Formate dehydrogenase mutants and their use in catalyzing synthesis of d-mannitol
By performing multi-site mutations on formate dehydrogenase and co-expressing it with mannitol dehydrogenase, a highly efficient coenzyme cycle system was constructed, which solved the problem of insufficient catalytic efficiency of existing formate dehydrogenases and achieved the effect of highly efficient catalytic synthesis of D-mannitol.
Patent Information
- Application Number
- CN202511284707.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-10
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-09-10
AI Technical Summary
Existing formate dehydrogenases and their mutants generally suffer from low enzyme activity and insufficient catalytic efficiency, making it difficult to meet the efficiency and cost requirements for industrial production of D-mannitol and limiting the large-scale application of enzymatic synthesis.
By directing the evolution of formate dehydrogenase from Hansenula polymorpha and performing multi-site mutations, a formate dehydrogenase mutant with high enzyme activity and high catalytic efficiency was obtained. This mutant was then co-expressed with mannitol dehydrogenase to construct an efficient coenzyme cycle system for catalyzing the synthesis of D-mannitol.
It significantly improved the efficiency of coenzyme cycle, and the yield of D-mannitol could reach more than 140g/L within 15 hours, thus improving the efficiency of D-mannitol production from fructose.
Smart Images

Figure CN120796210B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of bioengineering technology, and in particular to a formate dehydrogenase mutant and its application in the catalytic synthesis of D-mannitol. Background Technology
[0002] The information disclosed in the background section of this invention is intended only to enhance the understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.
[0003] The molecular formula of D-mannitol is C6H. 14 O6, with the general structural formula HOCH2(CHOH)4CH2OH, has a predominantly D-type chiral carbon configuration. As an important functional sugar alcohol, D-mannitol has irreplaceable application value in the fields of medicine and food due to its unique physicochemical properties and physiological activities.
[0004] Currently, the main methods for synthesizing D-mannitol include plant extraction, chemical synthesis, and enzymatic methods. Among these, plant extraction and chemical synthesis methods suffer from problems such as high energy consumption, complex purification, and severe pollution. In contrast, enzymatic methods, using fructose as a raw material and synthesized in one step by mannitol dehydrogenase, have advantages such as mild conditions, environmental friendliness, and high specificity, and have become the mainstream synthesis method.
[0005] Mannitol dehydrogenase, an NADH (reduced nicotinamide adenine dinucleotide)-dependent oxidoreductase, requires the addition of an exogenous coenzyme for its catalytic reaction, resulting in high production costs. Therefore, constructing an efficient coenzyme cycling system is crucial for industrial applications. Among existing coenzyme cycling systems, the glucose dehydrogenase-glucose system has high cycling efficiency, but it generates the byproduct gluconic acid, interfering with product purification. The formate dehydrogenase-formic acid system has greater application potential due to the absence of byproduct generation, but its low coenzyme cycling efficiency limits its practical application. However, currently reported formate dehydrogenases and their mutants generally suffer from low enzyme activity and insufficient catalytic efficiency, failing to meet the efficiency and cost requirements of industrial production, becoming a key bottleneck restricting the large-scale application of D-mannitol enzymatic synthesis. Summary of the Invention
[0006] In view of this, the present invention provides a formate dehydrogenase mutant and its application in the synthesis of D-mannitol. The present invention is based on the theory of directed evolution and obtains a formate dehydrogenase mutant with high enzyme activity and high catalytic efficiency through simultaneous mutation at multiple sites. It can be used as a coenzyme to efficiently catalyze the synthesis of D-mannitol together with mannitol dehydrogenase.
[0007] In a first aspect, the present invention provides a formate dehydrogenase mutant, wherein the amino acid sequence of the wild-type formate dehydrogenase, as shown in SEQ ID NO.2, is mutated as follows: glutamic acid at position 18 is mutated to proline, asparagine at position 57 is mutated to glutamic acid, histidine at position 70 is mutated to tryptophan, serine at position 235 is mutated to threonine, and valine at position 316 is mutated to threonine.
