Application of DHX58 as diagnostic marker and therapeutic target of rheumatoid arthritis

Abstract

The invention belongs to the technical field of biomedicine, and particularly relates to application of DHX58 as a diagnostic marker and a therapeutic target of rheumatoid arthritis. Experiments prove that the DXH58 level in rheumatoid arthritis involved parts such as serum and synovial tissues of rheumatoid arthritis patients is remarkably increased, DHX58 and rheumatoid arthritis are positively correlated, and the DHX58 gene or DHX58 protein can be used as a molecular marker for screening or diagnosis or prognosis evaluation of rheumatoid arthritis. Experiments prove that the targeted DHX58 can be used as an effective way for treating rheumatoid arthritis. The application has important meanings for researching the effect of DHX58 in rheumatoid arthritis, understanding the mechanism of RA disease and developing a new treatment strategy.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biomedical technology, and particularly relates to application of DHX58 as a diagnostic marker and therapeutic target for rheumatoid arthritis. TECHNICAL BACKGROUND

[0002] Rheumatoid arthritis (RA) is a systemic autoimmune disease associated with chronic inflammatory processes. Its pathological manifestations include immune cell infiltration, synovial intimal hyperplasia, pannus formation, and joint cartilage and bone destruction, ultimately leading to joint dysfunction or even loss.

[0003] In recent years, with the in-depth study of the pathogenesis of RA, macrophages play a key role in the immune activation in the early stage of RA to the bone destruction in the late stage. They not only participate in the local inflammatory response of RA, but also form an amplification of the inflammatory network through intensive bidirectional communication with various cell types, thereby accelerating the progression of joint lesions.

[0004] Currently, the clinical treatment of rheumatoid arthritis mainly relies on non-steroidal anti-inflammatory drugs and immunosuppressive agents to control inflammatory response and delay disease progression. However, such traditional treatment methods generally have the problems of slow onset and obvious side effects, which become the main difficulty in clinical treatment. With the in-depth study of the pathological mechanism of rheumatoid arthritis, early intervention therapy targeting specific molecular targets has become a new research direction. Such targeted treatment shows significant efficacy for early diagnosed patients, not only effectively controlling disease progression, but also significantly improving patient prognosis and quality of life.

[0005] In recent years, rheumatoid factor (RF), C-reactive protein (CRP), and anti-cyclic citrullinated peptide antibody (Anti-CCP) have been proposed as diagnostic indicators for laboratory rheumatoid arthritis. However, serum detection of these autoantibodies has certain false positives. Some studies have reported that rheumatoid factor may also appear in patients with systemic lupus erythematosus (SLE) and hepatitis C virus (HCV) infection, leading to a high misdiagnosis rate. Diagnosis of rheumatoid arthritis solely based on these indicators is not sufficient to confirm the diagnosis.

[0006] There are also some studies that propose various new RA diagnostic markers, such as patent CN113881764A proposes that Jmjd1c gene expression is closely related to rheumatoid arthritis and can be used as an RA diagnostic marker, patent CN109486942A proposes RPN2 mRNA or RPN2 protein as an RA diagnostic marker, etc. However, these markers are still in the early stage of exploration. In view of the complexity of the causes of RA and in order to improve the accuracy of diagnosis, it is urgent to explore new targets and carry out further experimental research to assist in the diagnosis of rheumatoid arthritis. SUMMARY

[0007] One of the purposes of the present application is to provide the application of DHX58 gene or DHX58 protein as a molecular marker for screening or diagnosis or prognosis evaluation of rheumatoid arthritis.

[0008] The second purpose of the present application is to provide the application of DHX58 gene or DHX58 protein in the preparation of products for screening or diagnosis or prognosis evaluation of rheumatoid arthritis.

[0009] Preferably, the product comprises reagents and kits.

