Identification primer group of lateolabrax japonicus dnd gene and application of identification primer group in identification of lateolabrax japonicus germ cells

By designing a specific identification primer set and kit for the dnd gene of the striped seabass, efficient identification and monitoring of the germ cells of the striped seabass were achieved, solving the problems of variety confusion and germplasm resource degradation, and promoting innovation in fish breeding models.

CN120796487APending Publication Date: 2025-10-17SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510902173.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-01
Publication Date
2025-10-17

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently and accurately distinguish the reproductive cells of striped sea bass, leading to problems such as variety confusion, germplasm resource degradation and reproduction difficulties. There is an urgent need for fish reproductive cell identification and transplantation technology.

Method used

A specific identification primer set and kit for the dnd gene of L. japonicus were designed and provided, and efficient identification and monitoring of L. japonicus germ cells were achieved through PCR amplification and agarose gel electrophoresis.

Benefits of technology

It has achieved efficient and accurate identification of the germ cells of the sea bass, supported the successful detection and monitoring of germ cell transplantation, solved the problems of variety confusion and germplasm resource protection, and provided a new model for fish breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120796487A_ABST
    Figure CN120796487A_ABST
Patent Text Reader

Abstract

The invention discloses an identification primer group of lateolabrax japonicus dnd genes and application of the identification primer group in identification of lateolabrax japonicus germ cells, and belongs to the technical field of fish germ cell identification. The complete cDNA sequence of the dnd gene of the lateolabrax japonicus is provided, a specific primer is obtained by comparing the cDNA sequence, and the germ cells of the lateolabrax japonicus can be quickly and accurately distinguished by utilizing a PCR (Polymerase Chain Reaction) technology. The primer group provided by the invention has strong specificity on the dnd gene of lateolabrax japonicus, and can efficiently and accurately distinguish germ cells of lateolabrax japonicus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of fish germ cell identification, and particularly relates to a set of identification primers for dnd gene of Epinephelus akaara and application thereof in identification of germ cells of Epinephelus akaara. BACKGROUND

[0002] Fish is hermaphroditic, and germ cell line and somatic cell line are separated in early embryonic development. The protogerm cell (pPGC) is a progenitor of germ cell, which produces two diploid daughter cells through asymmetric cell division, one of which becomes a primordial germ cell (PGC) and has the potential to proliferate and differentiate into sperm and oocyte cells, and is a progenitor of germ cell line; and the other one undergoes mitosis and becomes a progenitor of somatic cell line. Germ cells have developmental totipotency, and pass genetic information between generations through proliferation and differentiation. After PGCs are specialized, they are regulated by migration factors, reach a genital ridge (a cell specialized from somatic mesoderm, located on both sides of dorsal mesogastrium), and form a primitive gonad with surrounding somatic cells, which has the potential to differentiate into testis or ovary. Therefore, PGCs are an important genetic resource, and can provide materials for transplantation through cell transplantation technology to generate germ line chimeras.

[0003] Dead end (dnd) was first identified in zebrafish, which encodes an RNA binding protein and is one of the components of germ plasm specific to vertebrates, and is specifically expressed in germ line cells. Dnd is evolutionarily conserved, and the protein encoded by Dnd has six conserved domains: an N-terminal domain, an RRM (RNA Recognition Motif), and four C-terminal domains. Dnd plays an important role in the development of germ cells.

[0004] Lateolabrax maculatus is a marine fish with high economic value due to its high nutritional value. In recent decades, it has become one of the most important marine fish in China and is an excellent choice for deep-sea aquaculture in modern marine ranching. However, in recent years, the hybridization of different varieties of Lateolabrax maculatus has led to confusion in varieties, degradation of germplasm resources, reduction of genetic diversity, long growth cycle, and difficulty in reproduction. The protection of excellent germplasm resources of Lateolabrax maculatus and the demand for new breeding modes are increasingly prominent. The emergence of fish "parasitic reproduction" technology, combined with reproductive cell cryopreservation technology, opens up new ways for the preservation and efficient development and utilization of germplasm resources, and provides a new breeding mode for fish surrogate breeding. Therefore, the origin, migration, and identification of fish germ cells are still important topics in fish research. Studying the origin of germ cells in early embryonic development can promote further operations such as PGCs isolation, cryopreservation, and germ cell transplantation using PGCs as donors. SUMMARY

[0005] One of the purposes of the present application is to provide a Lateolabrax maculatus dnd gene identification primer set. The primer set has high specificity for the Lateolabrax maculatus dnd gene and can efficiently and accurately distinguish Lateolabrax maculatus from other fish.

