Androgen receptor targeting siRNA, modified siRNA, carrier system of modified siRNA, and application of modified siRNA and carrier system

Abstract

The invention discloses siRNA (small interfering Ribonucleic Acid) of a targeted androgen receptor, modified siRNA as well as a carrier system and application of the siRNA. According to the present invention, siRNA drug design is performed on the androgen receptor gene sequence, a plurality of siRNAs comprising positive-sense strand RNA and antisense strand RNA are screened, and the nucleotide sequences are represented by SEQ ID No.1-SEQ ID No.128, such that the mRNA expression level of the androgen receptor can be effectively knocked down, the mRNA expression level of the part of the sequence can be knocked down to about 30% on the human cell, and the obvious concentration effect is provided; the siRNA sequence stability can be effectively improved after the nucleotide chain is subjected to nucleic acid skeleton sulfo modification and base nucleoside modification, IC50 of androgen receptor gene knockdown can reach 0.064 nM, and the siRNA has the potential of preparing androgen receptor related gene therapy drugs for treating androgen alopecia or prostatic cancer and the like caused by overexpression of androgen receptor genes.

Description

TECHNICAL FIELD

[0001] The present application relates to a gene drug for treating androgenic alopecia, in particular to siRNA targeting androgen receptor, modified siRNA and its carrier system and application in preparing a gene therapy drug for preventing or treating androgenic alopecia, belonging to the field of gene therapy drugs for androgenic alopecia. BACKGROUND

[0002] Androgenic alopecia (AGA) is also known as seborrheic alopecia, early baldness, male baldness, etc., which is a kind of hair loss disease of progressive miniaturization of hair follicles. According to statistics, the prevalence rate of Chinese men is as high as 21.3%, and the prevalence rate of women is 6%. At the same time, the population of alopecia shows a trend of becoming younger and younger. The scalp of androgenic alopecia patients will appear yellow spots, pigmentation, perifolliculitis, hair shaft diameter variation and vellus hair and other disease characteristics.

[0003] The mechanism of androgenic alopecia can be simply summarized as follows: testosterone in the human body can be reduced to dihydrotestosterone (DHT) under the action of 5α-reductase. The expression of type II 5α-reductase gene in the hair follicle cells of the scalp hair loss area of androgenic alopecia patients is increased, which converts testosterone into dihydrotestosterone (DHT) and combines with androgen receptor protein (ARP) on the scalp, resulting in normal hair follicles becoming susceptible hair follicles. At the same time, the expression of androgen receptor (AR) gene in the hair follicle cells of the scalp hair loss area of patients is increased, which makes the effect of androgen on susceptible hair follicles increase, and then a series of symptoms such as miniaturization of hair follicles, shortening of hair growth period and stagnation of resting period occur, eventually leading to alopecia of different degrees. Androgenic alopecia is related to genetics and belongs to a polygenic recessive genetic disease.

[0004] The current treatment for androgenic alopecia mainly includes drug treatment, low-energy laser and hair transplantation. The oral drugs finasteride and dutasteride used in clinical practice belong to 5α-reductase inhibitors, which can prevent testosterone from being converted into dihydrotestosterone by inhibiting 5α-reductase, thereby achieving the purpose of treatment. The main external drug used in clinical practice is minoxidil, which can stimulate hair follicle cell proliferation and differentiation by dilating peripheral blood vessels, so as to promote hair growth. Other drugs under research in clinical practice include androgen receptor antagonists, prostaglandins and prostaglandin analogs, Wnt pathway modulators, type A botulinum toxin, etc. There is no marketed drug for RNA interference (RNAi) therapy. A siRNA drug OLX72021 developed by OliX Company of South Korea was launched in Australia for clinical phase I experiment in March 2023, indicating that nucleic acid drugs have a large market space in the field of prevention and treatment of androgenic alopecia. The expression level of AR gene in the hair follicle cells of androgenic alopecia patients is high, which further leads to excessive TGF-β, elevated IL-6 level and elevated DKK level, and finally causes alopecia. Therefore, reducing the expression level of AR gene can effectively solve androgenic alopecia.

[0005] The working principle of AR protein in hair follicle cells in the hair loss area of androgen alopecia patients is mainly that dihydrotestosterone binds the functional domain LBD of AR protein, and then is transported to the nucleus to regulate gene expression. Among the five isoforms of AR protein, AR-3, AR-4 and AR-8 mainly exist in prostate cancer cells, AR-45 has a high expression in the heart, and the expression in skin cells is not clear, and AR-B has the largest molecular weight and is the most common, and can be used as an effective target for preventing and treating androgen alopecia.

[0006] Prostate cancer is the second leading cause of death worldwide and one of the most common cancers in men, which is usually manifested as a malignant tumor of the prostate epithelium. The occurrence and development of prostate cancer are highly related to androgens, and studies have shown that mutations in the AR gene can cause prostate cancer. Clinically, androgen deprivation therapy (ADT) is used to block androgen synthesis and inhibit the AR signaling pathway to achieve the purpose of treatment. However, this treatment can further worsen the patient's condition to castration-resistant prostate cancer (CRPC), which seriously affects the patient's quality of life and survival rate. Androgen antagonistic therapy, as one of the main treatment methods, can be used alone to treat early prostate cancer or in combination with surgery for adjuvant therapy. Clinically, AR inhibitors can be divided into steroidal AR inhibitors and non-steroidal AR inhibitors according to their structures.

[0007] siRNA is a negatively charged double-stranded RNA about 21-25 bp long, which can form a RISC complex in cells to achieve high-efficiency and high-specificity binding to target mRNA, and then trigger specific degradation of target mRNA, thereby playing an RNAi role to regulate gene expression. Screening of effective siRNA can reduce the expression level of AR gene, thereby achieving the purpose of preventing and treating androgen alopecia and treating prostate cancer. SUMMARY

[0008] One of the purposes of the present application is to provide siRNA targeting androgen receptor;

[0009] The second purpose of the present application is to modify siRNA targeting androgen receptor to obtain modified siRNA;

[0010] The third purpose of the present application is to provide an expression vector containing siRNA targeting androgen receptor or modified siRNA targeting androgen receptor;

[0011] The fourth purpose of the present application is to prepare the siRNA targeting androgen receptor or the modified siRNA targeting androgen receptor into a gene therapy drug for treating androgen alopecia or treating prostate cancer.