[0010] The third purpose of the present application is to provide a product for screening or diagnosis or prognosis evaluation of rheumatoid arthritis, characterized in that the product is a reagent for detecting the mRNA expression level of DHX58 and / or the protein expression level of DHX58, or the product comprises a reagent for detecting the mRNA expression level of DHX58 and / or the protein expression level of DHX58.

[0011] Preferably, the detection object is selected from at least one of the following: peripheral blood, peripheral serum, synovial cells, synovial tissue, bone tissue, rheumatoid arthritis bone tissue or joint cavity synovial fluid.

[0012] Preferably, when the detection result shows that the mRNA expression level of DHX58 and / or the protein expression level of DHX58 is significantly higher than the preset threshold value of the healthy control population, it indicates that the detection subject has the risk of rheumatoid arthritis and needs to be further diagnosed in combination with other clinical indicators.

[0013] The present application also provides the application of DHX58 gene as a therapeutic target for rheumatoid arthritis, and inhibition of DHX58 gene expression can be used for the treatment of rheumatoid arthritis.

[0014] Based on this, the fourth purpose of the present application is to provide the application of a reagent for inhibiting the expression of DHX58 gene in the preparation of a drug for treating rheumatoid arthritis.

[0015] Preferably, the reagent for inhibiting the expression of DHX58 gene comprises an RNA interference molecule targeting the DHX58 gene.

[0016] Preferably, the RNA interference molecule targeting the DHX58 gene is siRNA or shRNA.

[0017] Preferably, the RNA interference molecule targeting the DHX58 gene is Dhx58-shRNA adenovirus, the sequence of the sense strand is shown in SEQ ID NO: 1, and the sequence of the antisense strand is shown in SEQ ID NO: 2.

[0018] Compared with the prior art, the application has the beneficial effects that:

[0019] DHX58 (also known as LGP2, Laboratory of Genetics and Physiology 2) is a key molecule connecting virus recognition and immune response regulation as a member of the RLR family. Abnormal expression of DHX58 is related to various diseases, and is particularly important in the pathogenesis of antiviral immunity and autoimmunity.

[0020] The application proves by experiments that the level of DHX58 in the synovial tissue and serum of rheumatoid arthritis patients and BMDM cells derived from K / BxN mice stimulated by LPS is significantly higher than that in normal people and unstimulated groups, DHX58 is positively correlated with the occurrence and development of rheumatoid arthritis, and can be used as a molecular marker for screening, diagnosis or prognosis evaluation of rheumatoid arthritis.

[0021] Knocking down DHX58 in BMDM cells derived from K / BxN mice shows that it can inhibit the inflammatory response; knocking down the expression of DHX58 in K / BxN STA mice shows obvious reduction of inflammation and relief of symptoms. Therefore, targeting DHX58 can be an effective way to treat rheumatoid arthritis. The application has important significance for studying the role of DHX58 in rheumatoid arthritis, understanding the mechanism of the disease, and developing new treatment strategies. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 The expression of DHX58 in the synovial tissue of KRN serum-induced arthritis mice (KRN STA) and K / BxN serum-induced arthritis mice (K / BXN STA). Among them Figure 1 The left side is HE staining to detect the inflammatory cell infiltration in the synovial tissue of KRN STA and K / BXN STA mice, the scale bar: 100 μm (20x), 50 μm (63x); the right side is immunohistochemical staining to detect the expression of DHX58 in the synovial tissue of KRN STA and K / BXN STA mice, the scale bar: 100 μm (20x), 50 μm (63x).

