Genetic coding pyruvic acid fluorescent probe capable of localizing subcellular structure, preparation method of genetic coding pyruvic acid fluorescent probe and application of genetic coding pyruvic acid fluorescent probe in macrophages

Abstract

The invention relates to a genetic coding pyruvic acid fluorescent probe capable of locating a subcellular structure, a preparation method of the genetic coding pyruvic acid fluorescent probe and application of the genetic coding pyruvic acid fluorescent probe in macrophages. The probe comprises a pyruvic acid sensitive recognition structural domain, a fluorescence signal report structural domain and a subcellular localization signal peptide which can perform targeted expression in a specific subcellular structure of macrophages, so that real-time monitoring and quantitative analysis of the concentration of pyruvic acid are realized. The probe provided by the invention has the advantages of strong specificity, high sensitivity, rapid response and the like, and is suitable for cell metabolism dynamic research, power-assisted metabolism mechanism analysis and drug target discovery. In the aspect of disease research, abnormal metabolism of macrophages is closely related to myocardial infarction and the like, the malic enzyme 2 is regulated and controlled to improve the pyruvic acid level, improve the polarization state of the macrophages and enhance the anti-inflammatory and tissue repair functions of the macrophages, and the potential protection effect on ischemic heart tissue is shown. The probe disclosed by the invention is expected to be used as an important tool for researching macrophage metabolism regulation and related disease intervention means.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological probes, in particular to a genetic coding pyruvate fluorescent probe capable of locating subcellular structure, and its preparation method and application in macrophages. BACKGROUND

[0002] Pyruvate (C3H4O3) is a key metabolic intermediate in the body (Nat Rev Cardiol, 2019, 16:203-212). Recent studies have shown that the metabolic characteristics of humans are closely related to disease states, and multiple key proteins involved in the regulation of pyruvate metabolism exhibit specific expression patterns under different physiological and pathological conditions, and their metabolic disorders have been confirmed to be closely related to various major diseases such as malignant tumors, neurodegenerative diseases and heart failure. In cardiovascular diseases, energy metabolism disorders of myocardium are manifested as mitochondrial dysfunction, changes in substrate utilization preference, dependence on glycolysis and ketone body oxidation, impaired mitochondrial metabolism of pyruvate, and the need to explore therapeutic targets from the perspective of pyruvate metabolism. Macrophages are widely present in various tissues of the body and are involved in various biological processes such as anti-infection, clearance of apoptotic cells and tissue repair. Their metabolic flexibility is the basis for realizing multifunctional immune effects and adapting to changes in the microenvironment. In-depth study of the metabolic state of pyruvate in different subcellular structures of macrophages helps to reveal the metabolic pathways and regulatory mechanisms in the process of immune response, and deepens the understanding of immune function. However, the low content of pyruvate in cells (about 40-100 μmol / L) poses a significant challenge to the precise detection of pyruvate at the subcellular level. (TrAC Trends in Analytical Chemistry, 2019, 110:160-172).

[0003] Current biochemical analysis, chromatography and mass spectrometry methods can detect pyruvate concentration, but it is difficult to achieve subcellular level in situ dynamic monitoring, and it depends on expensive equipment and professional operation, which is difficult to meet the real-time detection needs of high-throughput and living cell environment (Journal of Chromatography B, 2023, 1230: 123906). In order to further analyze the cell metabolism mechanism, a new type of tool with compartmentalization and time resolution ability is urgently needed. In recent years, genetically encoded probes based on fluorescent proteins have developed rapidly. With specific recognition domains, they can convert metabolic concentration changes into visual signals, achieving high spatiotemporal resolution dynamic imaging, especially suitable for studying disease-related metabolic regulation processes. Patent CN118063566A discloses a phosphoenolpyruvate optical probe. Specifically, the invention provides a phosphoenolpyruvate optical probe, which comprises a phosphoenolpyruvate-sensitive polypeptide and an optically active polypeptide, wherein the optically active polypeptide is located in the sequence of the phosphoenolpyruvate-sensitive polypeptide. Patent CN113336855B discloses a pyruvate optical probe, its preparation method and application. On the one hand, the invention relates to an optical probe comprising a pyruvate-sensitive polypeptide and an optically active polypeptide, wherein the optically active polypeptide is located in the sequence of the pyruvate-sensitive polypeptide. The invention also relates to the preparation method of the above-mentioned probe and its application in detecting pyruvate. However, the above probes are mostly general design, lacking application in specific cell types (such as immune cells).

[0004] Malic enzyme 2 (ME2) is an oxidative decarboxylase located in mitochondria, which catalyzes the conversion of malate to pyruvate and generates NADPH at the same time (Redox Biol, 2024, 75: 103273). As a key node enzyme in the mitochondrial metabolic pathway, ME2 plays an important role in regulating the tricarboxylic acid cycle, mitochondrial oxidative phosphorylation and glutamine metabolism (Cell Metab, 2021, 33: 1027-1041e1028, Nature Metabolism, 2022, 4: 225-238). Studies have shown that ME2 is highly expressed in various tumor types, such as liver cancer, lung cancer and osteosarcoma (Nature, 2017, 542: 119-123), which plays a key role in regulating cellular energy metabolism, maintaining redox homeostasis and remodeling tumor immune microenvironment (IUBMB Life, 2018, 70: 1076-1083, Proc Natl Acad Sci U S A, 2023, 120: e2217869120). Therefore, ME2 is considered a potential driver of tumor development, and its enzyme activity is closely related to the proliferation, apoptosis and immune escape of tumor cells. Although its role in tumor metabolism has been widely reported, the functional mechanism of ME2 in non-tumor diseases, especially cardiovascular diseases, is still unclear. The cardiovascular system is highly dependent on mitochondrial energy metabolism, and as a key metabolic enzyme in mitochondria, ME2 is likely to play an important role. However, there is still a lack of systematic research on its expression, function and regulation mechanism in cardiovascular diseases, and further exploration is needed. SUMMARY

[0005] Based on the above-mentioned shortcomings in the prior art, the purpose of the present application is to provide a genetic coding pyruvate fluorescent probe capable of locating subcellular structures, and its preparation method and application in macrophages.

[0006] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0007] One of the technical schemes of the present application provides a genetic coding pyruvate fluorescent probe, which is a fusion polypeptide comprising a pyruvate-sensitive polypeptide fragment and a subcellular localization signal peptide fragment; the fluorescent probe is a pyruvate-responsive polypeptide chain having a sequence shown in SEQ ID NO: 1-SEQ ID NO: 3 or a functional variant thereof, or a sequence having 35%-99% sequence identity thereto.

[0008] In some embodiments of the present application, the pyruvate-sensitive polypeptide is derived from Escherichia coli. The pyruvate-sensitive polypeptide can comprise one or more mutations at an amino acid site; the mutated forms include but are not limited to modifications, substitutions, deletions, or cleavages of amino acids. Preferably, the pyruvate-responsive polypeptide chain has 35%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 99% sequence identity.

[0009] Further, the sequence of the pyruvate-sensitive polypeptide comprises the sequence of a fluorescently active polypeptide, which divides the pyruvate-sensitive polypeptide into a first part and a second part. The fluorescently active polypeptide is inserted into different positions of the pyruvate-sensitive polypeptide as a structural unit that can emit a detectable fluorescent signal. In some specific embodiments, the fluorescently active polypeptide is embedded between two amino acid residues of the pyruvate-sensitive polypeptide segment. The pyruvate-sensitive polypeptide with the fluorescently active polypeptide inserted at different positions can change the ability to bind to pyruvate and the intensity of the fluorescent signal after being folded into a coil.

[0010] Further, the subcellular localization signal peptide is arranged at the N-terminus and / or C-terminus of the pyruvate-sensitive polypeptide, which is used to localize the genetically encoded pyruvate probe to the subcellular organelle of the cell and does not affect the fluorescent response performance of the genetically encoded pyruvate probe; the subcellular localization signal peptide can achieve specific localization of the probe in different subcellular structures such as cytoplasm, mitochondria, and nucleus, thereby achieving dynamic detection of pyruvate in a specific region. The cell is preferably a macrophage, more preferably a mouse bone marrow primary macrophage; the subcellular organelle includes any one of cytoplasm, mitochondria, or nucleus.

[0011] Further, the subcellular localization signal peptide is: a cytoplasmic localization signal peptide as shown in SEQ ID NO: 4, or a mitochondrial localization signal peptide as shown in SEQ ID NO: 5, or a nuclear localization signal peptide as shown in SEQ ID NO: 6.

[0012] Further, the present application also provides a nucleic acid encoding the above-mentioned pyruvate fluorescent probe, or a complementary nucleic acid thereof.