[0006] The present application achieves the purpose through the following technical solutions: a Lateolabrax maculatus dnd gene identification primer set, comprising the following primers:

[0007] BdndF: ACCTTGAGCGTGTTCAGGAG

[0008] BdndR: GAGGTGTCTCTTCTCCGTGC.

[0009] The second purpose of the present application is to provide a Lateolabrax maculatus dnd gene identification kit.

[0010] The present application achieves the purpose through the following technical solutions: a Lateolabrax maculatus dnd gene identification kit, comprising reaction reagents and the following primer set:

[0011] BdndF: ACCTTGAGCGTGTTCAGGAG

[0012] BdndR: GAGGTGTCTCTTCTCCGTGC.

[0013] The third purpose of the present application is to provide the application of the Lateolabrax maculatus dnd gene identification primer set in identifying Lateolabrax maculatus germ cells.

[0014] The application realizes the purpose through the following technical scheme: application of the identification primer set of the Lateolabrax maculatus dnd gene in identifying the Lateolabrax maculatus germ cells, taking the cDNA of the Lateolabrax maculatus gonad as a template, performing PCR amplification on the dnd gene, and then identifying the Lateolabrax maculatus germ cells through the result of agarose gel electrophoresis; the primer set used in the PCR amplification is as follows:

[0015] BdndF: ACCTTGAGCGTGTTCAGGAG

[0016] BdndR: GAGGTGTCTCTTCTCCGTGC.

[0017] The reaction procedure is as follows: 95 DEG C, pre-denaturation for 5 min; 95 DEG C, denaturation for 15 s, 55 DEG C, annealing for 15 s, 72 DEG C, extension for 30 s, 30 cycles; 72 DEG C, extension for 5 min.

[0018] Beneficial effects

[0019] The primer set provided in the application has high specificity for the dnd gene of the Lateolabrax maculatus and can efficiently and accurately distinguish the germ cells of the Lateolabrax maculatus.

[0020] The primer set and the kit provided in the application can be used to detect whether the transplantation of the Lateolabrax maculatus germ cells is successful, identify the chimeric situation and efficiency of the germ cells, and monitor the development of the donor germ cells in the gonad of the receptor, which is an effective method for detecting the exogenous germ cells after transplantation and has a good market prospect. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 It is the Lateolabrax maculatus dnd nucleic acid sequence and predicted amino acid sequence. The full length of the Dnd cDNA is 1523 bp, including 84 bp of 5'UTR, 1158 bp of ORF, 386 amino acids of the encoded protein, and 281 bp of 3'UTR.

[0022] The start codon ATG, the stop codon TAA and the tail signal AATTAAA are in bold font.

[0023] Figure 2 It is the Lateolabrax maculatus dnd amino acid sequence alignment and phylogenetic tree analysis. A, dnd amino acid multiple sequence alignment, the box represents the conserved sequence and the functional site. B, dnd phylogenetic tree analysis, the number represents the confidence of each branch.

[0024] Figure 3 The Lateolabrax maculatus dnd gene is expressed in the embryonic development and each tissue of the adult fish.

[0025] A, RT-PCR results during embryonic development; B, RT-PCR results in different tissues; C, Testis paraffin section H&E staining; D, Testis paraffin section, dnd antibody hybridization; E, Ovary paraffin section H&E staining; F, Ovary paraffin section, dnd antibody hybridization. Sg: spermatogonia; Sc: spermatocytes; St: spermatids; Og: oogonia; I-II: previtellogenic oocyte; III, early vitellogenic oocyte; IV: mid vitellogenic oocyte; V: late vitellogenic oocyte. Scale bar, 50 μm.

[0026] Figure 4 Electrophoretogram of PCR amplification of dnd specific primers in half-quantitative in ovary cDNA of Lateolabrax japonicus, Danio rerio and Oryzias latipes

[0027] M: DNA Marker; Lane 1: blank group, 2-3: ovary of Lateolabrax japonicus; Lane 4-5: ovary of Danio rerio; Lane 6-7: ovary of Oryzias latipes. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the embodiments of the present application more clear, the technical scheme of the embodiments of the present application will be completely described below in combination with the drawings in the embodiments of the present application, so as to fully understand the purpose, effect and application prospect of the present application. The following embodiments are only used to illustrate the present application, and are not used to limit the application scope of the present application.