[0008] In a second aspect, the present invention provides a nucleic acid molecule that encodes the formate dehydrogenase mutant described in the first aspect.
[0009] In this invention, the nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA or hnRNA.
[0010] Thirdly, the present invention provides a biomaterial containing the nucleic acid molecules described in the second aspect, wherein the biomaterial includes recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, or engineered bacteria.
[0011] In one or more embodiments of the present invention, the plasmid vector is the pET-duet plasmid.
[0012] Fourthly, the present invention provides a recombinant microorganism, which is constructed by introducing the nucleic acid molecules described in the second aspect into Escherichia coli via plasmids or by integrating them into the chromosome of Escherichia coli through genetic engineering.
[0013] In one or more embodiments of the present invention, the *E. coli* is *Escherichia coli*. E. coli BL21(DE3).
[0014] Fifthly, the present invention provides the application of the formate dehydrogenase mutant described in the first aspect, the nucleic acid molecule described in the second aspect, the biomaterial described in the third aspect, or the recombinant microorganism described in the fourth aspect in the catalytic synthesis of D-mannitol.
[0015] Sixthly, the present invention provides a method for the catalytic synthesis of D-mannitol, comprising:
[0016] The formate dehydrogenase mutant described in the first aspect is introduced together with mannitol dehydrogenase or mannitol dehydrogenase mutant into a host bacterium to construct a genetically engineered bacterium. The genetically engineered bacterium is induced and cultured to obtain wet cells. The wet cells or crude enzyme solution extracted by ultrasonic disruption of the wet cells are used as catalysts, fructose is used as substrate and sodium formate is used as co-substrate, and D-mannitol is obtained by reaction in a liquid phase environment.
[0017] Preferably, the nucleotide sequence of the mannitol dehydrogenase mutant is shown in SEQ ID NO. 37.
[0018] Preferably, the solvent in the liquid phase environment is a phosphate buffer solution with a pH of 6.8 to 7.2.
[0019] Preferably, the reaction temperature is 32~38℃ and the reaction time is 12~20h.
[0020] Preferably, the amount of wet bacterial cells in the catalyst is 15-30 g / L, more preferably 20-30 g / L; the final concentration of fructose is 100-180 g / L, more preferably 130-170 g / L; the final concentration of sodium formate is 50-80 g / L, more preferably 60-75 g / L; and the liquid phase environment also contains zinc sulfate, with a final concentration of 0.05-3 mM.
[0021] Compared with the prior art, the present invention has achieved the following beneficial effects:
[0022] This invention utilizes the method of processing yeast derived from Hansenula polymorpha (Hansenula polymorpha) Ogataea polymorpha Simultaneous mutations at multiple amino acid sites (18th, 57th, 70th, 235th, and 316th) of the formate dehydrogenase OpFDH yielded a formate dehydrogenase mutant, significantly improving the coenzyme cycle efficiency and consequently increasing the efficiency of mannitol dehydrogenase in producing D-mannitol from fructose. When genetically engineered bacteria co-expressing this formate dehydrogenase mutant and the mannitol dehydrogenase mutant were used to catalyze the production of D-mannitol from 150 g / L of fructose, the yield of D-mannitol could reach over 140 g / L within 15 h. Attached Figure Description
[0023] The accompanying drawings, which form part of this specification, are used to provide a further understanding of the invention. The illustrative embodiments and descriptions of the invention are used to explain the invention and do not constitute an undue limitation thereof. Obviously, those skilled in the art can obtain other drawings based on these drawings without any inventive effort.
[0024] Figure 1 This is a graph showing the D-mannitol yield at different reaction times in Example 6 of the present invention. Detailed Implementation
[0025] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0026] The technical solution of the present invention will be further described below with reference to specific embodiments. The present invention does not impose any special restrictions on the source of reagents used in the following embodiments; commercially available products well known to those skilled in the art can be used.