[0023] Figures 2-4 The expression of DHX58 in synovial tissues of OA patients and RA patients. Among them Figure 2 The left side is HE staining to detect the inflammatory cell infiltration in synovial tissues of OA patients and RA patients, and the right side is immunohistochemical staining to detect the expression of DHX58 in synovial tissues of OA patients and RA patients, scale: 100 μm (20x), 50 μm (63x). Figure 3 The expression of DHX58 and CD68 in synovial tissues of OA patients and RA patients was detected by immunofluorescence double staining (IF), scale: 100 μm (20x), 50 μm (63x); Figure 4 A figure in the middle is the Western blot to detect the expression of DHX58 in synovial tissues of OA patients and RA patients, and BMDM cells derived from K / BxN mice stimulated by LPS, B figure is qRT-PCR to detect the expression of DHX58 mRNA in synovial tissues of OA patients and RA patients, and BMDM cells derived from K / BxN mice stimulated by LPS; C figure is the expression of DHX58 in peripheral blood of normal people and RA patients. Data represent one repeated experiment, 3 samples in each group, expressed as mean ± standard deviation; * P<0.05, ** P<0.01.

[0024] Figures 5-6 The correlation analysis of the expression of DHX58 mRNA in peripheral blood mononuclear cells (PBMC) of RA newly diagnosed patients with RA disease activity and inflammatory factors. Among them Figure 5 The correlation of DHX58 mRNA expression in PBMC of RA newly diagnosed patients with RA disease activity; Figure 6 The correlation of DHX58 mRNA expression in PBMC of RA patients with inflammatory factors and chemokines.

[0025] Figure 7 The test results of knocking down DHX58 to inhibit the inflammatory response of BMDM cells derived from K / BxN mice. Among them, A figure is qRT-PCR to detect the expression of inflammatory factor and chemokine mRNA in BMDM cells derived from K / BxN mice stimulated by LPS after knocking down DHX58; B figure is ELISA to detect the expression of inflammatory factors in the supernatant of BMDM cells derived from K / BxN mice stimulated by LPS after knocking down DHX58. Data represent one repeated experiment, 3 samples in each group, expressed as mean ± standard deviation; * P<0.05, ** P<0.01.

[0026] Figures 8-10The experimental results of Dhx58-shRNA on the inflammatory response of K / BxN serum transfer arthritis mice in vivo are shown in the following table. Figure 8 The swelling degree of mouse ankle joint and the representative micro-CT image are shown in the following table. Figure 9 The first row of the figure shows the HE staining to detect the inflammatory cell infiltration in the synovial tissue of Nc-shRNA group and Dhx58-shRNA group mice, the scale is 100 μm (20x), 50 μm (63x); the second to fourth rows of the figure show the immunohistochemical detection of Dhx58, Il-1β and Il-6 expression in the synovial tissue of Nc-shRNA group and Dhx58-shRNA group mice, the scale is 100 μm (20x), 50 μm (63x); Figure 10 A in the table shows the joint score and swelling degree detection. Figure 10 B in the table shows the ELISA detection of the expression of inflammatory factors in the serum of K / BxN STA mice after DHX58 knockdown; compared with K / BxN STA Sh-Nc group: * P<0.05, ** P<0.01. DETAILED DESCRIPTION

[0027] The technical solutions of the present application will be described in more detail below in combination with experiments and drawings.

[0028] Unless otherwise specified, the terms used herein have meanings commonly understood by those skilled in the art.

[0029] Brief introduction and full process control:

[0030] OA: Osteoarthritis, osteoarthritis.

[0031] RA: Rheumatoid Arthritis, rheumatoid arthritis.

[0032] DHX58: DExD / H-box helicase 58, DExD / H-box helicase 58.

[0033] HE staining: Hematoxylin-Eosin staining, hematoxylin-eosin staining.

[0034] IHC: Immunohistochemistry, immunohistochemistry.

[0035] IF: Immunofluorescence, immunofluorescence.

[0036] IL-1β: Nterleukin—1β, interleukin 1β.

[0037] IL-6: Interleukin 6, Leukocyte Interleukin 6.

[0038] CCL2: Chemokine ligand 8, Chemokine Ligand 2.

[0039] CCL4: Chemokine ligand 8, Chemokine Ligand 4.

[0040] CCL8: Chemokine ligand 8, Chemokine Ligand 8.

[0041] CXCL2: C-X-C Motif Chemokine Ligand 2, C-X-C Motif Chemokine Ligand 2.