[0012] The above object of the present application is achieved by the following technical solution:

[0013] In one aspect of the present application, siRNA targeting androgen receptor is provided, which specifically binds to mRNA of AR gene. Preferably, the siRNA is designed to target 3384 region, 5032 region, 6102-6145 region, 6609-6613 region, 9209-9506 region or 10398-10406 region of mRNA in the region of 1127-3889 of the full length of AR gene.

[0014] In one preferred embodiment of the present application, the siRNA contains a sense strand and an antisense strand, which is selected from any one of siRNAs in (1)-(64) below:

[0015] (1) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 1 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 2; (2) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 3 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 4; (3) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 5 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 6; (4) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 7 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 8; (5) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 9 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 10; (6) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 11 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 12; (7) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 13 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 14; (8) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 15 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 16; (9) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 17 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 18; (10) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 19 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 20; (11) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 21 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 22; (12) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 23 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 24; (13) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 25 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 26; (14) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 27 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 28; (15) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 29 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 30; (16) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 31 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.32 the nucleotide sequence shown in SEQ ID No. 33 and the antisense strand containing the nucleotide sequence shown in SEQ ID No. 34; (18) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 35 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 36; (19) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 37 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 38; (20) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 39 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 40; (21) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 41 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 42; (22) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 43 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 44; (23) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 45 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 46; (24) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 47 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 48; (25) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 49 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 50; (26) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 51 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 52; (27) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 53 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 54; (28) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 55 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 56; (29) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 57 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 58; (30) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 59 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 60; (31) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 61 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.62 the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 64; (33) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 65 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 66; (34) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 67 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 68; (35) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 69 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 70; (36) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 71 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 72; (37) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 73 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 74; (38) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 75 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 76; (39) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 77 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 78; (40) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 79 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 80; (41) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 81 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 82; (42) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 83 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 84; (43) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 85 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 86; (44) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 87 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 88; (45) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 89 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 90; (46) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 91 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No.92 the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 94; (48) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 95 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 96; (49) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 97 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 98; (50) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 99 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 100; (51) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 101 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 102; (52) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 103 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 104; (53) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 105 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 106; (54) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 107 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 108; (55) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 109 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 110; (56) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 111 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 112; (57) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 113 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 114; (58) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 115 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 116; (59) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 117 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 118; (60) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 119 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No. 120; (61) an siRNA consisting of the sense strand comprising the nucleotide sequence set forth in SEQ ID No. 121 and the antisense strand comprising the nucleotide sequence set forth in SEQ ID No.122 the antisense strand comprising the nucleotide sequence shown in SEQ ID No. 124; (63) siRNA consisting of the sense strand comprising the nucleotide sequence shown in SEQ ID No. 125 and the antisense strand comprising the nucleotide sequence shown in SEQ ID No. 126; (64) siRNA consisting of the sense strand comprising the nucleotide sequence shown in SEQ ID No. 127 and the antisense strand comprising the nucleotide sequence shown in SEQ ID No. 128.

[0016] In order to improve the stability of siRNA in vivo, reduce the degradation of exonuclease or promote the delivery of siRNA in cells in vivo to better exert the effect of knocking down AR gene, another aspect of the present application provides modified siRNA obtained by modifying the siRNA. The siRNA provided by the present application can be modified in various ways to obtain modified siRNA with improved stability or improved effect of knocking down AR gene. Those skilled in the art can modify the siRNA as described above according to the need, including but not limited to one or more of the following modification types: (1) modification of the 2' carbon position of the sugar ring structure of the nucleotide, including but not limited to substitution of the -OH group at the 2' carbon position of the sugar ring structure of the nucleotide with a methoxy group, a methylethoxy group, a methyl group, an amino group, a fluorine group, an -O-2-methylthioethyl group, an -O-3-aminopropyl group or an -O-3-dimethylaminopropyl group; (2) modification of the phosphodiester bond between nucleotides, including but not limited to substitution of the phosphodiester bond with a phosphorothioate, a boranophosphonate or a methylphosphonate; (3) modification of the nucleotides of the sequence, including but not limited to substitution of the siRNA with a peptide nucleic acid, a locked nucleic acid or an unlocked nucleic acid; (4) base modification, including but not limited to base modification or substitution of the 5-methylcytosine, 6-methyladenine, ribavirin, pseudouracil and / or inosine of the nucleotide base; (5) no modification or modification of the terminal end of the siRNA sequence, including but not limited to phosphorylation, phosphorothioation, vinylphosphonation or other phosphorylation analogs and phosphate prodrugs;

[0017] In order to improve the strand selectivity of siRNA to the target gene and the silencing effect of the target gene, the 5' terminal end of the antisense strand of siRNA can be modified by the following modification methods:

[0018]

[0019] (6) In order to make siRNA have a targeting effect in cells, improve the uptake efficiency and play a silencing effect, the end group of siRNA can be modified with cholesterol as needed to improve the efficiency and long-acting of siRNA into cells and enhance the therapeutic effect; preferably, the cholesterol modification structure is as follows:

[0020]

[0021] In one specific embodiment of the present application, the modified siRNA is obtained by modifying the siRNA using at least one modification method selected from the following (1)-(6):

[0022] (1) converting one non-ester oxygen bond between the phosphodiester of RNA into sulfur;

[0023] (2) substituting the -OH group at the 2' carbon position of the nucleic acid base with, but not limited to, CH3 (methyl), -OCH3 (methoxy), -OCH2CH2OCH3 (methoxyethyl), -F (fluorine), NH2, -O-2-methylthioethyl, -O-3-aminopropyl, or -O-3-dimethylaminopropyl, and / or deoxy-modifying the 2'-OH; preferably, the -OH group at the 2' carbon position of the nucleic acid base is modified by alternately replacing it with methoxy and fluorine;

[0024] (3) both the sense strand and the antisense strand of siRNA have two or more phosphorothioate modifications;

[0025] (4) replacing the TT base at the 3' end of the sense strand or the antisense strand of siRNA with two bases that are originally complementary to AR mRNA;

[0026] (5) the antisense strand of the RNA sequence has no modification or modification of phosphate, phosphorothioate, or its phosphate analog and phosphate prodrug modification at the 5' end, and the sense strand has no modification or inverted non-base sugar cap modification at the 5' end;

[0027] (6) cholesterol modification of the end group of siRNA.

[0028] The antisense strand in the present application can be a polynucleotide complementary to the target gene, and the length thereof can be 19 nt or more; in one preferred embodiment, the length of the antisense strand can include the sequence and be between 19 nt and 26 nt; in addition, the antisense strand in the present application can also have a nucleotide sequence partially complementary to the sense strand.