[0027] The culture medium formulations used in the following examples are as follows:
[0028] LB medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, water as solvent, pH 7.4.
[0029] LB agar plates: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agar 18 g / L, solvent: water, pH 7.4.
[0030] The concentration of the product D-mannitol was determined by high performance liquid chromatography (HPLC). The chromatographic conditions were as follows: calcium cation exchange column; water as the mobile phase; 10 μL injection volume; differential detector; detection time of 25 min; flow rate of 0.6 mL / min; and column temperature of 80℃.
[0031] Example 1
[0032] This embodiment provides the construction of expression vectors and engineered bacteria.
[0033] Through gene library mining, a gene from *Hansenula polymorpha* was screened. Ogataea polymorpha The formate dehydrogenase OpFDH, NCBI accession number XP_018212858.1, was synthesized in its entirety by Nanjing GenScript Biotech Co., Ltd. The nucleotide sequence is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.
[0034] SEQ ID NO. 1 is as follows:
[0035]
[0036] SEQ ID NO. 2 is as follows:
[0037] MKVVLVLYDAGKHAQDEERLYGCTENALGIRDWLEKQGHELVVTSDKEGQNSVLEKNISDADVIISTPFHPAYITKERIDKAKKLKLLVVAGVGSDHIDLDYINQSGRDISVLEVTGSNVVSVAEHVVMTMLVLVRNFVPAHEQIISGGWNVAEIAKDSFDIEGKVIATIGAGRIGYRVLE RLVAFNPKELLYYDYQSLSKEAEEKVGARRVHDIKELVAQADIVTINCPLHAGSKGLVNAELLKHFKKGAWLVNTARGAICVAEDVAAAVKSGQLRGYGGDVWFPQPAPKDHPWRSMANKYGAGNAMTPHYSGSVIDAQVRYAQGTKNILESFFTQKFDYRPQDIILLNGKYKTKSYGADK.
[0038] Primers F1, R1, F2, and R2 were designed based on the nucleotide sequence shown in SEQ ID NO. 1 and the pET-duet vector sequence. The nucleotide sequence of F1 is shown in SEQ ID NO. 3, the nucleotide sequence of R1 is shown in SEQ ID NO. 4, the nucleotide sequence of F2 is shown in SEQ ID NO. 5, and the nucleotide sequence of R2 is shown in SEQ ID NO. 6. OpFDH was cloned into the first multiple cloning site of pET-duet.
[0039] F1: 5'-ctttaagaaggagatataccATGAAAGTAGTTCTAGTCTTATATGATGCTG-3';
[0040] R1: 5'-cttaagcattatgcggccgcTTACTTGTCCGCACCATAGCTCT-3';
[0041] F2: 5'-GCGGCCGCATAATGCTTA-3';
[0042] R2: 5'- GGTATATCTCCTTCTTAAAGTTAAACAAAAT-3'.
[0043] Using pET-duet plasmid as an expression vector, Escherichia coli was constructed E. coli BL21(DE3) / pETduet-OpFDH.
[0044] Construction of the expression vector: Under the initiation of primers F1 / R1 and F2 / R2, the target gene was amplified using high-fidelity Pfu DNA polymerase to obtain the formate dehydrogenase gene sequence with homologous arms. Using pET-duet plasmid as a template, the linearized vector sequence was amplified using high-fidelity Pfu DNA polymerase to obtain the linearized vector sequence. Homologous recombination was then performed between the target gene and the linearized vector using homologous recombination enzyme to construct the plasmid pETduet-OpFDH.
[0045] Construction of recombinant Escherichia coli: First, bacteria stored at -80℃... E. coli BL21(DE3) competent cells were incubated at 0°C on ice for 10 min, then 5 µL of the recombinant product was added in a clean bench, incubated at 0°C on ice for 30 min, heat-shocked in a 42°C water bath for 90 s, incubated at 0°C on ice for 2 min, and then 600 µL of LB medium was added. The cells were then cultured at 37°C and 200 rpm for 1 h on a shaker. The culture was then plated on LB agar plates containing 50 μg / mL kanamycin and cultured at 37°C for 10 h. Clones were randomly selected, plasmids were extracted, and sequenced for identification. Recombinant *E. coli* containing the recombinant plasmid expression were screened for these cells. E. coli BL21(DE3) / pETduet-OpFDH.
