The bar chart showing the effect of Pichia pastoris lysate + XVIII collagen on cell proliferation is shown below. Figure 7 As shown, Figure 7 It can be seen that Pichia pastoris lysate containing XVIII collagen has cell proliferation effects on fibroblasts at concentrations of 3-50 μg / ml, with the best proliferation-promoting effect at a concentration of 6.25 μg / ml.
[0064] (2) Cell scratch assay to detect the cell repair ability of the sample.
[0065] Select HFF cells in good logarithmic growth phase, and administer 200 μL of 8 × 10⁸ cells. 3Cells were seeded at a density of cells / well into 96-well plates. The experiment included a control group and a sample group (6.25 μg / ml). 2 μL (1%) PBS was added to each well of the control group, and 2 μL (1%) of the corresponding concentration of sample was added to each well of the sample group. The plates were incubated in an incubator (37℃, 5% CO2) for 48 h. A cross was drawn on each well, and the plates were incubated in the dark for about 18 h. Images of the same location were taken under a microscope.
[0066] Results of cell scratch healing experiment as follows Figure 8 As shown, Figure 8 It can be seen that, compared with PBS and Pichia pastoris lysate, Pichia pastoris lysate containing XVIII collagen showed a significant repair effect in the cell scratch experiment, completely repairing the cell scratch site within 24 hours.
[0067] (3) Evaluation of the anti-photoaging efficacy of the test samples by β-galactosidase
[0068] Select HFF cells in good logarithmic growth phase, and administer at a rate of 5 × 10⁻⁶ cells. 4 Cells were seeded into 24-well plates at a density of cells / well. The control group was treated with 10 μL of PBS, while the sample group was treated with 10 μL of 6.25 μg / ml sample. The 24-well plates were incubated in an incubator (37℃, 5% CO2) for 48 h. The cell culture medium was aspirated, and β-galactosidase staining was performed. The plates were then incubated overnight at 37℃ and observed and photographed under a regular optical microscope.
[0069] Cellular galactosidase results as follows Figure 9 As shown, Figure 9 It can be seen that, compared with PBS and Pichia pastoris lysate, Pichia pastoris lysate containing XVIII collagen showed a significant reduction in the number of blue-marked cells in the β-galactosidase anti-photoaging experiment, demonstrating a significant anti-aging effect.
[0070] (4) Detection of changes in COLA1 and MMP1 at the gene level
[0071] Human fibroblasts (HFF) in the logarithmic growth phase were divided into groups of 6 × 10⁻⁶. 5Cells were seeded at a density of 10 μL / well into 6-well plates. When the cell deposition rate reached 40-50%, 20 μL of PBS was added to the control group, and 20 μL of 6.25 μg / ml sample was added to the sample group. The plates were incubated in an incubator (37℃, 5% CO2) for 24 h. Both the control and sample groups received 1 h of UVA radiation (0.5 h radiation, 1 h incubation, 0.5 h radiation), while the blank control group received no radiation. After culture, the cells were washed three times with 2 mL / well PBS, and Trizol was added. Cells were lysed by pipetting, and the cell lysates were collected for RNA extraction, reverse transcription, and quantitative real-time PCR to detect COLA1 and MMP1 gene levels. -△△Ct The method calculates the relative expression level of the target gene.
[0072] Cellular MMP1 gene level detection, such as Figure 10 As shown in a, compared with the model group, the expression level of MMP-1 gene in the Pichia pastoris lysate treatment group was significantly reduced, while the Pichia pastoris lysate treatment group containing type XVIII collagen showed a more significant downregulation of MMP-1 gene expression, and its inhibitory effect was significantly better than that of the Pichia pastoris lysate treatment group alone.
[0073] The image shows the detection level of COLA-I gene in cells. Figure 10 As shown in b, Figure 10 As can be seen from b, compared with the model group, the COLA-1 gene expression level in the Pichia pastoris lysate treatment group was significantly increased. The Pichia pastoris lysate treatment group containing type XVIII collagen showed a more significant upregulation of COLA-1 gene expression, and its effect on promoting COLA-1 expression was significantly better than that of the simple Pichia pastoris lysate treatment group.