[0029] In a more preferred embodiment of the present application, the modified siRNA is selected from any one of the siRNAs consisting of the nucleotides comprising the sense strand and the nucleotides comprising the antisense strand in (1) - (22) below:

[0030] (1) sense strand: mG*mU*mUmUmCmUfGmAfGmUfGmAfCmAmUmGmAmUmA*dT*dT;

[0031] antisense strand: (Phos)mU*fA*fUfCmAfUmGfUmCfAmCfUmCfAmGfAmAmAmC*dT*dT;

[0032] (2) sense strand: mG*mG*mUmGmGmAfGmUfUmUfCmAfUmAmGmUmAmAmA*dT*dT;

[0033] antisense strand: (Phos)mU*fU*fUfAmCfUmAfUmGfAmAfAmCfUmCfCmAmCmC*dT*dT;

[0034] (3) sense strand: mC*mC*mUmGmAmUfUmUfCmUfGmCfAmUmUmGmAmUmA*dT*dT;

[0035] antisense strand: (Phos)mU*fA*fUfCmAfAmUfGmCfAmGfAmAfAmUfCmAmGmG*dT*dT;

[0036] (4) sense strand: mG*mA*mUmCmCmUfUmCfAmCfCmAfAmUmGmUmCmAmA*dT*dT;

[0037] antisense strand: (Phos)mU*fU*fGfAmCfAmUfUmGfGmUfGmAfAmGfGmAmUmC*dT*dT;

[0038] (5) sense strand: mG*mG*mAmUmAmUfGmUfUfCfUmGmUmAmAmAmGmAmU*dT*dT;

[0039] antisense strand: mA*fU*mCmUmUfUmAfCfAmGmAmAmCfAmUfAmUmCmC*dT*dT;

[0040] (6) sense strand: mG*mA*mUmAmUmGfUmUfCfUfGmUmAmAmAmGmAmUmU*dT*dT;

[0041] Antisense strand: mA*fA*mUmCmUfUmUfAfCmAmGmAmAfCmAfUmAmUmC*dT*dT;

[0042] (7) Justice chain: mU*mC*mUmUmUmUfGmUfUfGfCmUmCmUmAmAmAmUmA*dT*dT;

[0043] Antisense strand: mU*fA*mUmUmUfAmGfAfGmCmAmAmCfAmAfAmAmGmA*dT*dT;

[0044] (8) Justice chain: mU*mG*mCmUmCmUfAmAfAfUfAmCmAmAmUmUmAmAmA*dT*dT;

[0045] Antisense strand: mU*fU*mUmAmAfUmUfGfUmAmUmUmUfAmGfAmGmCmA*dT*dT;

[0046] (9) Justice chain: mA*mU*mAmUmGmUfUmCfUfGfUmAmAmAmGmAmUmUmU*dT*dT;

[0047] Antisense strand: mA*fA*mAmUmCfUmUfUfAmCmAmGmAfAmCfAmUmAmU*dT*dT;

[0048] (10) Justice chain: mC*mA*mCmUmGmAfCmUfGfAfAmUmAmGmUmUmAmAmA*dT*dT

[0049] Antisense strand: mU*fU*mUmAmAfCmUfAfUmUmCmAmGfUmCfAmGmUmG*dT*dT;

[0050] (11) Justice chain: mC*mA*mGmUmGmAfAmAfCfAfGmCmAmGmUmGmUmAmA*dT*dT;

[0051] Antisense strand: mU*fU*mAmCmAfCmUfGfCmUmGmUmUfUmCfAmCmUmG*dT*dT;

[0052] (12) Sense chain: mG*mA*mUmUmUmCfUmGfCfAfUmUmGmAmUmAmUmUmA*dT*dT;

[0053] Antisense strand: mU*fA*mAmUmAfUmCfAfAmUmGmCmAfGmAfAmAmUmC*dT*dT;

[0054] (13) sense: mG*mA*mAmAmCmAfGmCfAfGfUmGmUmAmAmUmUmAmA*dT*dT;

[0055] antisense: mU*fU*mAmAmUfUmAfCfAmCmUmGmCfUmGfUmUmUmC*dT*dT.

[0056] (14) sense: mU*mU*mGmGmAmUfAmUfGfUfUmCmUmGmUmAmAmAmG*mA*mU;

[0057] antisense: mA*fU*mCmUmUfUmAfCfAmGmAmAmCfAmUfAmUmCmC*mA*mA;

[0058] (15) sense: mU*mG*mGmAmUmAfUmGfUfUfCmUmGmUmAmAmAmGmA*mU*mU;

[0059] antisense: mA*fA*mUmCmUfUmUfAfCmAmGmAmAfCmAfUmAmUmC*mC*mA;

[0060] (16) sense: mA*mA*mUmCmUmUfUmUfGfUfUmGmCmUmCmUmAmAmA*mU*mA;

[0061] antisense: mU*fA*mUmUmUfAmGfAfGmCmAmAmCfAmAfAmAmGmA*mU*mU;

[0062] (17) sense: mG*mU*mUmGmCmUfCmUfAfAfAmUmAmCmAmAmUmUmA*mA*mA;

[0063] antisense: mU*fU*mUmAmAfUmUfGfUmAmUmUmUfAmGfAmGmCmA*mA*mC;

[0064] (18) sense: mG*mG*mAmUmAmUfGmUfUfCfUmGmUmAmAmAmGmAmU*mU*mU;

[0065] antisense: mA*fA*mAmUmCfUmUfUfAmCmAmGmAfAmCfAmUmAmU*mC*mC;

[0066] (19) sense: mG*mA*mCmAmCmUfGmAfCfUfGmAmAmUmAmGmUmUmA*mA*mA;

[0067] antisense: mU*fU*mUmAmAfCmUfAfUmUmCmAmGfUmCfAmGmUmG*mU*mC;

[0068] (20) sense: mA*mU*mCmAmGmUfGmAfAfAfCmAmGmCmAmGmUmGmU*mA*mA;

[0069] antisense: mU*fU*mAmCmAfCmUfGfCmUmGmUmUfUmCfAmCmUmG*mA*mU;

[0070] (21) sense: mC*mU*mGmAmUmUfUmCfUfGfCmAmUmUmGmAmUmAmU*mU*mA;

[0071] antisense: mU*fA*mAmUmAfUmCfAfAmUmGmCmAfGmAfAmAmUmC*mA*mG;

[0072] (22) sense: mG*mU*mGmAmAmAfCmAfGfCfAmGmUmGmUmAmAmUmU*mA*mA; antisense: mU*fU*mAmAmUfUmAfCfAmCmUmGmCfUmGfUmUmUmC*mA*mC.