[0046] Example 2
[0047] This embodiment provides the induced expression of formate dehydrogenase.
[0048] Wet bacterial cells containing the formate dehydrogenase gene: The recombinant Escherichia coli obtained in Example 1 were used respectively. E. coli BL21(DE3) / pETduet-OpFDH was inoculated into LB liquid medium containing 50 μg / mL ampicillin resistance and cultured at 37°C and 200 rpm for 12 h. Then, it was inoculated at a 1% (v / v) inoculation rate into fresh LB liquid medium containing 50 μg / mL ampicillin resistance and cultured at 37°C and 200 rpm until the bacterial OD reached the target cell count. 600 When the concentration reaches 0.6-0.8, add isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.1 mM. Induce culture at 25°C for 16 h, then centrifuge at 4°C and 8000 rpm for 20 min. Discard the supernatant and collect the precipitate to obtain the recombinant strain containing formate dehydrogenase. E. coli Wet cells of BL21(DE3) / pETduet-OpFDH.
[0049] Example 3
[0050] This embodiment provides the establishment of a formate dehydrogenase gene mutation library.
[0051] This embodiment is constructed based on embodiment 2. E. coli BL21(DE3) / pETduet-OpFDH was the starting strain, which was modified using the theory of directed evolution.
[0052] Based on the software calculations, site-directed mutagenesis was performed at sites 8, 10, 11, 18, 50, 57, 70, 133, 198, 213, 235, 271, 304, 316, and 337.
[0053] Primer design is shown in Table 1.
[0054] Table 1. Primer design for site-directed mutagenesis of formate dehydrogenase
[0055]
[0056] The mutant PCR system (100 μL) consisted of: 25 μL 2×PhantaMax buffer, 1 μL dNTPs, 1 μL each of the upper and lower mutant primers, 1 μL template (starting strain), 0.5 μL Pfu DNA polymerase, and ddH2O added to a final volume of 50 μL. The PCR conditions were: 95℃ pre-denaturation for 3 min, followed by 30 cycles: 95℃ for 15 s, 60℃ for 15 s, 72℃ for 4 min, and a final extension at 72℃ for 5 min. PCR results were verified by DNA agarose gel electrophoresis. The PCR product was digested with DpnI enzyme at 37℃ and 200 rpm for 1 hour, followed by inactivation at 65℃ for 1 minute. The PCR product was then heat-transformed into *E. coli*. E. coli BL21(DE3) was activated, incubated at 37°C and 200 rpm for 1 hour, and then spread onto LB plates containing 50 μg / mL ampicillin resistance. The plates were incubated upside down at 37°C overnight.
[0057] Example 4
[0058] This embodiment provides a screening of a gene mutation library of formate dehydrogenase.
[0059] Single colonies were picked from the plates obtained in Example 3 and inoculated into LB liquid medium containing 50 μg / mL ampicillin resistance. The culture was incubated at 37°C and 200 rpm for 12 h. The culture was preserved and sent to a sequencing company for sequencing verification. After successful sequencing verification, the preserved culture was inoculated at a rate of 0.2% (v / v) into LB liquid medium containing 50 μg / mL ampicillin resistance and incubated at 37°C and 200 rpm for 12 h. Then, at a rate of 1% (v / v) inoculated into LB liquid medium containing 50 μg / mL ampicillin resistance and incubated at 37°C and 200 rpm until the bacterial OD reached the target cell count.600 When the concentration reaches 0.6~0.8, add isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 0.1mM. After induction culture at 25℃ for 16 h, centrifuge at 4℃ and 8000 rpm for 20 min, discard the supernatant, collect the precipitate, and obtain the wet bacterial cells containing the formate dehydrogenase gene mutant library.