[0074] This invention discloses a humanized XVIII type collagen engineered bacterium, expression vector, preparation method, and application, belonging to the subfield of microbial fermentation within the scope of synthetic biology. This invention removes the immunogenic fragment of XVIII type collagen, optimizes the molecular conformation to improve transdermal efficiency, and directionally enhances the biological activity of specific functional domains. It also enhances exocrine efficiency by inserting a Pichia pastoris α-signal peptide and eliminates translational blockage caused by mRNA secondary structure through codon preference optimization of the collagen repeat region, resulting in an exocrine vector, Pic9k-CX-03. This expression vector is transformed into the Pichia pastoris GS115 expression vector, achieving high-efficiency expression in a heterologous host.
[0075] Pichia pastoris fermentation lysate has multiple skin care benefits due to its rich active ingredients. The XVIII collagen expression supernatant and Pichia pastoris engineered cells prepared in this invention are repeatedly freeze-thawed and ultrasonically disrupted, and then concentrated by centrifugation and ultrafiltration to obtain a recombinant Pichia pastoris fermentation lysate filtrate containing XVIII type collagen. It has the functions of promoting cell proliferation and repair, and also has anti-aging effects. It can be applied in the cosmetics field, and can make waste Pichia pastoris fermentation cells reused, reducing enterprise costs and achieving two benefits at once.
[0076] The humanized XVIII type collagen obtained by this invention is an amino acid sequence that our research team discovered incidentally. Through experimental screening and optimization, its biosynthesis was achieved using genetic engineering techniques. Computer-aided optimization and splicing of the screened anti-degradation amino acid fragments resulted in a synthetic product exhibiting significant bioactivity and excellent anti-degradation properties. Compared to Pichia pastoris fermentation lysate, the recombinant XVIII type collagen + Pichia pastoris fermentation lysate complex possesses stronger cell repair capabilities, with a cell migration rate exceeding 90%, and also exhibits anti-aging effects, making it applicable to the cosmetics field.
[0077] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. The application of a Pichia pastoris lysate complex containing recombinant human XVIII collagen in the preparation of cosmetics, characterized in that: The complex is used in cosmetics applied to the skin; The complex was obtained by fermentation of Pichia pastoris containing an expression vector of recombinant human XVIII collagen. Specifically, after fermentation, PMSF with a final concentration of 1 mM was added to prevent protein degradation. The pre- and post-induction precipitates of the recombinant Pichia pastoris were placed in a -80°C freezer and frozen for 30 minutes until completely solidified. Then, they were transferred to a 37°C water bath and gently shaken until completely thawed. The freeze-thaw cycle was repeated 6 times. The mixture was centrifuged at 12000×g for 20 minutes at 4°C, and the supernatant was collected. The supernatant contained intracellular products, thus obtaining the Pichia pastoris lysate complex containing recombinant human XVIII collagen. The recombinant human XVIII collagen has a molecular weight of 18 kDa, and its amino acid sequence is shown in SEQ ID NO.1 and its nucleotide sequence is shown in SEQ ID NO.
2.
2. The application as described in claim 1, characterized in that: The recombinant human XVIII type collagen promotes fibroblast proliferation.
3. The application as described in claim 1, characterized in that: The recombinant human XVIII type collagen promotes fibroblast scratch healing.
4. The application as described in claim 1, characterized in that: The recombinant human XVIII type collagen reduced β-galactosidase staining in fibroblasts.
5. The application as described in claim 1, characterized in that: The recombinant human XVIII type collagen reduces the expression level of the MMP-1 gene in fibroblasts.
6. The application as described in claim 1, characterized in that: The recombinant human XVIII type collagen increases the expression level of the COLA-1 gene in fibroblasts.