[0013] Further, the present application also provides a recombinant expression vector comprising the above-mentioned nucleic acid sequence or its complementary sequence; the recombinant expression vector comprises expression control sequences, including: replication origin, promoter, enhancer, operator, terminator, ribosome binding site; the expression vector is selected from any one of a prokaryotic expression vector, a eukaryotic expression vector, or a viral vector. The prokaryotic expression vector is preferably a plasmid vector, such as plasmid pRSETA.

[0014] Further, the present application also provides a recombinant expression transformant comprising the above-mentioned recombinant expression vector. After culturing the recombinant expression transformant and breaking, the pyruvate fluorescent probe is obtained. In some embodiments, the pyruvate fluorescent probe contains a tag for purification or a tag for immunoblotting, which is 6 histidines (6*His).

[0015] Further, a preparation method of the above-mentioned genetically encoded pyruvate fluorescent probe is provided, comprising the following steps:

[0016] (1) constructing a recombinant expression vector containing a nucleic acid sequence encoding the pyruvate fluorescent probe;

[0017] (2) transferring the recombinant expression vector into a host cell to construct a recombinant expression transformant; culturing the recombinant expression transformant under conditions suitable for expression of the recombinant expression transformant;

[0018] (3) isolating the pyruvate fluorescent probe.

[0019] Further, a method for expressing a genetically encoded pyruvate fluorescent probe in a cell is provided, preferably a mouse bone marrow primary macrophage cell; the method comprises the following steps:

[0020] (1) constructing a recombinant expression vector containing a nucleic acid sequence encoding a genetically encoded pyruvate fluorescent probe; preferably, the recombinant expression vector is a lentivirus or adenovirus expression system;

[0021] (2) transfecting the above-mentioned recombinant expression vector into the cell;

[0022] (3) culturing the cell and providing conditions suitable for its growth and expression of the probe protein; thereby realizing expression of the genetically encoded pyruvate fluorescent probe in the cell.

[0023] Further, a mouse bone marrow primary macrophage cell model expressing a genetically encoded pyruvate fluorescent probe obtained by the above-mentioned method is provided. The mouse bone marrow primary macrophage cell model can stably express the genetically encoded pyruvate fluorescent probe of the present application, and is suitable for subsequent metabolic detection and functional screening experiments.

[0024] The second technical solution of the present application provides an application of the above-mentioned genetically encoded pyruvate fluorescent probe in detecting pyruvate content, wherein the genetically encoded pyruvate fluorescent probe serves as a fluorescent detection indicator.

[0025] The application scenarios include but are not limited to detecting pyruvate content in an in-vitro sample to be detected; expressing the fluorescent probe in a cell to be detected to detect pyruvate content in the cell in real time.

[0026] Further, the application provides a method for detecting the content of pyruvic acid in a sample in vitro, comprising the following steps: (1) contacting the genetically encoded pyruvic acid fluorescent probe with the sample to be detected; (2) measuring the change of the fluorescence intensity of the sample to be detected before and after contacting the genetically encoded pyruvic acid fluorescent probe, comparing the change of the fluorescence intensity of the sample to be detected with the change of the fluorescence intensity of a pyruvic acid standard, and obtaining the content of pyruvic acid in the sample to be detected; when detecting the fluorescence intensity, the excitation wavelength is 420 nm or 485 nm, and the emission wavelength is 520 nm.

[0027] Further, the application provides an application of the genetically encoded pyruvic acid fluorescent probe in the research on the relationship between the functional state of macrophage subtypes and cardiovascular diseases. In the application, the genetically encoded pyruvic acid fluorescent probe is used as a fluorescent detection indicator to show the content of pyruvic acid and the metabolic state of pyruvic acid in cells.

[0028] Further, the application is based on the mechanism of malic enzyme 2 (ME2) regulating pyruvic acid metabolism. It is found that the expression level of ME2 in macrophages in different polarization states (such as M1 type pro-inflammatory state and M2 type anti-inflammatory state) is significantly different, which indicates that ME2 may be involved in the metabolic reprogramming and functional differentiation regulation of macrophages.

[0029] Further, the application constructs a mouse myocardial infarction model, and induces specific overexpression of ME2 in macrophages in vivo, and observes the regulation effect of ME2 on the repair process of myocardial injury in a pathological state. The experimental results show that the metabolic regulation function of ME2 can significantly improve the inflammatory response after myocardial infarction and promote tissue repair, which has potential application prospects in treatment. By establishing a disease intervention and mechanism research platform targeting the pyruvic acid metabolic pathway based on macrophages, the application provides a new method for analyzing the pathogenesis of cardiovascular diseases and screening metabolic targets.

[0030] The third technical solution of the application provides a screening system for targeting the pyruvic acid metabolic pathway in the cytoplasm, mitochondria and nucleus of mouse bone marrow primary macrophages based on the above-mentioned application.

[0031] The screening system is based on the genetically encoded fluorescent probe with subcellular organelle targeting ability constructed by the present application, and realizes stable expression in mouse bone marrow primary macrophages through lentiviral transduction technology, thereby establishing a screening model that can be used for cell level function evaluation. The screening system reflects the fluctuation of pyruvate concentration in real time through fluorescence signal change, can accurately monitor the dynamic changes of pyruvate metabolism in different subcellular environments such as cytoplasm, mitochondria and nucleus, and further evaluate the activation or inhibition effect of various compounds on pyruvate metabolism pathway. Through the system, lead compounds or functional molecules with pyruvate metabolism activity can be systematically screened, including but not limited to metabolic enzyme modulators, transporter regulatory factors and upstream mediators of regulatory signal pathways. The screening system has high specificity and tissue / subcellular organelle targeting, avoids the defects of whole signal covering subcellular differences in traditional metabolic analysis methods, and can more accurately reflect the real biological effect of the targeted compound. In addition, the system is compatible with automatic imaging analysis equipment and high-throughput reading platform, and can be integrated with molecular library screening, time gradient detection and dose response analysis processes, and is widely applicable to the fields of metabolic mechanism research, immune regulation exploration and function verification of inflammation intervention strategy.

[0032] The fourth technical solution of the present application provides a high-throughput screening method for compounds targeting pyruvate in mouse bone marrow primary macrophage cytoplasm, mitochondria and nucleus. The method is based on the above-mentioned screening system, and performs function verification and system evaluation on the compounds to be screened through a standardized process. The screening method comprises the following steps:

[0033] (1) contacting the system containing the above-mentioned genetically encoded pyruvate fluorescent probe with the compound to be tested;

[0034] (2) detecting the fluorescence change of the system, and screening the compounds that have an effect on the change of pyruvate content according to the fluorescence change.

[0035] Specifically, the method utilizes genetically encoded pyruvate fluorescent probes respectively located in different subcellular regions to construct a stable expression cell line, uses an automatic liquid workstation to add the compound to be tested into a microplate culture system, induces the compound to act on the cells under specific culture conditions, and collects fluorescence images or data at different time points. By analyzing the absolute change of the fluorescence intensity of the probe or the relative change of the fluorescence ratio, combined with image processing algorithms or high-content screening systems, quantitative evaluation of the compound regulating pyruvate level can be realized. The screening method has the advantages of high sensitivity, standardized operation process, high time resolution, etc., is suitable for large-scale screening of candidate compound libraries, and can be combined with artificial intelligence algorithms to realize automatic classification and priority sorting. The method can not only be used for screening of drug molecules with potential metabolic intervention function, but also be suitable for mechanism repositioning research of existing drugs, development of cell energy homeostasis intervention strategies, and discovery of specific metabolic pathway regulating molecules. Since pyruvate plays an important role in cell metabolic reprogramming, inflammation regulation and immune response, the screening method has broad application prospects in the fields of tumor metabolism, infectious diseases and autoimmune diseases, etc.

[0036] Compared with the prior art, the present application has at least the following outstanding substantial features and significant progress:

[0037] (1) The detection method provided by the present application can be carried out in vivo, in vitro, at the subcellular level or in situ conditions, has high sensitivity, real-time and spatial resolution, and is especially suitable for studying the dynamic changes of pyruvate in metabolic state, cell activity and drug action process. The genetically encoded pyruvate fluorescent probe provided by the present application not only has good fluorescence response dynamic range and specificity, but also can be stably expressed in mouse bone marrow primary macrophages by genetic engineering, so as to realize real-time, in situ and quantitative monitoring of intracellular and extracellular pyruvate, and provide an innovative tool platform for metabolic research and functional screening.