[0060] 1. Initial screening
[0061] Preparation of reaction solution (200 μL): final concentration 50 mM substrate NAD + Nicotinamide adenine dinucleotide (NADH), sodium formate at a final concentration of 60 mM, catalyst dosage (based on total wet cell weight) of 5 g / L, and phosphate buffer solution at pH 6.5 were used as the reaction medium. The reaction was carried out in a reactor at 35℃ and 500 rpm for 1 hour. After the reaction, 20 μL of the final sample was taken, diluted 20 times, and the absorbance was measured under an ELISA reader at 340 nm (NADH has an absorption peak at 340 nm). The results are shown in Table 2.
[0062] Table 2 Initial screening reaction results
[0063]
[0064] As can be seen from Table 2, the absorbance of mutant strains E18P, N57E, H70W, S235T, and V316T is higher than that of the parent strain. Therefore, these mutant strains were selected for subsequent rescreening.
[0065] 2. Secondary screening
[0066] The strains obtained from the initial screening were subjected to secondary screening. The resulting mutant combinations were sent to a sequencing company for sequencing verification. After successful sequencing verification, viability verification was performed. The secondary screening reaction solution (10 mL) contained a final concentration of 50 mM NAD substrate. + Sodium formate was added to a final concentration of 60 mM, and the catalyst dosage (based on the total weight of wet bacterial cells) was 5 g / L. Phosphate buffer solution at pH 6.5 was used as the reaction medium. The reaction was carried out in a reactor at 35℃ and 500 rpm for 1 hour. After the reaction, 20 μL of the final sample was taken, diluted 20 times, and the absorbance was measured using a microplate reader at 340 nm. The results are shown in Table 3.
[0067] Table 3 Results of the secondary screening reaction
[0068]
[0069] As can be seen from the results in Table 3, the mutant with the mutation site E18P+N57E+H70W+S235T+V316T has the highest activity.
[0070] Example 5
[0071] This embodiment provides the construction of a strain co-expressing mannitol dehydrogenase mutant and formate dehydrogenase mutant.
[0072] Mannitol dehydrogenase is an NADH-dependent enzyme. To improve catalytic efficiency and economic benefits, this embodiment constructs a formate dehydrogenase-coenzyme cycle system. The mannitol dehydrogenase used in this embodiment is derived from *Westernella paramecium* (…). Weissella paramesenteroides The mannitol dehydrogenase WpMDH, NCBI accession number WP_131474179.1, was subjected to site-directed mutagenesis to obtain a mannitol dehydrogenase mutant. The nucleotide sequence of the mannitol dehydrogenase mutant is shown in SEQ ID NO. 37.
[0073] SEQ ID NO. 37:
[0074]
[0075] Primers F3, R3, F4, and R4 were designed based on the nucleotide sequence shown in SEQ ID NO. 37 and the pETduet-OpFDH-E18P-N57E-H70W-S235T-V316T vector sequence. The nucleotide sequence of F3 is shown in SEQ ID NO. 38, the nucleotide sequence of R3 is shown in SEQ ID NO. 39, the nucleotide sequence of F4 is shown in SEQ ID NO. 40, and the nucleotide sequence of R4 is shown in SEQ ID NO. 41. WpMDH-E2K-E176Q-I195R-V325K was cloned into the second multiple cloning site of pETduet-OpFDH-E18P-N57E-H70W-S235T-V316T.
[0076] F3: 5'-tataagaaggagatatacatATGAAAGCTCTAGTATTAACAGGAATAAAA-3';
[0077] R3: 5'-gtttctttaccagactcgagTTACGCCTCTTCACCACCCA-3';
[0078] F4: 5'-CTCGAGTCTGGTAAAGAAACCGC-3';
[0079] R4: 5' - ATGTATATCTCCTTCTTATACTTAACTAATATACTAAGA -3'.