[0073] (23) sense: mG*mG*mAmUmAmUfGmUfUfCfUmGmUmAmAmAmGmAmU*dT*dT-Chol; antisense: mA*fU*mCmUmUfUmAfCfAmGmAmAmCfAmUfAmUmCmC*dT*dT;

[0074] wherein * is phosphorothioate modification, m is 2'-methoxy modification, f is 2'-fluoro modification, Phos is 5' phosphorylation modification, and Chol represents cholesteryl modification.

[0075] Another aspect of the present application provides a vector system containing the siRNA or modified siRNA, by which the siRNA is delivered into cells in vivo; the vector system is selected from the group consisting of nucleic acid-lipid particles, liposomes, micelles, viral particles, nucleic acid complexes or mixtures consisting of more than one. In some cases, the modified siRNA molecule is complexed with a lipid such as a cationic lipid to form a lipid-nucleic acid complex; in one embodiment, the modified siRNA molecule is complexed with a polymer such as a cationic polymer to form a polymer-nucleic acid complex; in one embodiment, the modified siRNA molecule can also be complexed with a cyclodextrin or a polymer thereof; preferably, the modified siRNA molecule is encapsulated in a nucleic acid-lipid particle.

[0076] Another aspect of the present application provides a pharmaceutical composition for preventing or treating alopecia or treating prostate cancer, wherein the pharmaceutical composition contains the siRNA or modified siRNA and a pharmaceutically acceptable carrier system and formulation adjuvant; wherein the carrier system contains any one selected from the group consisting of nucleic acid-lipid particles, liposomes, micelles, viral particles or nucleic acid complexes or mixtures consisting of more than one; the formulation adjuvant includes but is not limited to physiological saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol or ethanol; in addition, the pharmaceutical composition is prepared into a conventional formulation such as an injection formulation, a lyophilized formulation, a tablet, a capsule, a powder, a paste or a syrup, etc. by further adding various formulation adjuvants or carriers, which all belong to the conventional formulation methods in the art.

[0077] The administration method of the pharmaceutical composition of the present application can be determined according to the symptoms or severity of the disease of the patient, which includes but is not limited to oral administration, intramuscular injection administration, intra-arterial injection administration, intravenous injection administration, subcutaneous administration, intracardiac administration, intrathecal administration, etc.; the administration dose of the pharmaceutical composition of the present application is determined according to the severity of the disease of the patient, administration time, administration method, age, body weight, gender, etc.

[0078] The present application designs a series of siRNAs targeting androgen receptor, carries out siRNA drug design on androgen receptor (AR) gene, screens a plurality of siRNAs composed of sense strand and antisense strand RNA, the designed siRNA sequence can effectively knock down the mRNA expression level of AR, part of the sequences can knock down the mRNA expression level of AR to about 30% in human cells and have obvious concentration effect, by further carrying out nucleic acid backbone thio-modification and base nucleoside modification on the nucleotide chain, the stability of the siRNA sequence can be effectively improved, the IC 50Up to 0.064 nM, and is expected to be a gene therapy drug for treating androgen alopecia caused by overexpression of AR gene or treating prostate cancer. BRIEF DESCRIPTION OF DRAWINGS

[0079] Figure 1 The silencing effect of siRNA sequence on AR mRNA.

[0080] Figure 2 IC of siRNA modified sequence 50 Curve.

[0081] Figure 3 The silencing effect of siRNA sequence on AR mRNA in MSF cells.

[0082] Figure 4 The pharmacodynamic study results of siRNA (R-27-E-Chol) on male alopecia model mice. DETAILED DESCRIPTION

[0083] The present application will be further described below in conjunction with specific embodiments, and the advantages and features of the present application will become more apparent as the description proceeds. However, these embodiments are only exemplary, and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that modifications or substitutions can be made to the details and forms of the present application without departing from the spirit and scope of the present application, and such modifications and substitutions fall within the scope of the present application.

[0084] Experimental Example 1 Design, screening of siRNA targeting androgen receptor and experiment of knocking down AR gene

[0085] 1. siRNA sequence

[0086] According to siRNA design and screening on the full-length region of androgen receptor (AR) gene (NG_009014.2) transcript, TT was added as a protruding base at the 3' end of siRNA to increase the stability of siRNA double-stranded complex, and the designed siRNA sequence is shown in Table 1, and the primers used in the experiment are shown in Table 1.

[0087] Table 1 siRNA sequence

[0088]

[0089]

[0090]

[0091] Table 2 primer sequence

[0092] Name Sequence AR-Forward CATTTTGCATGCGCTCTGCT AR-Reverse GCTCACCAGCTAAGTGGGTC GAPDH-Forward TGCACCACCAACTGCTTAGC GAPDH-Reverse GGCATGGACTGTGGTCATGAG musAR-Forward AGCCCATCTATTTCCACACAC musAR-Reverse GAGGAATTTCCCCCAAGGCA

[0093] 2. Experimental method

[0094] 2.1 Cell culture

[0095] FBS was filtered by sterile filter and added into DMEM medium to make DMEM(+,-) medium containing 10% FBS, which was stored in 4°C refrigerator for cell culture. Antibiotics (penicillin and streptomycin) were added into DMEM(+,-) medium to make DMEM(+,+) medium containing 1% antibiotics, which was stored in 4°C refrigerator for cell culture.

[0096] HaCaT cells were resuscitated in 25cm 2 transwell cell culture flask containing DMEM(+,+) medium and placed in cell culture incubator (temperature constant at 37°C, CO2 concentration constant at 5%) for proliferation. When the cell density in the flask reached about 90%, the cells were subcultured. The cells were washed twice with 1xPBS (2mL / time), then 1mL trypsin was added to digest the cells in the cell culture incubator for 2-3min, until the cells were completely digested, then 3mL DMEM(+,-) was added to stop the digestion. The cells were blown down from the flat bottom with 1mL pipette, then the cell suspension was transferred to a 15mL centrifuge tube and centrifuged for 5min (1000rpm / min). The supernatant was discarded, and the cells were resuspended in fresh DMEM(+,-) medium, and 1 / 3 of the cell suspension was added to a 75cm 2 transwell cell culture flask containing 15mL DMEM(+,-) medium, mixed well, and continued to proliferate in the cell culture incubator.