[0042] TNF-a: tumor necrosis factor-a, tumor necrosis factor.

[0043] The KRN STA and K / BxN STA mouse models used in the embodiments of the present application are serum-induced arthritis mouse models, which can be used as RA animal models. With the consent of Professors Christophe Benoist and Diane Mathis of Harvard Medical School, KRN mice (transgenic mice carrying T cell receptors) were introduced for the construction of K / BxN mice. NOD mice (non-obese diabetic mice) were purchased from Jiangsu Jicui Yekang Biotechnology Co., Ltd. K / BxN mice were obtained by crossing KRN mice with NOD mice. K / BxN mice can spontaneously develop arthritis at 100% at 4-5 weeks. The serum of K / BxN mice was collected and stored at -80°C for the construction of K / BxN STA mice.

[0044] 1. Expression of DHX58 in synovial tissue of KRN STA and K / BxN STA mice

[0045] Establishment of KRN STA and K / BxN-STA mouse models: With the consent of Professors Christophe Benoist and Diane Mathis of Harvard Medical School, KRN mice were introduced, and NOD mice were purchased from Jiangsu Jicui Yekang Biotechnology Co., Ltd. K / BxN mice were obtained by crossing the two. The serum of KRN mice and K / BxN mice was injected intraperitoneally into C57 mice for the first time to induce KRN STA and K / BxN STA mouse models. The mouse ankle joints were extracted by conventional method, paraffin-embedded, and the expression of DHX58 in the synovial tissue of KRN STA and K / BxN STA mice was evaluated by immunohistochemical experiment.

[0046] See Figure 1HE staining results showed that the K / BxN STA group mice showed obvious inflammatory cell infiltration. Immunohistochemistry results showed that the positive staining degree of the synovial tissue of the K / BxN STA mice was significantly higher than that of the KRN STA group mice, indicating that the expression of DHX58 in the synovial tissue of K / BxN STA mice was significantly higher than that of KRN STA mice.

[0047] 2. Study on the difference of DXH58 expression in synovial tissues of OA patients and RA patients

[0048] Synovial tissues from patients with typical clinical presentations of OA and RA were collected from the Department of Rheumatology at the First Affiliated Hospital of Anhui Medical University. RNA was extracted using conventional methods, and qRT-PCR was used to evaluate DHX58 mRNA expression in synovial tissues from patients with OA and RA. Protein was extracted using conventional methods, paraffin-embedded, and Western blot, qRT-PCR, immunohistochemistry, and immunofluorescence were used to evaluate DHX58 expression in synovial tissues from patients with OA and RA. Bone marrow mononuclear cells were isolated from K / BxN mice and induced into BMDM using L929 supernatant. After stimulation with LPS (1 μg / ml) for 24 hours, DHX58 expression was assessed by Western blot and qRT-PCR. This preliminary study examined the specific expression of DHX58 in BMDM derived from K / BxN mice.

[0049] See also Figure 2 HE staining results showed that the infiltration of inflammatory cells in the synovial tissue of RA patients was significantly higher than that in the synovial tissue of RA patients. Immunohistochemistry results showed that the positive staining degree of synovial tissue of RA patients was significantly higher than that of OA patients, indicating that the expression of DHX58 in the synovial tissue of RA patients was significantly higher than that of OA patients.

[0050] like Figure 3 The immunofluorescence results shown in the figure are red marked as DHX58 and green marked as CD68. CD68 is a marker for macrophages. When it is positive, it means that the cell is a synovial macrophage. It can be seen that DHX58 is highly expressed in the synovial tissue of RA patients and partially overlaps with the expression of CD68. Therefore, DHX58 is expressed in synovial macrophages.

