Application of MFN2 gene molecular marker in detection of duck sperm forward nature

Abstract

The invention relates to application of an MFN2 gene molecular marker in detection of duck sperm forward nature, and belongs to the technical field of biology. SNP (Single Nucleotide Polymorphism) genotyping is carried out by utilizing a sequencing technology, and the MFN2 gene molecular marker remarkably related to duck sperm forward sex is obtained through whole genome association analysis and screening, so that a new gene and a new molecular marker resource are provided for duck sperm forward sex index breeding.

Description

TECHNICAL FIELD

[0001] The application relates to application of an MFN2 gene molecular marker in detection of duck sperm forward motility and belongs to the technical field of biotechnology. BACKGROUND

[0002] With the intensive development of waterfowl breeding and the continuous improvement of the demand for breeding selection, the reproductive performance of breeding ducks has become a key factor restricting the industrial benefit. Among the many indicators of reproductive performance, sperm forward motility is a core parameter for measuring the quality of sperm of breeding drakes. It directly reflects the potential of sperm to effectively move in the female reproductive tract, penetrate the outer barrier of oocytes and complete fertilization. The level of sperm forward motility not only directly affects the fertilization rate and hatching rate of breeding eggs, but also is the top priority for determining whether excellent breeding drakes can efficiently transmit genetic resources, reduce breeding costs and improve overall economic benefits.

[0003] Duck sperm forward motility is jointly regulated by a variety of complex factors. The genetic basis is the internal core that determines sperm quality, and there are significant differences in sperm motility among different breeds and even individuals within the same breed, which is closely related to key regulatory sites in the genome.

[0004] Therefore, in-depth analysis of the internal genetic mechanism affecting sperm forward motility and exploration of key regulatory genes and their functional molecular markers are of great significance for realizing precise breeding of breeding ducks and improving reproductive performance. Mitochondrial fusion protein 2 (Mitofusin 2, MFN2) gene is a key factor for regulating mitochondrial fusion. In the research of ducks and other waterfowl, there is no report on the direct correlation between the variation of a specific gene site of MFN2 and sperm forward motility, a key economic trait, and the potential of MFN2 as a molecular marker for early breeding of breeding ducks. SUMMARY

[0005] The purpose of the present application is to solve the problems in the prior art and provide an MFN2 gene molecular marker related to duck sperm forward motility and application thereof, which can quickly and accurately identify the level of duck sperm forward motility.

[0006] To achieve the above purpose, the application is implemented by the following technical scheme: application of a reagent for detecting an MFN2 gene molecular marker in detection of duck sperm forward motility, wherein the molecular marker is located at the 5456191th base of chromosome 22 of the duck reference genome GCF_015476345.1_ZJU1.0 version, and the molecular marker site has C / C, C / A and A / A polymorphism; the base mutation is C or A, and the 270th base is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0007] Further, the reagent comprises a primer pair, the primer pair comprises an upstream primer and a downstream primer, a nucleotide sequence of the upstream primer is shown as SEQ ID NO: 1, and a nucleotide sequence of the downstream primer is shown as SEQ ID NO: 2.

[0008] Further, the applied method comprises the following steps:

[0009] In step S1, the DNA sample of the duck to be tested is subjected to PCR amplification with a duck DNA-specific primer pair to obtain an amplification product, the duck DNA-specific primer pair comprises an upstream primer and a downstream primer, a nucleotide sequence of the upstream primer is shown as SEQ ID NO: 1, and a nucleotide sequence of the downstream primer is shown as SEQ ID NO: 2.

[0010] In step S2, the amplification product is subjected to Sanger sequencing.

[0011] In step S3, the molecular marker genotype of the target site is determined according to the sequencing result of step S2.

[0012] Further, in step S1, the final concentration of the reaction system for PCR amplification is 25 μl, and specifically comprises:

[0013]

[0014] The reaction conditions for PCR amplification are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 55℃ annealing for 30 sec, 72℃ extension for 60 sec, a total of 30 cycles; 72℃ extension for 2 min; and 20℃ storage.