[0080] Using pET-duet plasmid as the expression vector, the co-expression plasmid pETduet-OpFDH-E18P-N57E-H70W-S235T-V316T-WpMDH-E2K-E176Q-I195R-V325K was constructed.
[0081] The transformation process was performed as described in Example 1, and the results were verified by sequencing by a sequencing company, yielding the desired strain. E. coli BL21(DE3) / pETduet-OpFDH-E18P-N57E-H70W-S235T-V316T-WpMDH-E2K-E176Q-I195R-V325K.
[0082] To obtain a co-expression strain with higher catalytic efficiency, and as a control group, WpMDH-E2K-E176Q-I195R-V325K was placed at the first multiple cloning site of pETduet, and OpFDH-E18P-N57E-H70W-S235T-V316T was placed at the second multiple cloning site of pETduet. The specific construction process refers to the construction procedure of the pETduet-OpFDH-E18P-N57E-H70W-S235T-V316T-WpMDH-E2K-E176Q-I195R-V325K plasmid. The obtained strain was verified by transformation and sequencing companies. E. coli BL21(DE3) / pETduet-WpMDH-E2K-E176Q-I195R-V325K-OpFDH-E18P-N57E-H70W-S235T-V316T.
[0083] The fermentation process was carried out according to Example 4. Two co-expressed strains were obtained for activity comparison. The reaction solution was prepared with a final concentration of 150 g / L fructose substrate, a final concentration of 68 g / L sodium formate, a final concentration of 1 mM zinc sulfate, and a catalyst concentration (based on total wet cell weight) of 20 g / L. Phosphate buffer (pH=7) was used as the reaction medium. The reaction was carried out at 35℃ and 500 rpm for 1 hour. After the reaction, 20 μL of the final sample was taken, diluted 10-fold, filtered through a 0.22 μm filter membrane, and analyzed by HPLC. The results are shown in Table 4. E. coli BL21(DE3) / pETduet-WpMDH-E2K-E176Q-I195R-V325K-OpFDH-E18P-N57E-H70W-S235T-V316T has better vitality.
[0084] Table 4 Enzyme activity detection results
[0085]
[0086] Example 6
[0087] This embodiment provides the application of the co-expression strain of Example 5 in the catalytic synthesis of D-mannitol.
[0088] The co-expression strain from Example 5 E. coliBL21(DE3) / pETduet-WpMDH-E2K-E176Q-I195R-V325K-OpFDH-E18P-N57E-H70W-S235T-V316T was inoculated into LB liquid medium containing 50 μg / mL ampicillin and cultured at 37°C for 9 hours. This seed culture was then inoculated into a 5 L fermenter containing 3 L of fermentation medium at a volume concentration of 3.5%. After culturing at 37°C and 500 rpm for approximately 4 hours, the desired bacterial density (OD) was achieved at 6-8. The fermenter temperature was then lowered to 25°C, and lactose (10 g / L) was added as an inducer. The culture was then continued at 25°C and 500 rpm for 12 hours to obtain the fermentation broth. The fermentation broth was centrifuged at 8000 rpm for 10 min to obtain the co-expressed strain. E. coli Wet cells of BL21(DE3) / pETduet-WpMDH-E2K-E176Q-I195R-V325K-OpFDH-E18P-N57E-H70W-S235T-V316T.
[0089] The fermentation medium in this embodiment consists of the following components: 45g tryptone, 36g yeast extract, 30g sodium chloride, 4.08g potassium dihydrogen phosphate, 45g glycerol, 6.84g dipotassium hydrogen phosphate trihydrate, 15g ammonium sulfate, 1.125g magnesium sulfate, and 3g defoamer. Distilled water is added to a final volume of 3 L for dissolution.