[0097] The cells were counted with a cell counting plate, and a cell suspension of 1x10 5 individual / mL was prepared. 0.5mL of the cell suspension was added to each well of a 24-well plate, and 0.25mL of the cell suspension was added to each well of a 48-well plate, which was then placed in the cell incubator for 24h.

[0098] MSF cells (Mouse Skin Fibroblasts Cells) were resuscitated in 25cm 2Place the cells in a breathable cell culture flask in a cell culture incubator (constant temperature at 37°C, constant CO2 concentration at 5%) for proliferation. When the cell density in the culture flask reaches about 80-90%, cell passage is performed. Wash twice with 1×PBS (2mL / time), then add 1mL of trypsin and digest in a cell culture incubator for 1 minute. After the cells are completely digested, add 3mL of DMEM (+, -) to terminate the digestion. Use a 1mL pipette to blow the cells down from the flat bottom, then transfer the cell suspension to a 15mL centrifuge tube and centrifuge for 5 minutes (speed 1000rpm / min). Discard the supernatant, resuspend the cells with fresh DMEM (+, -) culture medium, take 1 / 3 of the cell resuspension and add it to a 75cm 2 Mix well in a breathable cell culture flask and continue to proliferate in a cell culture incubator.

[0099] Count the cells using a cell counting plate and prepare 2×10 5 Add 0.5 mL of cell resuspension to each well of a 24-well plate, shake well by the cross method, and then culture in a cell incubator for 24 hours.

[0100] 2.2 Cell transfection

[0101] When the cell density in the well plate was about 70%, the cell transfection experiment was performed using the commercial transfection reagent Lipofectamine 2000. TM Transfection of nucleic acid, the specific experimental steps are as follows:

[0102] Lipofectamine 2000 in 24-well plates TM 2μL / well for experiment, take 50μL and add 1200μL Opti-MEM medium to dilute to 1250μL Lipofectamine 2000 TM +Opti-MEM stock solution, mix well with a pipette and incubate at room temperature for 5 minutes. siRNA was prepared into a 10μM stock solution with DEPC water and diluted into Opti-MEM medium according to the transfection concentration, with 50μL per well. TM + Add an equal volume of Opti-MEM stock solution (50 μL per well) to the nucleic acid transfection stock solution, pipette 10-20 times to mix, and incubate at room temperature for 15 minutes.

[0103] Remove DMEM(+,-) medium in 24-well plate, wash once with 1xPBS, then add 400μL Opti-MEM medium to each well, add 100μL transfection stock solution to each well according to experimental design, mix gently, then put into cell culture incubator, 6h later remove Opti-MEM medium, replace with fresh DMEM(+,-) medium, evaluate 48h after transfection.

[0104] 2.3 Real-time fluorescent quantitative PCR

[0105] Extract according to TRIZOL total RNA extraction reagent instruction, use NanoDrop 2000 to detect RNA concentration and absorption peak type. According to the whole style gold Uni All-in-One First-Strand cDNA SynthesisSuperMix for qPCR (One-Step gDNA Removal) kit instruction, take 500ng total RNA for reverse transcription experiment, dilute the cDNA obtained by reverse transcription with 100μL enzyme-free water, and according to the whole style gold Green qPCR SuperMix (+ Universal Passive Reference Dye) fluorescent quantitative detection kit instruction, configure qPCR system after operation, detect on ABI fluorescent quantitative PCR instrument, fluorescent signal is SYBR Green. The types and contents of components in qPCR system configuration are shown in Table 3. The reference gene is GAPDH. The reaction conditions of qPCR are as follows: 1) denaturation of initial template 95℃ 2min; 2) template denaturation, annealing and extension in PCR cycle (40 cycles) 95℃ 5sec, 60℃ 30sec; 3) cooling to 0℃.

[0106] Table 3 Component content of qPCR system configuration

[0107]

[0108] 3. Experimental results

[0109] 3.1 siRNA screening and modification

[0110] The evaluation of siRNA requires appropriate concentration and time. Overall, 48 h was selected as the screening time condition, and 50 nM was selected as the screening concentration condition (the cholesterol conjugate of AR-27-E, AR-27-E-Chol, was set to a final concentration of 1 μM to allow it to enter the cells through free uptake). The OLX72021 sequence (Sense chain: 5′-CUU UUG ACC UGC UAA U-3′; Antisense chain: 5′-AUU AGC AGG UCA AAA GUG AAC-3′) was used as a control. The silencing effects of siRNA sequences on AR are shown in Tables 4 and 4. Figure 1 shown.

[0111] Table 4 Knockdown effect of siRNA sequences on ARmRNA

[0112]

[0113]

[0114] A total of 13 sequences, including AR-5, AR-6, AR-9, AR-23, AR-27, AR-30, AR-33, AR-34, AR-41, AR-44, AR-50, AR-52, and AR-58, were selected for further modification and evaluation. The specific modification schemes are shown in Table 5 below.

[0115] Table 5 Base modification scheme of ARsiRNA

[0116]

[0117]

[0118] Where * indicates phosphorothioate modification, m represents 2′-methoxy modification, f represents 2′-fluoro modification, Phos represents 5′ phosphorylation, and Chol represents cholesterol. # Knockdown results represent free uptake (not transfection reagent-encapsulated).

[0119] During nucleic acid synthesis, the oxidizing reagent in the DNA solid-phase synthesizer is replaced with a thiolation reagent, converting one of the non-ester oxygen bonds between the phosphodiester groups to sulfur. Using commercially available fluorinated or methoxylated phosphoramidite monomers allows for fluorination and methoxylation of the 2′ position of nucleic acid bases. Because excessive methoxylation of bases can compromise siRNA efficacy, alternating methoxylation and fluorination are used. In practice, siRNA undergoes 5′ phosphorylation of the antisense strand within the cell. Modified or unmodified phosphate groups on the antisense strand of the siRNA have equivalent gene silencing efficacy, and modifications with certain phosphate analogs can enhance gene silencing efficacy.

[0120] In addition, AR-27, AR-30, AR-33, AR-34, AR-41, AR-44, AR-50, AR-52, and AR-58 sequences are selected, and the originally overhanging TT bases at the 3' end of the sequence are replaced with two bases that originally and AR mRNA complementary pairing (Table 5). This sequence has little effect on the effect of siRNA, and there is no obvious difference in activity with the sequence with TT bases at the 3' end, and has the same ability to target and silence the androgen receptor gene.