[0038] (2) The genetically encoded pyruvate probe provided by the present application has good fluorescence dynamic range and high pyruvate response specificity, and can monitor pyruvate in real time and quantitatively in different biological environments, suitable for various experimental conditions and research needs. The probe can be stably expressed and accurately detected in vivo, in vitro, subcellular, and in situ levels, and is especially suitable for high-resolution imaging and analysis of pyruvate concentration changes in different subcellular structures such as cytoplasm, mitochondria and nucleus. The probe described in the present application can be widely used in various research and application scenarios, including but not limited to: live cell or animal model live imaging for observing the spatiotemporal dynamic distribution of intracellular pyruvate; metabolic mechanism research, especially in the context of inflammation, immune response, tumor metabolic reprogramming, etc. Analyzing the energy state of cells; the construction of drug screening platform, screening agonists or inhibitors that regulate the level of pyruvate in cells through probe signal changes; and inflammation-related metabolic pathway research, providing a key tool for studying macrophage functional state, disease mechanism and metabolic targeted therapy strategy development. The application mode of the present application is flexible, has good universality and expandability, and has significant scientific research and transformation application value.

[0039] (3) The present application first applies pyruvate probes to primary macrophages, and combines with the study of cell polarization state under the background of metabolic reprogramming, verifies the applicability of the probe under various physiological and pathological conditions, especially the study of inflammation repair mechanism in myocardial infarction model. This interdisciplinary technology integration not only expands the application range of the probe, but also provides an efficient tool for studying immune metabolism regulation and disease intervention strategies.

[0040] (4) Compared with existing chemical synthesis probes, the present application uses genetic encoding to synthesize probes, which has the advantages of stable expression, low toxicity, no need for repeated staining, etc., is suitable for long-term tracking of intracellular metabolite changes, and can be applied to animal bodies through viral or transgenic technology, supporting dynamic monitoring and intervention evaluation in chronic disease research, significantly improving the continuity and data reliability of the experimental system.

[0041] (5) The present application focuses on macrophages, a cell type that plays a key role in inflammation and tissue repair, and combines its metabolic characteristics to explore its functional transformation in ischemic diseases, providing specific research tools for related disease research and intervention. At the same time, the present application not only focuses on the detection of metabolites, but also includes the combined application with cell function regulation. The present application can not only be used for monitoring, but also proposes to increase the pyruvate content by regulating key metabolic factors such as malate dehydrogenase 2, and then regulate the polarization state of macrophages, to explore its therapeutic potential in ischemic heart injury, realizing the complete research chain of "detection-intervention-mechanism analysis". BRIEF DESCRIPTION OF DRAWINGS

[0042] The present application will be further described below in conjunction with the drawings and examples.

[0043] Figure 1 Screening chart of genetically encoded pyruvate probe Gepri in Example 3;

[0044] Figure 2 Fluorescence spectrum chart of genetically encoded pyruvate probe Gepri in Example 4;

[0045] Figure 3 Normalized ratio of fluorescence intensity at 485 nm to 420 nm of genetically encoded pyruvate probe Gepri in Example 4 after adding sodium pyruvate solution of different concentrations in turn;

[0046] Figure 4 Time titration curve of normalized ratio of fluorescence intensity at 485 nm to 420 nm of genetically encoded pyruvate probe Gepri in Example 4 after adding sodium pyruvate solution of different concentrations in turn;

[0047] Figure 5 Fold line chart of specific detection of genetically encoded pyruvate probe Gepri in Example 4;

[0048] Figure 6 Temperature stability detection chart of genetically encoded pyruvate probe Gepri in Example 4;

[0049] Figure 7 pH stability detection chart of genetically encoded pyruvate probe Gepri in Example 4;

[0050] Figure 8 Subcellular organellar localization photo of genetically encoded pyruvate probe Gepri in mouse bone marrow primary macrophages in Example 5;

[0051] Figure 9 A: Relative mRNA expression level of ME2 detected by fluorescent quantitative PCR after mouse bone marrow primary macrophages in Example 6 were induced to M1 type macrophages by LPS; B: Relative mRNA expression level of ME2 detected by fluorescent quantitative PCR after mouse bone marrow primary macrophages in Example 4 were induced to M2 type macrophages by IL-4;

[0052] Figure 10 A: Relative mRNA expression level of M1 type macrophage marker gene detected by fluorescent quantitative PCR after mouse bone marrow primary macrophages in Example 6 overexpressed ME2; B: Relative mRNA expression level of M2 type macrophage marker gene detected by fluorescent quantitative PCR after mouse bone marrow primary macrophages in Example 4 overexpressed ME2;

[0053] Figure 11To evaluate the effect of ME2 overexpression on myocardial infarction area in the myocardial infarction model by TTC staining in Example 7. DETAILED DESCRIPTION

[0054] In order for those skilled in the art to better understand the technical solutions of the present application, the present application will be described in detail below in conjunction with specific examples. It should be noted that the following examples will help those skilled in the art to further understand the present application, but do not limit the present application in any form. It should be noted that for those skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made. These all belong to the protection scope of the present application.

[0055] All raw materials of the present application, unless otherwise specified, represent that there is no special restriction on their source, and can be purchased on the market or prepared according to the conventional method well known to those skilled in the art.

[0056] The experimental materials and reagents involved in the present application are as follows:

[0057] The pRSETA-YFP, pRSETA-YFP-Pd plasmids used in the examples were constructed by the laboratory of Shanghai University School of Medicine. All primers used for PCR were synthesized, purified and identified correctly by mass spectrometry by Shenguo Bioengineering (Shanghai) Co., Ltd. The expression plasmids constructed in the examples were all subjected to sequence determination, which was completed by Beijing Qikong Biotechnology Co., Ltd. The Phusion DNA polymerase used in each example was purchased from Thermo Fisher Scientific Co., Ltd. The restriction endonucleases such as BamHI, HindIII, XbaI, EcoRI, T4 ligase, T4 phosphorylase (T4 PNK) were purchased from New England Biolabs (NEB) Co., Ltd. and were accompanied by the corresponding buffers when purchased. The transfection reagent Hieff Liposomal Transfection Reagent was purchased from Yixing Biotechnology (Shanghai) Co., Ltd. Sodium pyruvate and HEPES salt were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Ampicillin (AMP) was purchased from Shenguo Bioengineering (Shanghai) Co., Ltd. 96-well full-black detection plates, 10-cm cell culture dishes, and cell culture six-well plates were purchased from the LABSELECT brand. The DNA purification kit and the general plasmid small extraction kit used in the examples were purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd. The cloning strain BL21 (DE3) and the Trans5α E. coli competent cells were purchased from Beijing Quansijin Biotechnology Co., Ltd. The His-tag protein purification kit was from Shanghai Lingyin Biotechnology Co., Ltd.

[0058] The main instruments used in the examples include: multifunctional enzyme label instrument (Tecan Company of Switzerland), 3-5R high-speed refrigerated centrifuge (Hunan Hengnuo Instrument and Equipment Co., Ltd.), PCR amplifier (BIOER Company), ultrasonic crusher (Ningbo Xinzhi Company), nucleic acid electrophoresis instrument (Shanghai Tian Neng Technology Co., Ltd.), fluorescence spectrophotometer (Varian Company of the United States), CO2 constant temperature cell incubator (Thermo Fisher), full-automatic inverted fluorescence microscope (Nikon Company of Japan), chemiluminescence imaging system (Shanghai Kinxiang Scientific Instrument Co., Ltd.), biochemical incubator (Bluepard).

[0059] Example 1 Fluorescent protein and pRSETA vector connection

[0060] 1. Polymerase chain reaction (PCR):

[0061] The fluorescent protein YFP gene sequence is amplified by PCR, and the reaction system is as follows: template sequence (as shown in SEQ ID NO: 7) 0.5 μL, forward primer (YFP-F sequence: ATACTGCAGGCTACAACAGCGACAACGTCTATATC, 10 μM) 0.5 μL, reverse primer (YFP-R sequence: ATAGGTACCGTTGTACTCCAGCTTGTGCCC, 10 μM) 0.5 μL, 2×Phusion high-fidelity PCR premix 5 μL, sterile ultrapure water (ddH2O) 3.5 μL, total volume 10 μL. The PCR amplification program is as follows: denaturation at 98℃ for 30 seconds, 35 cycles of 98℃ for 10 seconds, 65℃ for 30 seconds, 72℃ for a certain time (30s / kb), and extension at 72℃ for 10 minutes.