[0051] Western blot results showed that the expression of DHX58 in the synovial tissue of RA patients was significantly higher than that in OA patients. The expression of DHX58 in BMDM cells was significantly increased after LPS stimulation. Figure 4Figure A. B. qRT-PCR analysis of DHX58 mRNA expression in synovial tissues of OA and RA patients (left), and in LPS-stimulated BMDM cells from K / BxN mice (right). C. qRT-PCR analysis of DHX58 mRNA expression in peripheral blood of normal and RA patients. The results showed that DHX58 mRNA expression in synovial tissues of RA patients was significantly higher than that in OA patients, and DHX58 expression in LPS-stimulated BMDM cells was significantly increased.

[0052] 3. Correlation of DHX58 mRNA expression in peripheral blood of newly diagnosed RA patients with clinical disease activity and synovial inflammation

[0053] Peripheral blood samples of newly diagnosed RA patients were collected from the Department of Rheumatology and Immunology, the First Affiliated Hospital of Anhui Medical University. Peripheral blood mononuclear cells (PBMCs) were extracted, and the correlation of DHX58 mRNA expression with RA clinical disease activity (DAS28 score, Swollen score, ESR, Pain socre, CRP, RF, etc.) and inflammatory factors (CCL8, IL-1β, IL-6, TNF-α, etc.) was analyzed by qRT-PCR.

[0054] qRT-PCR results are shown in Figure 5 , which correspond to DAS28, Swollenscore, ESR, and Pain socre, CRP, RF results related to RA disease activity in order, and the expression of DHX58 mRNA was positively correlated with them, with statistical difference. See Figure 6 Correlation analysis with RA synovial inflammatory factors showed that the expression of DHX58 mRNA was positively correlated with CCL8, IL-1β, L-6, TNF-α, and had statistical difference.

[0055] 4. In vitro study of the regulatory effect of targeted DHX58 on inflammatory response in LPS-stimulated BMDM cells from K / BxN mice

[0056] DHX58 expression in BMDM was knocked down by using a DHX58-shRNA adenovirus (Top strand: TCGAGGCAGAGTTGTTACAGTTGGCACTCAACTCGAGTTGAGTGCCAACTGTAACAACTCTGTTTTTTA, SEQ ID NO. 1; Bottom strand: AGCTTAAAAAACAGAGTTGTTACAGTTGGCACTCAACTCGAGTTGAGTGCCAACTGTAACAACTCTGCC, SEQ ID NO. 2). After 24h of induction and activation using 1 pg / mL of LPS (mimicking the inflammatory microenvironment in RA patients), cell supernatants were collected, and cell RNA was extracted. qRT-PCR and ELISA were used to evaluate the secretion of inflammatory factors and chemokines (Ccl2, Ccl4, Ccl8, Cxcl2, Il-lb, Il-6, Tnf-a) in BMDM after DHX58 knockdown.

[0057] qRT-PCR results are shown in Figure 6A. As can be seen, knockdown of DHX58 significantly inhibited the expression of inflammatory factors (Il-lb, Il-6, Tnf-a) and chemokines (Ccl2, Ccl4, Ccl8, Cxcl2) in BMDM. Figure 7 ELISA results are shown in Figure 6B. As can be seen, knockdown of DHX58 significantly inhibited the secretion of inflammatory factors (IL-Ib and TNF-a) and chemokine CCL8 in BMDM in cell supernatants. Figure 7 ELISA results are shown in Figure 6B. As can be seen, knockdown of DHX58 significantly inhibited the secretion of inflammatory factors (IL-Ib and TNF-a) and chemokine CCL8 in BMDM in cell supernatants.

[0058] 5. In vivo study of the regulatory effect of targeting DHX58 on the inflammatory response of arthritic mice.