[0015] Further, the length of the amplification product is 300 bp, and the amplification product contains the base at position 5456191 on chromosome 22 of the duck reference genome GCF_015476345.1_ZJU1.0 version 22.

[0016] Further, in step S3, the judgment standard is that the sperm forwardness of the duck with C / C genotype at the SNP site of the MFN2 gene is higher than that of the duck with C / A genotype and A / A genotype, and the sperm forwardness of the duck with C / A genotype is higher than that of the duck with A / A genotype.

[0017] The application detects the genotype of sperm fore direction of a duck by a MFN2 gene molecular marker, finds that the sperm fore direction of a C / C genotype individual at 43 weeks is higher than that of a C / A genotype individual and an A / A genotype individual, and the sperm fore direction of a C / A genotype individual is higher than that of an A / A genotype individual. By taking genomic DNA of a duck to be detected as a template, a specific primer pair is used for PCR amplification, then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and based on the genotype of the SNP molecular marker, the high and low sperm fore direction of a duck can be selected. In breeding, according to breeding goals, C / A genotype and A / A genotype individuals are eliminated, and C / C genotype individuals are reserved, and the beneficial effects are that the sperm fore direction of a duck can be efficiently and quickly identified, and a scientific basis is provided for early selection of high-quality ducks. In addition, the detection method disclosed by the application is simple and easy to operate, and can be carried out in a laboratory, and can also be applied to genomic breeding technology.

[0018] The application has the following beneficial effects: the application uses whole genome resequencing technology for SNP genotyping, and obtains a MFN2 gene molecular marker significantly related to sperm fore direction of a duck through whole genome association analysis screening, and provides a new gene and molecular marker resource for selection and breeding of sperm fore direction indicators of a duck. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 is a Manhattan plot of GWAS analysis of sperm fore direction of a duck at 43 weeks.

[0020] Figure 2 is a Sanger sequencing result of PCR amplification products of three genotypes.

[0021] Figure 3 is a phenotype distribution map of three genotypes of a chr22:5456191 molecular marker.

[0022] Upstream primer (SEQ ID NO: 1): 5'-TTGCCAGGCTTGTGCTCT-3'

[0023] Downstream primer (SEQ ID NO: 2): 5'-CATTGGATTATTGCGTATGA-3'

[0024] SEQ ID NO: 3

[0025] TTGCCAGGCTTGTGCTCTCATATTCTAATTCTTTTACATTATTTTTAATTCATAGGTTTTTTCATGCCGTTTAGGAAATGAACAAGAGACTGCACTGTCAATTATTGATCCAGTACAAATTCACGTGGAACTTCTTGAGAATCCTTCCTACCCACGTCATTCAGGACTGTTGGATGCTTTCAACAGTGGTGATTTTCCTCCTATTCTGGAGGTAATATTAAAGGACTGAATAAGACTATATGCAGTATAGGATACGTGATTGTAATCTTCTGCTGATTTTTCATACGCAATAATCCAATG

[0026] SEQ ID NO: 4

[0027] TTGCCAGGCTTGTGCTCTCATATTCTAATTCTTTTACATTATTTTTAATTCATAGGTTTTTTCATGCCGTTTAGGAAATGAACAAGAGACTGCACTGTCAATTATTGATCCAGTACAAATTCACGTGGAACTTCTTGAGAATCCTTCCTACCCACGTCATTCAGGACTGTTGGATGCTTTCAACAGTGGTGATTTTCCTCCTATTCTGGAGGTAATATTAAAGGACTGAATAAGACTATATGCAGTATAGGATACGTGATTGTAATCTTATGCTGATTTTTCATACGCAATAATCCAATG DETAILED DESCRIPTION

[0028] The application will be further described in conjunction with the following examples, but not as the basis for limiting the application.