[0062] 2. DNA fragment recovery

[0063] The PCR product was subjected to agarose gel electrophoresis, and after imaging, the agarose gel block containing the target fragment was cut. To purify the DNA fragment in the gel block, an agarose gel recovery kit was used according to the instructions. The reference steps are as follows: Place the adsorption column into the collection tube, add 500 μL of the equilibration solution BL, centrifuge at 12000 rpm for 1 min, and discard the waste in the collection tube. Add 200 μL of solution PN to the digested DNA product, mix by blowing, and then transfer to the adsorption column. Incubate at room temperature for 2 min, centrifuge at 12000 rpm for 1 min, and discard the waste in the collection tube. Add 600 μL of rinse solution PW to the adsorption column, centrifuge at 12000 rpm for 1 min, and discard the waste in the collection tube. Then repeat this step once more. Place the adsorption column back into the collection tube, centrifuge at 12000 rpm for 2 min to remove as much rinse solution as possible. Open the lid of the adsorption column and let it stand at room temperature for 5 min to allow the remaining rinse solution to evaporate as much as possible. Transfer the adsorption column to a clean 1.5 mL centrifuge tube, and add 30 μL of sterile ultrapure water (ddH2O) to the adsorption membrane site to elute the DNA fragment obtained by PCR.

[0064] 3. DNA fragment digestion and ligation

[0065] After gel electrophoresis and recovery of the PCR product, the DNA fragment was digested with BamHI and EcoRI, and the pRSETA vector was also subjected to the corresponding double digestion. The reaction system was as follows: DNA fragment 27 μL, BamHI enzyme 1 μL, EcoRI enzyme 1 μL, 10 x rCutSmart buffer 5 μL, and finally sterile ultrapure water (ddH2O) was added to a total volume of 50 μL; pRSETA vector 3 μL, BamHI enzyme 0.5 μL, EcoRI enzyme 0.5 μL, 10 x rCutSmart buffer 1 μL, and finally sterile ultrapure water (ddH2O) was added to a total volume of 10 μL. After incubation in a 37°C incubator for 40 min, the reaction was removed. Since the digested fragment still contains endonuclease, which affects the subsequent ligation effect, the DNA fragment was recovered again according to the steps in 2 to obtain the purified YFP digestion product and pRSETA digestion product. Ligation was performed using T4 DNA ligase, and the system was as follows: YFP digestion product 3.5 μL, pRSETA digestion product 1.5 μL, T4 DNA ligase buffer 1 μL, T4 DNA ligase (5 U / μL) 0.5 μL, and finally sterile ultrapure water (ddH2O) was added to a total volume of 10 μL. The ligation was performed at 4°C overnight for 12 h, and the next day the ligation was continued at 16°C for 1 h.

[0066] 4. Transformation

[0067] The connected product was added to 100 μL of Trans5 α E. coli competent cells, and incubated in ice bath for 30 minutes. Then, it was heated at 42°C for 30 seconds, and after being taken out, it was incubated in ice bath for another 5 minutes. 500 μL of high-temperature autoclaved broth medium was added thereto, and it was incubated in a 37°C shaker at a speed of 220 rpm for 1 hour. Then, 500 μL of the medium was discarded, and the remaining bacterial solution was spread on an agar plate, and incubated in a 37°C incubator overnight. After a single colony was randomly picked from the agar plate, 500 μL of broth medium was added, and it was incubated in a 37°C shaker at a speed of 220 rpm for 6 hours. Then, the bacterial solution was taken for PCR identification. After the positive plasmid was sequenced correctly, plasmid extraction was performed, and the pRSETA-YFP plasmid was obtained for subsequent plasmid construction.

[0068] Example 2: Pyruvate-sensitive polypeptide plasmid construction

[0069] 1. Polymerase chain reaction (PCR):

[0070] The pyruvate-binding protein Pd gene sequence was amplified by PCR, and the reaction system was as follows: template sequence (as shown in SEQ ID NO: 8) 0.5 μL, forward primer (primer F: ATAGGTACCGGCGAAATGCTACCACTAGTATCTAGTCACA, 10 μM) 0.5 μL, reverse primer (primer R: ATACTGCAGATCGTCGAGAATACAGGAGCTCA, 10 μM) 0.5 μL, and the remaining reagents in the system were the same as in Example 1. The PCR amplification program was the same as in Example 1.

[0071] 2. DNA fragment recovery, which was the same as in Example 1;

[0072] 3. DNA fragment enzyme digestion and ligation

[0073] PCR product gel electrophoresis after recovery after enzyme digestion with PstI and KpnI, and the pRSETA-YFP vector obtained in Example 1 was subjected to corresponding double enzyme digestion. The reaction system was as follows: Pd DNA fragment 27 μL, PstI enzyme 1 μL, KpnI enzyme 1 μL, 10 x rCutSmart buffer 5 μL, and finally sterilized ultrapure water (ddH2O) was added to a total volume of 50 μL; pRSETA-YFP vector 3 μL, PstI enzyme 0.5 μL, KpnI enzyme 0.5 μL, 10 x rCutSmart buffer 1 μL, and finally sterilized ultrapure water (ddH2O) was added to a total volume of 10 μL; after incubation in a 37 °C incubator for 40 min, it was taken out. Since the fragments after enzyme digestion still contain endonuclease, which affects the subsequent ligation effect, the DNA fragment was recovered again according to the steps in 2, and the purified YFP enzyme digestion product and pRSETA enzyme digestion product were obtained. Ligation with T4 DNA ligase, system: pyruvate kinase digestion product 3.5 μL, YFP-pRSETA enzyme digestion product 1.5 μL, T4 DNA ligase buffer 1 μL, T4 DNA ligase (5 U / μL) 0.5 μL, and finally sterilized ultrapure water (ddH2O) was added to a total volume of 10 μL. Ligation at 4 °C for 12 h, and the next day continue ligation at 16 °C for 1 h.

[0074] 4. The transformation step is the same as in Example 1, and finally the pRSETA-YFP-Pd plasmid is obtained for subsequent optimization.

[0075] Example 3 Optimization of pyruvate-sensitive polypeptide

[0076] 1. Polymerase chain reaction (PCR):

[0077] Pyruvate kinase and fluorescent protein genes were amplified by PCR, and the reaction system was as follows: 0.5 μL of the plasmid synthesized in Example 2 as the template sequence, 0.5 μL of the forward primer (10 μM), 0.5 μL of the reverse primer (10 μM), 5 μL of 2 x Phusion high-fidelity PCR premix, 3.5 μL of sterilized ultrapure water (ddH2O), and a total volume of 10 μL. The PCR amplification program was the same as in Example 1. In this example, the reverse PCR primer containing the specific mutation site was designed for the target mutation region, and a predetermined nucleotide substitution sequence was introduced at the 5' end of the primer. The product obtained after PCR amplification carries the corresponding mutation site. Through this site-directed mutagenesis strategy, a mutant library was constructed, and the obtained mutants were functionally screened to obtain probe variants with optimized performance.

[0078] 2. DNA fragment recovery, steps the same as in Example 1;

[0079] 3. DNA fragment enzyme digestion, phosphorylation, ligation

[0080] Afterwards, the DNA fragments were digested by Dpn I enzyme to remove the template DNA by recognizing the methylation site. The reaction system was as follows: DNA fragments 27 μL, Dpn I enzyme 1 μL, 10 x rCutSmart buffer 5 μL, and finally sterilized ultrapure water (ddH2O) was added to a total volume of 50 μL. After 3 hours of reaction in a 37 °C incubator, it was taken out and placed on ice. Afterwards, the 5' end of the DNA fragments was phosphorylated. 8.5 μL of the 50 μL reaction product was taken, and 0.5 μL of T4 polynucleotide kinase (T4 PNK), 1 μL of 10 x T4 ligase buffer were added, and a total of 10 μL system was incubated in a 37 °C incubator for 1 hour, then taken out and placed on ice. Finally, the 5' end phosphorylated DNA fragments were connected by self-circularization to connect the 3' end and 5' end of the linearized vector to obtain recombinant plasmids. The connection reaction system was as follows: 10 μL of phosphorylation reaction system, 0.5 μL of T4 ligase (5 U / μL), and a total volume of 10.5 μL. The connection was carried out at 4 °C for 12 hours, and the next day it was placed in a 16 °C reaction condition for 1 hour.

[0081] 4. Transformation

[0082] The connected product was added to 100 μL of BL21 (DE3) E. coli competent cells, and ice bathed for 30 minutes. Afterwards, it was heated at 42 °C for 30 seconds, and then taken out and ice bathed for 5 minutes. 500 μL of high-temperature and high-pressure sterilized broth medium was added, and it was placed in a 37 °C shaker at a speed of 220 rpm for 1 hour. Afterwards, 500 μL of culture medium was discarded, and the remaining bacterial liquid was spread on an agar plate, and incubated in a 37 °C incubator overnight.