[0029] The technical scheme of the present application will be further described in detail below in combination with the drawings and specific embodiments.

[0030] 1. RNA extraction and cDNA first strand synthesis

[0031] Total RNA of different tissues and each period of embryonic development of Lateolabrax japonicus was extracted according to the instructions of Trizol (15596026CN, Invitrogen) reagent. After the concentration, purity and integrity of the extracted total RNA were detected, 1 μg of total RNA was used as a template for reverse transcription to synthesize cDNA first strand according to the instructions of the reverse transcription kit (KR118, Tiangen).

[0032] 2. Cloning of dnd gene

[0033] In the transcriptome database of the adult ovary of Lateolabrax japonicus, the spliced sequence of dnd was obtained according to the gene annotation information, and specific primers were designed according to the spliced sequence. The ovary cDNA of Lateolabrax japonicus was used as the template, and the specific primers were used for dnd open reading frame (ORF) (1158bp) amplification. The PCR reaction system was cDNA template 1 μL, 2 × Rapid Taq Master Mix 13 μL, upstream and downstream primers 0.1 μL each, ddH2O 9 μL, a total of 25 μL. The reaction program was as follows: 95℃, 5min (pre-denaturation); 95℃, 15s (denaturation), 55℃, 15s (annealing), 72℃, 1min (extension), 34 cycles; 72℃, 5min (extension). The reaction product was subjected to 1.5% agarose gel electrophoresis, stained with non-toxic nucleic acid dye (4S Green Plus), and then connected with pMD18-T vector overnight after Omega gel recovery. The E. coli competent DH-5α was transformed, positive clones were screened by colony PCR and sequenced.

[0034] Specific primers:

[0035] dndF: ATGGAGATGATGGAGAACAAGCGGAG,

[0036] dndR: TCAGTGGGCAAACTGGTTATTGTACACC.

[0037] 3. Sequence analysis and phylogenetic tree construction

[0038] The full-length dnd cDNA sequence obtained was analyzed for amino acid sequence and similarity using BLASTn and BLASTp in the NCBI database. Jalview 2.11 software and Clustal Omega (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo / ) were used for amino acid multiple sequence alignment. MEGA v5.2 software was used to construct a phylogenetic tree using the Neighbor-joining (NJ) method, and the data in the phylogenetic tree represent the bootstrap value (confidence) calculated randomly for 1000 times for phylogenetic analysis.

[0039] The dnd amino acid sequence of Lateolabrax japonicus contains six conserved motifs including the RNA recognition motif (RRM), and multiple sequence alignment analysis showed that the dnd of Lateolabrax japonicus has high homology with the dnd of other species: Oryzias latipes (77.43%), Oncorhynchus mykiss (76.46%), Homo sapiens (39.40%), Mus musculus (38.60%), Danio rerio (52.48%), Micropterus salmoides (88.70%), and Siniperca chuatsi (88.04%) Figure 2A) According to the dnd of Anabarbus gmelini and other 12 kinds of dnd homologous proteins, the N-J system evolution tree was constructed Figure 2 B) The value in the evolution tree represents the reliability of the tree. Analysis shows that the dnd family forms two branches: the branch of bony fish and the branch of quadruped. The dnd of Anabarbus gmelini belongs to the branch of bony fish.

[0040] 4. RACE to obtain the full-length sequence of dnd cDNA

[0041] According to the Clonetech SMARTer RACE cDNA amplification kit instructions, the ovarian cDNA was used as a template to synthesize 3' RACE cDNA and 5' RACE cDNA by reverse transcription. According to the dnd ORF fragment, gene-specific primers were designed for 5' RACE and 3' RACE PCR and splicing (DNAman software) to obtain the full-length gene (1523bp).

[0042] Specific primers:

[0043] 5' RACE-dnd: CAGCTCCTGAACACGCTCAAGGT,

[0044] 3' RACE-dnd: GGATAACGGCCGCCTTTGAAGGGC.

[0045] 5. Semi-quantitative RT-PCR study on the expression of dnd mRNA in different tissues and embryonic development periods

[0046] The cDNA obtained by reverse transcription of total RNA extracted from different tissues and embryonic development periods was used as the PCR template, and dnd semi-quantitative specific primers (377bp) were designed. β-actin (114bp) was used as an internal reference, the concentration of each template was adjusted, and the PCR conditions were optimized. The PCR reaction system is the same as above, and the optimized PCR program in tissues and embryos is: 95℃, 5min (pre-denaturation); 95℃, 15s (denaturation), 55℃, 15s (annealing), 72℃, 30s (extension), dnd gene (30 cycles), β-actin (25 cycles), 72℃ 5min (extension). The reaction products were electrophoresed on a 1.5% agarose gel, stained with nucleic acid dye, and photographed with a Bio-Rad gel imaging system.