[0121] 3.2 IC 50 Experiment

[0122] Selecting siRNA with concentrations of 10 -8 , 10 -7 , 10 -6 , 0.00001, 0.00005, 0.0001, 0.001, 0.01, 0.05, 0.1, 0.25, 0.5, 1, 2.5, 7.5, 10, 50, 100, 150, 200nM to evaluate the silencing effect of the first 6 modified siRNAs in Table 5 (i.e. AR-5-J, AR-6-J, AR-9-J, AR-23-J, AR-27-E, AR-34-E) in 48h 50 Experiment, and the obtained IC 50 curve is shown in Figure 2 , and the obtained IC 50 value is shown in Table 6.

[0123] Table 6 IC 50 value of modified sequence

[0124] Name IC 50 (nM) Name IC 50 (nM) AR-5-J 0.11 AR-23-J 0.19 AR-6-J 0.35 AR-27-E 0.064 AR-9-J 0.094 AR-34-E 0.15

[0125] 3.3 Silencing effect of human-mouse homologous siRNA in MSF cells

[0126] Among all siRNA sequences, AR-26-AR-42 are human-mouse homologous sequences, and AR-27, AR-30, AR-33, AR-34, AR-41, and modified sequences AR-27-E, AR-30-E, AR-33-E, AR-34-E, AR-41-E, AR-27-oriE, AR-30-oriE, AR-33-oriE, AR-34-oriE, AR-41-oriE are selected, and OLX72021 sequence is used as a control to evaluate the silencing effect in MSF cells.

[0127] Experimental method: cell transfection experiment is performed when the cell density in the well plate is about 70%, and commercial transfection reagent Lipofectamine 3000 TMTransfection was performed using Lipofectamine 3000 in 24-well plates. TM 1 μL / well for the experiment, take 25 μL and add 1225 μL Opti-MEM medium to dilute to 1250 μL Lipofectamine 3000 TM +Opti-MEM stock solution, mix well with a pipette and incubate at room temperature for 5 minutes. siRNA was prepared into a 10μM stock solution with DEPC water, and then diluted into Opti-MEM medium at a final concentration of 50nM, with 50μL per well. TM + Add an equal volume of Opti-MEM stock solution (50 μL per well) to the nucleic acid transfection stock solution, pipette 10-20 times to mix, and incubate at room temperature for 15 minutes. Remove the DMEM (+, -) medium in the 24-well plate, wash once with 1× PBS, add 400 μL of Opti-MEM medium to each well, add 100 μL of the above transfection stock solution to each well of the 24-well plate according to the experimental design, and gently shake to mix. After completion, place it in a cell culture incubator. After 6 hours, remove the Opti-MEM medium and replace it with fresh DMEM (+, -) medium. Remove the medium in the well plate 48 hours after the start time of transfection, and perform real-time quantitative fluorescence PCR evaluation according to the experimental method in 2.3. Set the final concentration of the cholesterol conjugate of AR-27-E (AR-27-E-Chol) to 1 μM, so that it can enter MSF cells (non-transfection reagent packaged) through free uptake.

[0128] Table 7 AR gene silencing effect of human and mouse homologous sequences in mouse MSF cells

[0129]

[0130]

[0131] The experimental results show that (Table 7, Figure 3 ): The sequences AR-27, AR-30, AR-33, AR-34, AR-41 and the modified sequences AR-27-E, AR-30-E, AR-33-E, AR-34-E, AR-41-E, AR-27-oriE, AR-30-oriE, AR-33-oriE, AR-34-oriE, AR-41-oriE and AR-27-E-Chol all had a good silencing effect on the AR gene in MSF cells.

[0132] 3.4 Therapeutic effect of human-mouse homologous siRNA (AR-27-E-Chol) on androgenic alopecia model mice

[0133] Male C57BL / 6J mice were injected intraperitoneally with dihydrotestosterone (1 mg / day / mouse) solution to establish an androgen alopecia mouse model. On the fourth day of dihydrotestosterone injection, the mice were depilated on the back to synchronize the hair cycle, and the mice were randomly divided into groups of 6, and divided into the following groups: normal mice (NC) that were not subjected to modeling and were injected intradermally with PBS on the back on days 1, 5, 9, 13, and 17 after depilation; a model group that was continuously modeled and was injected intradermally with PBS on the back on days 1, 5, 9, 13, and 17 after depilation; an AR siRNA low-dose group that was continuously modeled and was injected intradermally with 5 mg / kg AR-27-E-Chol on the back on days 1, 5, 9, 13, and 17 after depilation; an AR siRNA high-dose group that was continuously modeled and was injected intradermally with 25 mg / kg AR-27-E-Chol on the back on days 1, 5, 9, 13, and 17 after depilation; a PC siRNA low-dose group that was continuously modeled and was injected intradermally with 5 mg / kg OLX72021 (Sense strand: 5'-mCUmU UmUG mACmC UmGC mUA*mA*U(Chol)-3'; Antisense strand: 5'-mA*fU*mU fAmGfC mAfGmG fUmCfA mAfAmA fGmU*fG*mA*fA*mC-3', wherein * is a phosphorothioate modification, m represents a 2'-methoxy modification, f represents a 2'-fluoro modification, and Chol is cholesterol) on the back on days 1, 5, 9, 13, and 17 after depilation; a PC siRNA high-dose group that was continuously modeled and was injected intradermally with 25 mg / kg OLX72021 on the back on days 1, 5, 9, 13, and 17 after depilation; a minoxidil group that was continuously modeled and was given minoxidil gel (2.2%) by topical application on the back on days 1, 5, 9, 13, and 17 after depilation until the end of treatment; and a finasteride group that was continuously modeled and was given finasteride corn oil solution (the finasteride dose was 10 mg / kg) by gavage every day after depilation until the end of treatment. The hair growth on the back of the mice was recorded on days 1, 3, 5, 7, 9, 11, 13, 15, 17, and 19 after depilation.

[0134] The experimental results are shown in Table 1: Figure 4 As shown in Table 1, the model group showed a significant growth lag in the 7-11 day period compared to the normal group, indicating that the androgen alopecia model was successfully established. At the end of treatment, the newly grown hair completely covered the back in the AR siRNA high- and low-dose groups, which was similar to the OLX72021 high- and low-dose groups and the minoxidil group, and was not significantly different from the normal mice, indicating that the AR siRNA provided by the application can promote hair growth.