[0083] 5. Protein expression, purification and fluorescence detection

[0084] The next day, single clones were picked from the plate into 50 mL centrifuge tubes, 20 mL LB medium was added, and the tubes were incubated at 37 °C on a shaker at 220 rpm until the absorbance OD600 = 0.6. Then, 1 / 1000 (v / v) of IPTG (1 M) was added, and the protein expression was induced at 18 °C on a shaker at 220 rpm for 24 hours. After the protein induction expression was completed, the 50 mL centrifuge tubes were centrifuged at 4000 rpm for 5 minutes to collect the bacterial cells. Then, 50 mM HEPES buffer was added to resuspend the bacterial cell pellets, and the bacterial cells were sonicated on ice until the solution became clear. After centrifugation at 12000 rpm at 4 °C for 10 minutes, the supernatant was collected as the protein solution to be purified. The protein solution to be purified was purified by His-tag magnetic beads to obtain the protein. After the purified protein was identified by SDS-PAGE, the probe was diluted to a final concentration of 1 μΜ using the assay buffer (10 mM HEPES, pH 7.4). Sodium pyruvate was prepared into a stock solution with a final concentration of 100 mM using the assay buffer (10 mM HEPES, pH 7.4). 90 μL of the protein solution with a concentration of 1 μΜ was added to a black 96-well plate, and the plate was incubated at 37 °C for 10 minutes. The fluorescence intensity of the protein at 520 nm after excitation at 420 nm and at 520 nm after excitation at 485 nm was measured before and after the addition of 10 μL of 100 mM sodium pyruvate solution, and the fluorescence intensity ratio R485 / 420nm was calculated as the ratio of the fluorescence intensity at 485 nm to the fluorescence intensity at 420 nm.

[0085] All mutants were detected under the same conditions, and the fluorescence changes were normalized and used to compare the response ability of the probes to pyruvate. The R485 / 420nm obtained after the addition of the pyruvate solution was divided by the R485 / 420nm obtained before the addition of the pyruvate solution to obtain the normalized Normalized R485 / 420nm. The experimental results after summarization are as follows Figure 1The results of screening experiments on nearly a thousand different mutant fluorescent probe proteins constructed showed that most mutants had a low fluorescence change amplitude under the stimulation of sodium pyruvate solution, and only showed slight changes or no obvious changes, suggesting that they had weak responsiveness to pyruvate. However, one mutant showed a significant increase in fluorescence intensity under the same concentration treatment, indicating that this configuration had the optimal pyruvate response capacity, and was named Gepri (the gene sequence is shown in SEQ ID NO: 9, and the corresponding upstream primer is GGGGGCTACAACAGCGACAAC, and the downstream primer is TCGTCGAGAATACAGGAGCTCAA). The image results clearly showed that Gepri was the most sensitive mutant to 10 mM sodium pyruvate in the current screening system; its significant fluorescence change amplitude indicated that this mutant configuration might have better conformational transition efficiency and target binding capacity, providing a strong candidate molecular basis for further functional verification and probe optimization.

[0086] Example 4 In vitro fluorescence properties of genetically encoded pyruvate probe Gepri

[0087] The purified genetically encoded pyruvate probe Gepri was subjected to in vitro fluorescence property detection using a multifunctional enzyme marker and a fluorescence spectrophotometer, respectively.

[0088] 1. Fluorescence spectrum determination of the fluorescent probe

[0089] The Gepri protein purified by His-tag magnetic beads was diluted with assay buffer (10 mM HEPES, pH 7.4), and 300 μL of 1 μM Gepri protein was added to a quartz dish. The fluorescence spectrum of the Gepri protein was measured using a fluorescence spectrophotometer. After recording the initial fluorescence spectrum, 0, 100, 200, 500, and 1000 μM sodium pyruvate solutions were added to the reaction solution, and the spectrum was immediately recorded. In all excitation spectrum experiments, the excitation and emission slits were set to 2.5 nm. The excitation spectrum scanning range was 300-510 nm, and the emission wavelength was fixed at 520 nm; every 1 nm was recorded, the integration time was 1 second, and the photomultiplier tube (PMT) voltage was set to 950 V. The detection range of the emission spectrum was 500-800 nm, and the excitation wavelength was fixed at 485 nm, and the other parameters were the same as those of the excitation spectrum.

[0090] The experimental results are shown in Table 1. Figure 2As shown in the figure, it is found that the fluorescence signal of the probe shows a significant enhancement trend with the step-by-step increase of the exogenous pyruvate concentration from low to high, which is manifested as the continuous increase of the fluorescence emission peak intensity; and the fluorescence enhancement has a good concentration dependence, indicating that Gepri can respond to the change of pyruvate concentration, and the response has a high dynamic range. Therefore, the genetically encoded probe constructed in the application can produce sensitive and quantifiable fluorescence response to the change of pyruvate concentration, has the function of pyruvate biosensor, and has good application prospect.

[0091] 2. Fluorescent probe responsive detection

[0092] (1) Concentration-dependent property detection of fluorescent probe

[0093] Take 90 μL of Gepri protein solution with a concentration of 1 μM and separate fluorescent protein YFP solution into a full black 96-well plate, incubate at 37°C for 10 minutes, and then add 10 μL of pyruvate sodium solution with working concentrations of 0, 10, 20, 50, 100, 200, 500, 1000, 5000, 10000 μM in sequence for detection. The fluorescence intensity at 520 nm emission wavelength under 420 nm excitation and at 520 nm emission wavelength under 485 nm excitation is measured respectively, and the Normalized R485 / 420nm is calculated. At the same time, 90 μL of Gepri protein solution with a concentration of 1 μM is also taken into a full black 96-well plate, incubated at 37°C for 10 minutes, and then an equal amount of assay buffer (10 mM HEPES, pH 7.4) is added as a control. The fluorescence excitation and emission of the sample are measured by using a multifunctional fluorescence microplate reader.

[0094] The experimental results are shown in the figure. Figure 3 As shown in the figure, Gepri protein shows a concentration-dependent fluorescence enhancement trend in the pyruvate sodium titration range, especially in the 100-1000 μM concentration interval, the Normalized R485 / 420nm increases significantly, indicating that Gepri protein has a good dynamic response range and sensitivity in this interval. When the concentration is higher than 1000 μM, the combination of Gepri protein and pyruvate sodium tends to be saturated. The control group with an equal amount of assay buffer has no significant change in fluorescence signal, which further confirms that the fluorescence response is specific to the presence of pyruvate sodium rather than the buffer components. The experimental results show that Gepri protein has good response to pyruvate, and can realize sensitive and quantitative fluorescence ratio change in a certain concentration range.

[0095] (2) Time titration property detection of fluorescent probe

[0096] 90 μL of a 1 μM Gepri protein solution was added to a black 96-well plate and incubated at 37°C for 10 minutes. Then, 10 μL of sodium pyruvate solution was added sequentially at working concentrations of 0, 10, 20, 50, 100, 200, 500, 1000, 5000, and 10,000 μM. The plate was then left to stand for 20 minutes, and the fluorescence intensity of Gepri was observed over time. Fluorescence intensities at 520 nm under 420 nm excitation and 520 nm emission wavelengths under 485 nm excitation were measured, and the Normalized R485 / 420 nm ratio was calculated. Fluorescence excitation and emission measurements were performed using a multifunctional fluorescence microplate reader.

[0097] The experimental results are as follows Figure 4 As shown, 20 minutes after drug addition, the Normalized R485 / 420nm ratio of the Gepri protein stabilized, indicating that the probe's fluorescence signal had reached equilibrium after drug addition and exhibited stable response kinetics. This property validates the feasibility of Gepri as a pyruvate fluorescent probe for dynamic and quantitative detection, and its potential for application in living cells and at the subcellular level.

[0098] 3. Fluorescent probe specific detection

[0099] 90 μL of 1 μM Gepri protein solution and a separate fluorescent protein YFP solution were added to a black 96-well plate and incubated at 37°C for 10 minutes. Metabolites NAD, NADH, glucose, serine, glutamine, sodium glutamate, phosphoenolpyruvate, ATP, ADP, lactate, oxaloacetate, citric acid, α-ketoglutarate, sodium succinate, sodium malate, and sodium pyruvate solutions were added in sequence according to the working concentrations of 0, 10, 20, 50, 100, 200, 500, 1000, 5000, and 10000 μM. The fluorescence intensity of Gepri protein and YFP protein at 520 nm emission wavelength under 420 nm excitation and 520 nm emission wavelength under 485 nm excitation was measured respectively. The fluorescence intensity ratio R485 / 420 nm was calculated as the ratio of the fluorescence intensity at 485 nm to the fluorescence intensity at 420 nm, respectively, and was recorded as R. Gepri and R YFP Since the addition of excessively high concentrations of acidic or alkaline substances will destroy the protein conformation, thereby affecting the fluorescence intensity. In order to eliminate the effect of high or low pH on the fluorescence intensity, YFP was used as a non-responsive control protein to standardize the potential nonspecific effects and calculate R Gepri and R YFP The ratio before and after drug addition is normalized to be the Normalized R Gepri / R YFP The experimental results are as followsFigure 5 The results are shown in Figure 6.