[0059] Adapted for one month, using DHX58 knockdown adenovirus to K / BxN STA mice in situ injection, randomly divided into two groups, namely the control group (injection of Nc-shRNA adenovirus) and model group (Dhx58-shRNA), and in the injection of adenovirus 2 days and 4 days respectively injection of K / BxN mouse serum to induce arthritis, modeling for 14 days, after the end of modeling to observe the mouse ankle swelling, and take pictures; modeling period every 2 days record once the mouse ankle swelling and joint swelling score, reflecting the knockdown of DHX58 on the inflammatory response of mice with arthritis; after the end of modeling, the mouse serum was collected, and the expression of inflammatory factors (IL-1β, CCL8 and TNF-α) in the serum was evaluated by ELISA experiment; the mouse ankle was collected, and the influence of knockdown of DHX58 on the inflammatory response of mice with arthritis was evaluated by micro-CT, HE staining and immunohistochemical experiment.

[0060] Joint swelling score: the forelimb score was 0-3, 0 for no swelling, 1 for mild swelling, 2 for moderate swelling, and 3 for severe swelling or even deformity; the hindlimb score was 0-4, 0 for no swelling, 1 for only red, 2 for mild swelling, 3 for moderate swelling, and 4 for severe swelling or even deformity.

[0061] Swelling degree measurement: the diameter value of 0.5mm below the left and right hind ankle joints of mice in each group was measured by vernier caliper. From the 0d of the first immunization, the swelling degree measurement was carried out every 2 days. The mouse with clinical score of one paw was 1 or above, which was considered as the onset.

[0062] Figure 8 The left column is the visual graph of the mouse ankle swelling degree, and the right column is the representative image of micro-CT. The results show that the ankle swelling degree and bone damage of the model group mice are significantly higher than those of the control group.

[0063] See Figure 9 , the HE staining results show that the inflammatory cell infiltration of the model group is obviously improved after knockdown of DXH58; the immunohistochemical results show that the secretion of DHX58, IL-1β and IL-6 of the model group mice is obviously reduced after knockdown of DHX58. See Figure 10 , the mouse ankle swelling degree and joint swelling score fold line graph and ELISA experiment results show that knockdown of DHX58 can obviously relieve the inflammatory response of mice. The above experiments show that DHX58 has application prospect as a rheumatoid arthritis treatment target.

[0064] The above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; even though the present application has been described in detail with reference to the foregoing embodiments, those ordinarily skilled in the art should understand that any modification, equivalent replacement and improvement made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. Application of the DHX58 gene or DHX58 protein as a molecular marker for screening, diagnosis, or prognosis assessment of rheumatoid arthritis.

2. Use of the DHX58 gene or DHX58 protein in the preparation of products for screening, diagnosis or prognosis assessment of rheumatoid arthritis.

3. The use according to claim 2, characterized in that The products include reagents and kits.

4. A product for screening, diagnosis or prognosis assessment of rheumatoid arthritis, characterized in that: The product is a reagent for detecting the mRNA expression level of DHX58 and / or the protein expression level of DHX58, or the product contains a reagent for detecting the mRNA expression level of DHX58 and / or the protein expression level of DHX58.

5. A product for screening, diagnosis or prognosis assessment of rheumatoid arthritis according to claim 4, characterized in that: The object of detection is selected from at least one of the following: peripheral blood, peripheral serum, synovial cells, synovial tissue, bone tissue, rheumatoid arthritis bone tissue or joint cavity synovial fluid.

6. The product according to claim 5, characterized in that When the test results show that the DHX58 mRNA expression level and / or the DHX58 protein expression level is significantly higher than the preset threshold value of the healthy control group, it indicates that the test subject has a risk of rheumatoid arthritis.

7. Use of an agent for inhibiting DHX58 gene expression in the preparation of a drug for treating rheumatoid arthritis.

8. The use according to claim 7, characterized in that The agent for inhibiting the expression of the DHX58 gene includes an RNA interference molecule targeting the DHX58 gene.

9. The use according to claim 8, characterized in that The RNA interference molecule targeting the DHX58 gene is siRNA or shRNA.

10. The use according to claim 8, characterized in that The RNA interference molecule targeting the DHX58 gene is a Dhx58-shRNA adenovirus, the sense chain sequence of which is shown in SEQ ID NO: 1, and the antisense chain sequence is shown in SEQ ID NO: 2.

Images