Claims

1. An siRNA targeting androgen receptor, characterized in that The siRNA contains a sense strand and an antisense strand, and the siRNA is selected from any one of the following siRNAs (1) to (64): (1) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.1 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.2; (2) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.3 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.4; (3) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.5 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.6; (4) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.7 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.8; (5) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.9 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.10; (6) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.11 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.12; (7) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.13 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. (8) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 15 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 16; (9) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 17 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 18; (10) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 19 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 20; (11) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 21 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 22; (12) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 23 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 24; (13) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 25 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 26; (14) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 27 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 28; (15) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 29 and an antisense strand containing the nucleotide sequence shown in SEQ ID No. 30; (16) siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No. 31 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.(1) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 32 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 32; (17) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 33 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 34; (18) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 35 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 36; (19) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 37 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 38; (20) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 39 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 40; (21) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 41 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 42; (22) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 43 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 44; (23) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. (24) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 47 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 48; (25) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 49 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 50; (26) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 51 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 52; (27) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 53 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 54; (28) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 55 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 56; (29) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 57 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.58 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.58; (30) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.59 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.60; (31) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.61 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.(32) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 63 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 64; (33) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 65 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 66; (34) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 67 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 68; (35) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 69 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 70; (36) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 71 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 72; (37) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 73 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 74; (38) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 75 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 76; (39) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 77 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 78; (40) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 79 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 80; (41) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 81 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 82; (42) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 83 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 84; (43) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 85 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 86; (44) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 87 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. siRNA consisting of an antisense strand containing the nucleotide sequence shown in SEQ ID No.88; (45) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.89 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.90; (46) an siRNA consisting of a sense strand containing the nucleotide sequence shown in SEQ ID No.91 and an antisense strand containing the nucleotide sequence shown in SEQ ID No.(47) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.93 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.94; (48) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.95 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.96; (49) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.97 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.98; (50) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.99 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.100; (51) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.101 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.102; (52) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No.103 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. (53) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 105 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 106; (54) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 107 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 108; (55) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 109 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 110; (56) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 111 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 112; (57) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 113 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 114; (58) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 115 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 117 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 118; (60) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 119 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 120; (61) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 121 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.(62) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 123 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 124; (63) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 125 and an antisense chain containing the nucleotide sequence shown in SEQ ID No. 126; (64) siRNA consisting of a sense chain containing the nucleotide sequence shown in SEQ ID No. 127 and an antisense chain containing the nucleotide sequence shown in SEQ ID No.

128.

2. A siRNA, characterized in that The siRNA has 15 or more consecutive identical nucleotide sequences with the siRNA sequence according to claim 1.

3. The siRNA according to claim 1, wherein The TT base at the 3' end of the sense strand or antisense strand of the siRNA is replaced with two bases that complementarily pair with the mRNA of the androgen receptor gene.

4. A modified siRNA, characterized in that The modified siRNA is a modified siRNA obtained by modifying the backbone, sugar ring, nucleoside or base of the siRNA according to claim 1, 2 or 3; preferably, the modification is selected from one or more of the following modification methods: (1) Substitution of the 2' carbon position of the sugar ring in the nucleotide, including but not limited to methoxy, methylethoxy, methyl, amino, fluorine, -O-2-methylthioethyl, -O-3-aminopropyl or -O-3-dimethylaminopropyl substitution; (2) Modification of the phosphodiester bond between nucleotides, including but not limited to thiophosphate, boranephosphate or methylphosphonate; (3) Modification of the nucleoside of the sequence, including but not limited to peptide nucleic acid, locked nucleic acid or unlocked nucleic acid; (4) Base modification, including but not limited to: base modification or substitution of 5-methylcytosine, 6-methyladenine, ribavirin, pseudouracil and / or inosine of the nucleoside base; (5) Phosphorylation, thiophosphorylation, vinylphosphonation or other phosphorylation analogue modification of the end of the siRNA sequence; (6) Cholesterol modification of the end group of the siRNA; Preferably, the modified siRNA is modified by at least one modification selected from the following (1)-(6): (1) Converting a non-ester oxygen bond between RNA phosphodiesters into sulfur; (2) the -OH group at the 2' carbon position of the nucleic acid base is replaced by, but not limited to, CH3, -OCH3, -OCH2CH2OCH3, -F, or NH2 and / or the 2'-OH is deoxygenated; preferably, the -OH group at the 2' carbon position of the nucleic acid base is alternately replaced by methoxy and fluorine; (3) The ends of the sense or antisense strand of the siRNA have two or more phosphorothioate modifications; (4) The TT base at the 3′ end of the sense or antisense strand of the siRNA is replaced with the two bases that originally complementarily pair with the ARmRNA; (5) The 5' end of the antisense strand of the RNA sequence is unmodified or modified with a phosphate, thiophosphate, or a phosphate analog or phosphate prodrug thereof, and the 5' end of the sense strand is unmodified or modified with an inverted non-basic sugar cap; (6) Cholesterol modification of the terminal groups of siRNA.