[0100] The results are shown in Figure 6. Gepri The results are shown in Figure 6. YFP The results are shown in Figure 6. Gepri The results are shown in Figure 6. YFP The results are shown in Figure 6.

[0101] 4. Stability of the fluorescent probe

[0102] The environmental sensitivity of the purified pyruvate fluorescent probe was detected, which usually includes the effects of temperature and pH on the probe.

[0103] (1) 90 μL of 1 μM protein solution was added to a black 96-well plate, and incubated at 23, 26, 28, 30, 33, 35, and 37°C for 10 minutes. According to the working concentration of 0, 10, 20, 50, 100, 200, 500, 1000, 5000, and 10000 μM, 10 μL of sodium pyruvate solution was added, and the fluorescence intensity at 520 nm emission wavelength under 420 nm excitation and 520 nm emission wavelength under 485 nm excitation was measured, and the Normalized R485 / 420nm was measured.

[0104] The results are shown in Figure 7. Figure 6 The results are shown in Figure 7, which shows that the fluorescence response trend of Gepri probe to sodium pyruvate is consistent in the range of 23-37°C, and the Normalized R485 / 420nm value increases in a concentration-dependent manner with the increase of pyruvate concentration, and the difference between each temperature group is small. This indicates that the fluorescence response of Gepri probe to sodium pyruvate shows good thermal stability in the physiological temperature range of 23-37°C, which makes Gepri have the potential for stable application in various experimental and imaging conditions, especially suitable for real-time dynamic monitoring of pyruvate concentration changes in living cells and animal models.

[0105] (2) Take 90 μL of protein solution with a concentration of 1 μM into a full black 96-well plate, and incubate at 37°C for 10 minutes at pH 7.0, 7.2, 7.4, 7.6, 7.8, 8.0, respectively. Then, add 10000 μM of sodium pyruvate solution to measure the ratio of fluorescence intensity at 485 nm to that at 420 nm, and measure the Normalized R485 / 420nm.

[0106] The experimental results are shown in Table 1, and the image data shows that the Normalized R485 / 420nm value of Gepri protein in the pH range of 7.0-8.0 remains basically unchanged, and there is no significant difference between groups. The fluorescence ratio is stably responsive to the pyruvate signal, and no significant fluorescence drift or probe performance attenuation caused by changes in the acid-base degree of the solution is observed. This indicates that Gepri has good pH stability in the physiological pH range of cells in response to pyruvate fluorescence, and can be reliably applied to real-time detection of pyruvate in various microenvironment conditions of organisms, which helps to ensure its applicability and accuracy in different tissues, organelles or pathological states. Figure 7

[0107] Example 5 Subcellular organelle localization of the fluorescent probe

[0108] In this embodiment, different localization signal peptides are used to fuse with the pyruvate fluorescent probe, wherein SEQ ID NO: 1 (Cyto-GePri) corresponds to the cytoplasmic localization sequence provided in SEQ ID NO: 4, SEQ ID NO: 2 (Mito-GePri) corresponds to the mitochondrial localization sequence provided in SEQ ID NO: 5, and SEQ ID NO: 3 (Nuc-GePri) corresponds to the nuclear localization sequence provided in SEQ ID NO: 6, so as to localize the fluorescent probe to different organelles of bone marrow-derived macrophages (BMDM).

[0109] 1. Lentivirus packaging

[0110] Using pLVX as a carrier, the pyruvate fluorescent probe plasmid with subcellular organelle localization sequence and the auxiliary vector (psPAX2 and pMD2.G) are mixed according to a mass fraction ratio of 4:3:1, and an appropriate amount of Hieff After mixing the Liposomal Transfection Reagent transfection reagent, stand for 20 minutes. Add the formed liposome complex to the HEK293T cells, and discard the culture medium after 6 hours and replace it with complete culture medium without liposome complex. After 48 hours and 72 hours, collect the lentivirus supernatant, filter it through a 0.22 μm filter membrane, and store it at -80°C. ​

[0111] 2. Mouse bone marrow primary macrophage extraction

[0112] Sterile surgical equipment was sterilized and dried in advance, and C57BL / 6J mice were sacrificed by decapitation, soaked in 75% ethanol for 3-5 min and dried. The main muscles around the femur were stripped, the femur was rotated and removed, the main muscles around the tibia were removed, and the fibula was removed. The ethanol on the leg bone was washed with PBS, and the two ends of the femur and tibia were cut off with ophthalmic scissors. A 1 mL syringe was used to suck sterile cold PBS into a 50 mL test tube, and the bone marrow was filtered with a 70 μm cell screen. The filtered bone marrow suspension was centrifuged at 200xg, 4°C for 5 min. Resuspend with culture medium (10% FBS + DMEM + 20 ng / μL M-CSF), and after 12-16 hours of culture, centrifuge and resuspend the supernatant and plate, and continue to culture with M-CSF-containing medium. Partial medium replacement was performed on the third and fifth days, and BMDM was fully matured on the seventh day.

[0113] 3. Macrophage infection and confocal imaging

[0114] The lentivirus supernatant containing 8 μg / mL polybrene was co-incubated with mouse BMDM for infection, and was placed in a 37°C, 95% humidity and 5% CO2 incubator for culture to achieve stable expression of the fluorescent probe gene. After 48-72 h of co-incubation of lentivirus and BMDM for infection, the BMDM was washed with PBS and placed in HBSS solution for imaging using a confocal microscope. 405 nm and 488 nm tandem excitation were used, and > 505 nm emission light was collected. The genetically encoded pyruvate probe Gepri can be localized to subcellular organelles including cytoplasm, mitochondria, and nucleus by fusion with different specific localization signal peptides, thereby displaying fluorescence in different subcellular structures, as shown in Figure 8 .

[0115] The experimental results show that the genetically encoded pyruvate probe Gepri can be successfully expressed in BMDM, and by fusion with different subcellular localization signal peptides, the probe can be specifically localized in cytoplasm, mitochondria and nucleus. In the confocal image, the three localization specificities are clear, and there is no obvious cross contamination or non-specific background. This provides a powerful tool for further studying the pyruvate metabolic dynamics in different subcellular compartments, and significantly expands the application potential of the probe in the study of cell metabolic partitioning.

[0116] Example 6 Fluorescent quantitative PCR analysis of the relationship between ME2 and the polarization state of macrophages

[0117] After verifying that the probes can achieve subcellular localization expression, we further combined functional research to explore its application value in the metabolic regulation of macrophages. For this purpose, we focused on the key enzyme ME2 closely related to pyruvate metabolism and analyzed the influence of its expression change on the polarization state and function of macrophages.

[0118] 1. Detection of expression level of ME2 mRNA in BMDM in different polarization states

[0119] (1) Polarization induction of BMDM

[0120] A large number of mononuclear cells were contained in the bone marrow flushed from the tibia and femur of C57BL / 6J mice after being executed by cervical dislocation, and the supernatant was taken after overnight standing. After being induced in complete culture medium containing 20 ng / μL M-CSF for 7 days, the mature BMDM can be differentiated. 100 ng / μL of LPS and 20 ng / μL of IL-4 were added to the mature BMDM, respectively, and treated for 24 hours to induce BMDM to polarize to M1 or M2 type.

[0121] (2) RNA extraction: total RNA was extracted from BMDM according to the steps of RNAeasy extraction kit according to the instructions. The concentration of the obtained RNA was determined by ultramicro spectrophotometer.

[0122] (3) Reverse transcription: the present application adopts Evo M-MLV RT Master Mix kit to establish a 10 μL standard reverse transcription system for cDNA synthesis of RNA template. After concentration determination, the reverse transcription product is uniformly diluted to 100 ng / μL working concentration as the template for subsequent real-time fluorescent quantitative PCR reaction.

[0123] (4) Fluorescent quantitative PCR: SYBR Green Pro Taq HS Premix premix reagent system is adopted, and the mRNA expression level of pyruvate metabolism related enzyme ME2 is detected by fluorescent quantitative PCR technology, and the mRNA expression level is standardized by taking 18s RNA as the internal reference. The primer sequence is as follows:

[0124] 18S(mouse)-F: GTAACCCGTTGAACCCCATT;

[0125] 18S(mouse)-R: CCATCCAATCGGTAGTAGCG;

[0126] ME2(mouse)-F: GGCTAAGAGCTGTTACCACTCC;

[0127] ME2(mouse)-R: CGTAAACGCCATTCCCTTGTT.