[0090] catalyst E.coli The dosage of BL21(DE3) / pETduet-WpMDH-E2K-E176Q-I195R-V325K-OpFDH-E18P-N57E-H70W-S235T-V316T (based on total wet cell weight) was 25 g / L, the final fructose concentration was 150 g / L, the final sodium formate concentration was 68 g / L, and the final zinc sulfate concentration was 1 mM. Phosphate buffer solution at pH 7 was used as the reaction medium, and the total reaction volume was 1 L. Reaction conditions: 35℃, 300 rpm. 20 μL samples were taken at reaction times of 3 h, 6 h, 9 h, 12 h, 15 h, and 16 h, diluted 20-fold, filtered through a 0.22 μm filter membrane, and analyzed by HPLC. The results are as follows: Figure 1 As shown, the concentration of D-mannitol was 140.3 g / L when the reaction time was 15 h.
[0091] Comparative Example
[0092] This comparative example refers to the method in Example 5 to construct polymorphic Hansenula yeast ( Ogataea polymorphaThe strain co-expressing formate dehydrogenase OpFDH (nucleotide sequence shown in SEQ ID NO. 1) and mannitol dehydrogenase mutants. E.coli BL21(DE3) / pETduet-WpMDH-E2K-E176Q-I195R-V325K-OpFDH, and referring to Example 6, construct the co-expression strain. E.coli BL21(DE3) / pETduet-WpMDH-E2K-E176Q-I195R-V325K-OpFDH was used to catalyze the synthesis of D-mannitol under the same reaction conditions as in Example 6. HPLC analysis showed that the concentration of D-mannitol was 72.8 g / L at a reaction time of 15 h.
[0093] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. A formate dehydrogenase mutant, characterized in that, The wild-type formate dehydrogenase, as shown in SEQ ID NO.2, has the following mutations: glutamic acid at position 18 is replaced by proline, asparagine at position 57 is replaced by glutamic acid, histidine at position 70 is replaced by tryptophan, serine at position 235 is replaced by threonine, and valine at position 316 is replaced by threonine.
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the formate dehydrogenase mutant of claim 1.
3. A biomaterial containing the nucleic acid molecule of claim 2, characterized in that, The biomaterials include recombinant DNA, expression cassettes, plasmid vectors, viral vectors, or engineered bacteria.
4. A recombinant microorganism, characterized in that, The recombinant microorganism is constructed by introducing the nucleic acid molecule described in claim 2 into Escherichia coli via plasmid or by integrating it into the chromosome of Escherichia coli through genetic engineering.
5. The application of the formate dehydrogenase mutant of claim 1, the nucleic acid molecule of claim 2, the biomaterial of claim 3, or the recombinant microorganism of claim 4 in the catalytic synthesis of D-mannitol.
6. A method for the catalytic synthesis of D-mannitol, characterized in that, include: The formate dehydrogenase mutant of claim 1, together with mannitol dehydrogenase or mannitol dehydrogenase mutant, is introduced into a host bacterium to construct a genetically engineered bacterium. The genetically engineered bacterium is induced and cultured to obtain wet cells. The wet cells or crude enzyme solution extracted by ultrasonic disruption of the wet cells are used as catalysts, with fructose as substrate and sodium formate as co-substrate, to react in a liquid phase environment to obtain D-mannitol.
7. The method as described in claim 6, characterized in that, The nucleotide sequence of the mannitol dehydrogenase mutant is shown in SEQ ID NO.
37.
8. The method as described in claim 6, characterized in that, The solvent in the liquid environment is a phosphate buffer solution with a pH of 6.8 to 7.
2.
9. The method as described in claim 6, characterized in that, The reaction temperature is 32~38℃, and the reaction time is 12~20h.
10. The method as described in claim 6, characterized in that, In the catalyst, the amount of wet bacterial cells is 15~30 g / L, the final concentration of fructose is 100~180 g / L, and the final concentration of sodium formate is 50~80 g / L; the liquid phase environment also contains zinc sulfate, and the final concentration of zinc sulfate is 0.05~3 mM.
Citation Information
Patent Citations
Formate dehydrogenase mutant with improved enzyme activity and stability as well as construction method of formate dehydrogenase mutant
CN106479988A
Formate dehydrogenase mutant, recombinant genetically engineered bacterium and application of formate dehydrogenase mutant
CN116676283A