[0047] Semi-quantitative specific primers:

[0048] BdndF: ACCTTGAGCGTGTTCAGGAG

[0049] BdndR: GAGGTGTCTCTTCTCCGTGC

[0050] β-actin F: CAACTGGGATGACATGGAGAAG

[0051] β-actin R: TTGGCTTTGGGGTTCAGG.

[0052] The expression of dnd gene during embryonic development was carried out by semi-quantitative RT-PCR. The results showed that dnd mRNA was highly expressed at the early stage of embryonic development, and the expression gradually decreased with the development of the embryo, and decreased in turn until it was not detected at the late stage of primitive gut. Figure 3 A) dnd mRNA was specifically expressed only in the gonad of adult fish, and was not expressed in other tissues Figure 3 B) To further understand the specific distribution of dnd protein in the process of gonad development, the dnd antibody prepared by the present application was used for immunohistochemical analysis of the gonad of Lateolabrax japonicus. The analysis results showed that dnd was strongly expressed in spermatogonia, gradually weakened in spermatocytes, and not expressed in sperm cells Figure 3 D) in the ovary. dnd mRNA was expressed at each stage of oocyte formation, but mainly concentrated in early oocytes (I-III oocytes), and the expression signal was weak in VI and V oocytes Figure 3 E).

[0053] The semi-quantitative dnd specific primer of Lateolabrax japonicus was used to extract RNA from the ovary of Lateolabrax japonicus, AB type zebrafish and marine blue guppy, and cDNA was synthesized by reverse transcription as the template for PCR. PCR was carried out. The Tm value was 58℃. Figure 4 It is shown that in the Lateolabrax japonicus sample, a fragment with an expected length of 377bp was successfully amplified, while the same primer failed to amplify the corresponding fragment in zebrafish and guppy. This proves that the primer has high species specificity and can be used for the study of Lateolabrax japonicus dnd gene. The above-described examples only express one embodiment of the present application, which is described in more detail and in more detail, but it cannot be understood as limiting the scope of the patent. It should be noted that for ordinary skilled in the art, without departing from the concept of the present application, a number of modifications and improvements can be made, which are within the scope of the present application.

Claims

1. A primer set for identifying the dnd gene of Lateolabrax japonicus, characterized by: The following primers are included: BdndF:ACCTTGAGCGTGTTCAGGAG BdndR:GAGGTGTCTCTTCTCCGTGC.

2. A kit for identifying the dnd gene of Lateolabrax japonicus, comprising a reaction reagent and the following primer set, characterized in that: The primer set is: BdndF:ACCTTGAGCGTGTTCAGGAG BdndR:GAGGTGTCTCTTCTCCGTGC.

3. The use of a primer set for identifying the dnd gene of Lateolabrax japonicus in identifying germ cells of Lateolabrax japonicus is characterized by: The dnd gene was amplified by PCR using the cDNA of the gonad of the Lateolabrax japonicus as a template, and then the germ cells of the Lateolabrax japonicus were identified by agarose gel electrophoresis. The primer set used for the PCR amplification was: BdndF:ACCTTGAGCGTGTTCAGGAG BdndR:GAGGTGTCTCTTCTCCGTGC.

4. The use of the identification primer set for the dnd gene of Lateolabrax japonicus according to claim 3 in identifying germ cells of Lateolabrax japonicus, characterized in that: The PCR reaction program was as follows: 95°C, pre-denaturation for 5 min; 95°C, denaturation for 15 s, 55°C, annealing for 15 s, 72°C, extension for 30 s, 30 cycles; 72°C, extension for 5 min.

Citation Information

Patent Citations

  • Molecular biological method of identifying lateolabrax japonicus

    CN103131766A

  • Primer and method for distinguishing germ cells of large yellow croaker and nibea albiflora

    CN116287292A

  • Dnd gene, identification primer group and application of dnd gene in identification of germ cells of grass carp and squaliobarbus curriculus

    CN118345083A

  • Application of lateolabrax japonicus DNA fingerprint spectrum in lateolabrax japonicus identification

    CN119662843A

  • Method for separating, purifying and transplanting spermatogonial stem cells of lateolabrax japonicus

    CN120699893A