[0128] ME2 mRNA expression levels in M1 and M2 type BMDMs were respectively as shown in Figure 9 A and Figure 9 B, indicating that the expression level of ME2 in M1 type BMDM was significantly lower than that in M0 type, suggesting that ME2 transcriptional activity was inhibited in the classical activation state; the expression level of ME2 in M2 type BMDM was significantly higher than that in M0 type, indicating that alternative activation state can induce up-regulation of ME2 expression. The results show that the polarization state of macrophages has a significant regulatory effect on the gene expression of ME2, suggesting that ME2 may be involved in the regulation of energy metabolism pathways corresponding to the functional state in the process of macrophage metabolic reprogramming. This finding lays a foundation for further exploring the relationship between ME2 and the metabolic regulation and immune function of macrophages, and provides theoretical support for its potential metabolic target.

[0129] 2. Effect of ME2 overexpression on BMDM polarization

[0130] (1) Overexpression of ME2 in BMDM

[0131] A large number of mononuclear cells were contained in the bone marrow flushed from the tibia and femur of C57BL / 6J mice after decapitation, and the supernatant was taken after overnight standing. After 7 days of induction in complete medium containing 20 ng / μL M-CSF, the mature BMDM was differentiated. The slow virus containing ME2 overexpression was packaged, and the slow virus supernatant containing 8 μg / mL polybrene was incubated with mouse BMDM for infection, and cultured in a incubator at 37°C, 95% humidity and 5% CO2. The BMDM was infected with ME2 overexpression mediated by slow virus, and the expression levels of M1 and M2 type macrophage marker genes were detected by fluorescence quantitative PCR. After 72 hours of infection of slow virus and BMDM co-incubation, the BMDM was washed with PBS.

[0132] (2) RNA extraction: total RNA was extracted from BMDM using RNAeasy extraction kit according to the instruction manual. The concentration of the obtained RNA was determined by ultramicro spectrophotometer.

[0133] (3) Reverse transcription: In this study, 10 μL standard reverse transcription system was established using Evo M-MLV RT Master Mix kit for cDNA synthesis of RNA template. After concentration determination, the reverse transcription product was uniformly diluted to 100 ng / μL working concentration, which was used as the template for subsequent real-time fluorescence quantitative PCR reaction.

[0134] (4) Fluorescent quantitative PCR: SYBR Green Pro Taq HS Premix premix reagent system was used to detect the mRNA expression levels of Ml and M2 type polarization markers of macrophages in ME2 overexpressed BMDM by fluorescent quantitative PCR technology, and 18s RNA was used as an internal reference for standardization. The primer sequences are as follows:

[0135] 18S(mouse)-F: GTAACCCGTTGAACCCCATT;

[0136] 18S(mouse)-R: CCATCCAATCGGTAGTAGCG;

[0137] IL-6(mouse)-F: AGTTGCCTTCTTGGGACTGA;

[0138] IL-6(mouse)-R: TCCACGATTTCCCAGAGAAC;

[0139] TNF-a(mouse)-F: AATGGCCTCCCTCTCATCAGTT;

[0140] TNF-a(mouse)-R: CGAATTTTGAGAAGATGATCTGAGTGT;

[0141] IL-10(mouse)-F: TGAATTCCCTGGGTGAGAAGCTGA;

[0142] IL-10(mouse)-R: TGGCCTTGTAGACACCTTGGTCTT;

[0143] Arg-1(mouse)-F: AGCTCCAAGCCAAAGTCCTTAGA;

[0144] Arg-1(mouse)-R: CCTCCTCGAGGCTGTCCTT.

[0145] As Figure 10 A and Figure 10As shown in B, after overexpression of ME2 in BMDM, the expression levels of M1-type related marker genes (TNF-a, IL-6) decreased significantly; at the same time, the expression levels of M2-type related marker genes (Arg1, IL-10) increased significantly. This shows that ME2 not only acts as an energy metabolism regulator in macrophages, but also has the potential to regulate the polarization direction of cells, suggesting that remodeling of the metabolic state can significantly affect the determination process of the immune phenotype. This finding reveals the intrinsic link between metabolism and immune phenotype, providing a theoretical basis for the application of targeting ME2 to regulate macrophage function in diseases.

[0146] Example 7 Effect of ME2 overexpression on myocardial tissue damage in a mouse myocardial infarction model

[0147] 1. Specific overexpression of ME2 in mice

[0148] To verify the effect of ME2 on the pathological process of myocardial infarction in the regulation of macrophage metabolism, ME2 expression in the myocardium was specifically overexpressed in vivo by adeno-associated virus mediation. The animals used in the experiment were 8-week-old C57BL / 6J male mice, which were randomly divided into ME2 overexpression group (ME2 OE) and control group (Con). Adeno-associated virus was injected through the tail vein, with a dose of 5 x 10 11 GC / only (GC refers to the number of genomic copies), the 1 / 4 of the tail vein was selected as the injection site, the needle was inserted into the tail vein at an angle of 15-30° and then advanced horizontally, the solution was slowly injected, and the tail color was observed to ensure no leakage. After injection, the needle was slowly withdrawn and the injection site was lightly pressed with a cotton ball to stop bleeding, and finally the mice were placed back in the cage to observe their condition.

[0149] 2. Construction of myocardial infarction model

[0150] One week after virus injection, the experimental animals were anesthetized by inhaling 3% isoflurane, the heart was exposed after left fourth intercostal thoracotomy, and 6-0 polypropylene suture was used to ligate the left anterior descending branch of the coronary artery to establish a myocardial infarction model. Postoperative observation was continued for 24 hours.

[0151] 3. TTC staining

[0152] To explore the function of ME2 in regulating the metabolic state of macrophages and affecting the degree of myocardial ischemic injury, the myocardial infarction area after 7 days of modeling was determined by TTC staining. The heart was frozen in a-20℃ refrigerator for 20 minutes, and then quickly transferred to a-80℃ refrigerator on ice and a section mold for 5 minutes. After taking out, the frozen heart tissue was placed on the section mold, quickly cut into 1mm thick sections, and placed in 1% red tetrazole solution in a 37℃ dark water bath for 30 minutes. The container was shaken slightly every 5 minutes to ensure complete staining. The heart sections were sorted according to the section order, and the images were obtained by scanning with a scanner. ImageJ image analysis system was used for quantitative evaluation. To reduce errors, this example strictly implemented the double-blind principle, all surgical operations and result analysis were completed independently by different researchers, and the operators were unaware of the genotypes and treatment schemes of the experimental animals.

[0153] The experimental results are shown in Figure 11 TTC staining was performed at 7 days after myocardial infarction to evaluate the myocardial infarction area, and compared with the control group (Con), the ME2 overexpression group (ME2 OE) mice showed a significantly reduced myocardial infarction area, which indicated that ME2 had a significant myocardial protective effect in the context of acute myocardial infarction. Considering that ME2 can regulate the pyruvate metabolism and polarization state of macrophages, it is speculated that its heart protection effect may be closely related to the transformation of macrophage inflammatory phenotype and metabolic state reprogramming. Therefore, the present application provides a new idea for intervention in the pathological process of myocardial infarction from the perspective of immunometabolism.

[0154] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. Those skilled in the art can easily make various modifications to these embodiments, and apply the general principles described herein to other embodiments without having to go through creative labor. Therefore, the present application is not limited to the above embodiments, and the improvements and modifications made by those skilled in the art without departing from the scope of the present application should be within the scope of protection of the present application.