5. The modified siRNA according to claim 4, characterized in that The modified siRNA is selected from any one of the following siRNAs (1) to (22) comprising nucleotides containing a sense strand and nucleotides containing an antisense strand: (1) Justice chain: mG*mU*mUmUmCmUfGmAfGmUfGmAfCmAmUmGmAmUmA*dT*dT; Antisense strand: (Phos)mU*fA*fUfCmAfUmGfUmCfAmCfUmCfAmGfAmAmAmC*dT*dT; (2) Justice chain: mG*mG*mUmGmGmAfGmUfUmUfCmAfUmAmGmUmAmAmA*dT*dT; Antisense strand: (Phos)mU*fU*fUfAmCfUmAfUmGfAmAfAmCfUmCfCmAmCmC*dT*dT; (3) Justice chain: mC*mC*mUmGmAmUfUmUfCmUfGmCfAmUmUmGmAmUmA*dT*dT; Antisense strand: (Phos)mU*fA*fUfCmAfAmUfGmCfAmGfAmAfAmUfCmAmGmG*dT*dT; (4) Justice chain: mG*mA*mUmCmCmUfUmCfAmCfCmAfAmUmGmUmCmAmA*dT*dT; Antisense strand: (Phos)mU*fU*fGfAmCfAmUfUmGfGmUfGmAfAmGfGmAmUmC*dT*dT; (5) Justice chain: mG*mG*mAmUmAmUfGmUfUfCfUmGmUmAmAmAmGmAmU*dT*dT; Antisense strand: mA*fU*mCmUmUfUmAfCfAmGmAmAmCfAmUfAmUmCmC*dT*dT; (6) Sense chain: mG*mA*mUmAmUmGfUmUfCfUfGmUmAmAmAmGmAmUmU*dT*dT; Antisense strand: mA*fA*mUmCmUfUmUfAfCmAmGmAmAfCmAfUmAmUmC*dT*dT; (7) Justice chain: mU*mC*mUmUmUmUfGmUfUfGfCmUmCmUmAmAmAmUmA*dT*dT; Antisense strand: mU*fA*mUmUmUfAmGfAfGmCmAmAmCfAmAfAmAmGmA*dT*dT; (8) Justice chain: mU*mG*mCmUmCmUfAmAfAfUfAmCmAmAmUmUmAmAmA*dT*dT; Antisense strand: mU*fU*mUmAmAfUmUfGfUmAmUmUmUfAmGfAmGmCmA*dT*dT; (9) Justice chain: mA*mU*mAmUmGmUfUmCfUfGfUmAmAmAmGmAmUmUmU*dT*dT; Antisense strand: mA*fA*mAmUmCfUmUfUfAmCmAmGmAfAmCfAmUmAmU*dT*dT; (10) Sense chain: mC*mA*mCmUmGmAfCmUfGfAfAmUmAmGmUmUmAmAmA*dT*dT Antisense chain: mU*fU*mUmAmAfCmUfAfUmUmCmAmGfUmCfAmGmUmG*dT*dT; (11) Justice chain: mC*mA*mGmUmGmAfAmAfCfAfGmCmAmGmUmGmUmAmA*dT*dT; Antisense strand: mU*fU*mAmCmAfCmUfGfCmUmGmUmUfUmCfAmCmUmG*dT*dT; (12) Sense chain: mG*mA*mUmUmUmCfUmGfCfAfUmUmGmAmUmAmUmUmA*dT*dT; Antisense strand: mU*fA*mAmUmAfUmCfAfAmUmGmCmAfGmAfAmAmUmC*dT*dT; (13) Justice chain: mG*mA*mAmAmCmAfGmCfAfGfUmGmUmAmAmUmUmAmA*dT*dT; Antisense strand: mU*fU*mAmAmUfUmAfCfAmCmUmGmCfUmGfUmUmUmC*dT*dT; (14) Sense strand mU*mU*mGmGmAmUfAmUfGfUfUmCmUmGmUmAmAmAmG*mA*mU; Antisense strand: mA*fU*mCmUmUfUmAfCfAmGmAmAmCfAmUfAmUmCmC*mA*mA; (15) Sense strand mU*mG*mGmAmUmAfUmGfUfUfCmUmGmUmAmAmAmGmA*mU*mU; Antisense strand: mA*fA*mUmCmUfUmUfAfCmAmGmAmAfCmAfUmAmUmC*mC*mA; (16) Sense chain: mA*mA*mUmCmUmUfUmUfGfUfUmGmCmUmCmUmAmAmA*mU*mA; Antisense strand: mU*fA*mUmUmUfAmGfAfGmCmAmAmCfAmAfAmAmGmA*mU*mU; (17) Justice chain: mG*mU*mUmGmCmUfCmUfAfAfAmUmAmCmAmAmUmUmUmA*mA*mA; Antisense strand: mU*fU*mUmAmAfUmUfGfUmAmUmUmUfAmGfAmGmCmA*mA*mC; (18) Sense chain: mG*mG*mAmUmAmUfGmUfUfCfUmGmUmAmAmAmGmAmU*mU*mU; Antisense strand: mA*fA*mAmUmCfUmUfUfAmCmAmGmAfAmCfAmUmAmU*mC*mC; (19) Sense strand: mG*mA*mCmAmCmUfGmAfCfUfGmAmAmUmAmGmUmUmA*mA*mA; Antisense strand: mU*fU*mUmAmAfCmUfAfUmUmCmAmGfUmCfAmGmUmG*mU*mC; (20) Sense strand: mA*mU*mCmAmGmUfGmAfAfAfCmAmGmCmAmGmUmGmU*mA*mA; Antisense strand: mU*fU*mAmCmAfCmUfGfCmUmGmUmUfUmCfAmCmUmG*mA*mU; (21) Justice chain: mC*mU*mGmAmUmUfUmCfUfGfCmAmUmUmGmAmUmAmU*mU*mA; Antisense strand: mU*fA*mAmUmAfUmCfAfAmUmGmCmAfGmAfAmAmUmC*mA*mG; (22) Sense strand: mG*mU*mGmAmAmAfCmAfGfCfAmGmUmGmUmAmAmUmU*mA*mA; Antisense strand: mU*fU*mAmAmUfUmAfCfAmCmUmGmCfUmGfUmUmUmC*mA*mC; (23) Sense chain: mG*mG*mAmUmAmUfGmUfUfCfUmGmUmAmAmAmGmAmU*dT*dT-Chol; Antisense chain: mA*fU*mCmUmUfUmAfCfAmGmAmAmCfAmUfAmUmCmC*dT*dT; Among them, * represents phosphorothioate modification, m represents 2′-methoxy modification, f represents 2′-fluoro modification, Phos represents 5′ phosphorylation modification, and Chol represents cholesterol modification.

6. A siRNA conjugate, characterized in that An siRNA conjugate obtained by conjugating the siRNA according to claim 1, 2 or 3 with a conjugation group, or conjugating the modified siRNA according to claim 4; wherein the conjugation group is a cholesterol group, a cell penetrating peptide or an alkyl chain group.

7. Use of the siRNA according to any one of claims 1 to 3, the modified siRNA according to claim 4 or 5, or the siRNA conjugate according to claim 6 in the preparation of a gene drug for preventing or treating alopecia and treating prostate cancer.

8. A carrier system comprising the siRNA according to any one of claims 1 to 3, or a carrier system comprising the modified siRNA according to claim 4 or 5, or a carrier system comprising the siRNA conjugate according to claim 6; preferably, the carrier system is selected from any one of nucleic acid-lipid particles, liposomes, micelles, viral particles, and nucleic acid complexes, or a mixture of more than one of them.

9. Use of the vector system according to claim 8 in the preparation of gene medicine for preventing or treating hair loss or treating prostate cancer.

10. A pharmaceutical composition for preventing or treating hair loss or treating prostate cancer, characterized in that: The pharmaceutical composition contains a therapeutically effective amount of the siRNA according to any one of claims 1 to 3, the modified siRNA according to claim 4 or 5, or the siRNA conjugate according to claim 6, as well as a pharmaceutically acceptable carrier system and formulation excipients.

Images