[0155] The sequences involved in the present application are as follows:

[0156] SEQ ID NO: 1 (Cyto-GePri):

[0157] MALQKKLEELELDEQQRKRLEDLMALQKKLEELELDEQQRKRLEDLEFMAYSKIRQPKLSDVIEQQLEFLILEGTLRPGEKLPPERELAKQFDVSRPSLREAIQRLEAKGLLLRRQGGGTFVQSSLWQSFSDPLVELLSDHPESQYDLLETRHALEGIAAYYAALRSTDEDKERIRELHHAIELAQQSGDLDAESNAVLQYQIAVTEAAHNVVLLHLLRCMEPMLAQNVRQNFELLYSRRGGYNSDNVYIMADKQKNGIKANFKIRHNVEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSFQSVLSKDPNEKRDHMVLLEFVTAAGITLGMDELYNVDGGSGGTGSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKLICTTGKLPVPWPTLVTTLGYGLKCFARYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIGFKEDGNILGHKLEYNGTGEMLPLVSSHRTRIFEAIMAGKPEEAREASHRHLAFIEEILLDRSREESRRERSLRRLEQRKN-

[0158] SEQ ID NO: 2 (Mito-GePri):

[0159] MSVLTPLLLRGLTGSARRLPVPRAKIHSLGDPMSVLTPLLLRGLTGSARRLPVPRAKIHSLGDPKPGMAYSKIRQPKLSDVIEQQLEFLILEGTLRPGEKLPPERELAKQFDVSRPSLREAIQRLEAKGLLLRRQGGGTFVQSSLWQSFSDPLVELLSDHPESQYDLLETRHALEGIAAYYAALRSTDEDKERIRELHHAIELAQQSGDLDAESNAVLQYQIAVTEAAHNVVLLHLLRCMEPMLAQNVRQNFELLYSRRGGYNSDNVYIMADKQKNGIKANFKIRHNVEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSFQSVLSKDPNEKRDHMVLLEFVTAAGITLGMDELYNVDGGSGGTGSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKLICTTGKLPVPWPTLVTTLGYGLKCFARYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIGFKEDGNILGHKLEYNGTGEMLPLVSSHRTRIFEAIMAGKPEEAREASHRHLAFIEEILLDRSREESRRERSLRRLEQRKN-

[0160] SEQ ID NO: 3 (Nuc-GePri):

[0161] MAYSKIRQPKLSDVIEQQLEFLILEGTLRPGEKLPPERELAKQFDVSRPSLREAIQRLEAKGLLLRRQGGGTFVQSSLWQSFSDPLVELLSDHPESQYDLLETRHALEGIAAYYAALRSTDEDKERIRELHHAIELAQQSGDLDAESNAVLQYQIAVTEAAHNVVLLHLLRCMEPMLAQNVRQNFELLYSRRGGYNSDNVYIMADKQKNGIKANFKIRHNVEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSFQSVLSKDPNEKRDHMVLLEFVTAAGITLGMDELYNVDGGSGGTGSKGEELFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKLICTTGKLPVPWPTLVTTLGYGLKCFARYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIGFKEDGNILGHKLEYNGTGEMLPLVSSHRTRIFEAIMAGKPEEAREASHRHLAFIEEILLDRSREESRRERSLRRLEQRKNGSDPKKKRKVDPKKKRKVDPKKKRKVDPKKKRKV-

[0162] SEQ ID NO: 4 (cytoplasmic localization sequence):

[0163] MALQKKLEELELDEQQRKRLEDLMALQKKLEELELDEQQRKRLEDL

[0164] SEQ ID NO: 5 (mitochondrial localization sequence):

[0165] MSVLTPLLLRGLTGSARRLPVPRAKIHSLGDPMSVLTPLLLRGLTGSARRLPVPRAKIHSLGDPK

[0166] SEQ ID NO: 6 (nuclear localization sequence):

[0167] DPKKKRKVDPKKKRKVDPKKKRKVDPKKKRKV

[0168] SEQ ID NO: 7 (fluorescent protein YFP gene sequence):

[0169] TACAACAGCGACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCACAACGTCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCTTCCAGTCCGTCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAACGTGGATGGCGGTAGCGGTGGCACCGGCAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGCTGATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTCGGCTACGGCCTGAAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGGCTTCAAGGAGGACGGCAACATC CTTGGGGCACAAGCTGGAGTACAAC

[0170] SEQ ID NO: 8 (pyruvate binding protein Pd gene sequence):

[0171] ATGGCATATAGCAAAATTCGGCAGCCCAAACTGAGCGATGTGATTGAGCAGCAGCTGGAGTTTCTGATTCTGGAAGGCACCCTGAGACCTGGAGAGAAACTGCCCCCTGAGCGCGAACTCGCCAAGCAGTTCGACGTGAGTCGACCATCACTGAGGGAGGCTATCCAGAGGCTGGAAGCAAAGGGACTGCTCCTGAGGAGACAGGGAGGAGGGACTTTCGTGCAGAGCTCCCTGTGGCAGAGCTTCAGCGACCCCCTGGTCGAGCTCCTGTCTGACCACCCAGAAAGTCAGTACGATCTCCTGGAGACAAGACATGCTCTGGAAGGCATCGCCGCTTACTATGCAGCCCTGCGGTCCACTGACGAGGATAAGGAACGCATCCGAGAGCTGCACCATGCCATTGAACTCGCTCAGCAGTCAGGAGACCTGGATGCAGAGAGCAACGCCGTGCTGCAATACCAGATTGCAGTCACCGAGGCTGCACACAATGTGGTCCTCCTGCATCTCCTGAGGTGCATGGAGCCAATGCTGGCCCAGAACGTGAGACAGAATTTTGAGCTCCTGTATTCTCGACGAGAAATGCTACCACTAGTATCTAGTCACAGGACCAGAATCTTTGAGGCAATTATGGCCGGAAAGCCCGAGGAAGCTAGAGAAGCAAGTCACCGGCATCTGGCCTTCATCGAGGAAATTCTGCTCGACCGGAGCCGCGAGGAATCCCGAAGGGAGCGCAGCCTGAGACGACTCGAACAGCGAAAGAACTGA

[0172] SEQ ID NO: 9 (Gene sequence of Gepri):

[0173]

Claims

1. A genetically encoded pyruvate fluorescent probe, characterized in that The fluorescent probe is a fusion polypeptide comprising a pyruvate-sensitive polypeptide fragment and a subcellular localization signal peptide fragment; the fluorescent probe is a pyruvate-responsive polypeptide chain having a sequence as shown in SEQ ID NO.1, SEQ ID NO.2 or SEQ ID NO.3 or a functional variant thereof, or a sequence having 35%-99% sequence identity therewith; The pyruvate-sensitive polypeptide fragment includes a fluorescent active polypeptide fragment; the fluorescent active polypeptide fragment is used to emit a detectable fluorescent signal; The subcellular localization signal peptide fragment is arranged at the N-terminus and / or the C-terminus of the pyruvate sensitive polypeptide fragment and is used to locate the genetically encoded pyruvate probe in the subcellular organelles of the cell.

2. A nucleic acid molecule, characterized in that The invention relates to a nucleic acid molecule encoding the genetically encoded pyruvate fluorescent probe according to claim 1, or a complementary nucleic acid molecule thereof.

3. A recombinant expression vector, characterized in that: Comprising the nucleic acid molecule according to claim 2, and an expression vector; the expression vector is selected from any one of a prokaryotic expression vector, a eukaryotic expression vector or a viral vector.

4. A recombinant expression transformant, characterized in that: Comprising the recombinant expression vector according to claim 3.

5. A method for preparing a genetically encoded pyruvate fluorescent probe as claimed in claim 1, characterized in that: The following steps are involved: (1) constructing a recombinant expression vector containing the nucleic acid molecule according to claim 2; (2) transferring the recombinant expression vector into a host cell to construct a recombinant expression transformant; and culturing the recombinant expression transformant; (3) Isolate and obtain the genetically encoded pyruvate fluorescent probe according to claim 1.

6. Use of the genetically encoded pyruvate fluorescent probe according to claim 1 in detecting pyruvate content, characterized in that: The genetically encoded pyruvate fluorescent probe serves as a fluorescent detection indicator.

7. The use according to claim 6, characterized in that In the application, the method for detecting the pyruvic acid content comprises the following steps: (1) contacting the genetically encoded pyruvate fluorescent probe with a sample to be detected; (2) Measuring the change in fluorescence intensity of the sample to be tested before and after contact with the genetically encoded pyruvate fluorescent probe, and comparing it with the change in fluorescence intensity of the pyruvate standard to obtain the content of pyruvate in the sample to be tested.

8. A detection kit for detecting pyruvic acid, characterized in that: The kit comprises any one or a combination of the following: (1) The genetically encoded pyruvate fluorescent probe according to claim 1; (2) The nucleic acid molecule according to claim 2; (3) the recombinant expression vector according to claim 3; (4) The recombinant expression transformant according to claim 4.

9. A screening system targeting the pyruvate metabolic pathway in the cytoplasm, mitochondria and nucleus of primary mouse bone marrow macrophages, characterized in that: The screening system comprises the genetically encoded pyruvate fluorescent probe according to claim 1 and is used for studying metabolic mechanisms or metabolism-related compounds.

10. A high-throughput screening method for compounds targeting pyruvate in the cytoplasm, mitochondria and nucleus of primary mouse bone marrow macrophages, characterized in that: Based on the screening system according to claim 9, the screening method comprises the following steps: (1) contacting a system containing the genetically encoded pyruvate fluorescent probe according to claim 1 with a test compound; (2) Detecting the fluorescence changes of the system and screening compounds that affect the changes in pyruvate content based on the fluorescence changes.

Images