[0029] Example 1

[0030] In this example, the sperm motility of 43-week-old Jingding gander was measured, SNP genotyping was performed by sequencing technology, and the MFN2 gene molecular marker significantly related to sperm motility was screened by whole genome association analysis, and the results are shown in Table 1. Figure 1

[0031] In this example, the MFN2 gene molecular marker related to duck sperm motility was identified and applied by the following experiments

[0032] 1. Phenotype determination and genotype detection​

[0033] (1) Experimental materials and determination of sperm forwardness phenotype

[0034] 366 Jingdinggong ducks were selected as experimental animals and were raised under the same feeding conditions. The whole process used free diet and drinking water. Semen was collected at 43 weeks of age, and the forwardness index of each duck sperm was detected using a full-automatic sperm analyzer as the phenotype data of duck sperm forwardness.

[0035] (2) Extraction of genomic DNA

[0036] Blood was collected from the subclavicular vein of the test individual after anticoagulation and lysis, and then digested with proteinase K. After extraction with saturated sodium chloride and dissolution in TE, it was stored at -20°C.

[0037] (3) PCR amplification

[0038] The fragment containing the SNP molecular marker at position 5456191 of duck chromosome 22 was amplified using the above extracted genomic DNA as the template.

[0039] Upstream primer: 5'-TTGCCAGGCTTGTGCTCT-3' (SEQ ID NO: 1)

[0040] Downstream primer: 5'-CATTGGATTATTGCGTATGA-3' (SEQ ID NO: 2) The final concentration of the reaction system (25 μl) was:

[0041]

[0042] The reaction conditions for PCR amplification were as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, a total of 30 cycles; 72°C extension for 2 min; 20°C storage; 10 μl was taken for agarose detection. The length of the single target band obtained by amplification was 300 bp, and it contained the 5456191th base of duck chromosome 22. The amplification product was as sequence SEQ ID NO: 3 or SEQ ID NO: 4, and the 270th base was mutated to C or A.

[0043] (4) Sequencing verification and genotyping

[0044] The PCR products of each sample were subjected to Sanger sequencing, respectively, and the sequencing peak chart is shown in Figure 2 .

[0045] (5) Determination of fertilization rate and hatching rate of fertilized eggs of individuals with different genotypes

[0046] From the 366 genotyped Jinding male ducks, 6 individuals of each C / C, C / A and A / A genotypes (a total of 18 individuals) were randomly selected, and the individuals were healthy and similar in weight (±5%). 180 female ducks of 300 days old with an egg laying rate of more than 90% for 3 consecutive weeks were selected, and the female ducks were randomly divided into 3 groups, 60 in each group, and were paired with C / C, C / A and A / A genotype male ducks respectively. All female ducks were fed with unified complete feed in the same environment, and the water was free. The ducks were pre-fed for 2 weeks to adapt to the environment. The semen of the male ducks was collected and mixed with the semen of 6 male ducks of the same genotype group, and the female ducks were artificially inseminated with a dose of 0.05 mL per duck (containing sperm number ≥3×10^7). After continuous insemination for 5 days, the eggs were collected for 3 weeks. The fertilization rate = (fertilized egg number / total incubation egg number) × 100%; the fertilized egg hatching rate = (hatched number / fertilized egg number) × 100%.

[0047] 2. Result analysis

[0048] 347 Jinding male ducks of 43 weeks old with clear sperm forwardness index records were selected for correlation analysis. The t.test test function of R 4.0 software was used for statistical test, and the average value comparison mode between each other was selected for statistical test of the genotypes and sperm forwardness of the test ducks, P<0.05 indicating significant difference, and P<0.01 indicating extremely significant difference. The results are shown in Tables 1 and Figure 3 As shown in Tables 1 and 2, among the detected individuals, there were 135 C / C genotypes, 103 C / A genotypes and 109 A / A genotypes, and the sperm forwardness of the individuals of the three genotypes at 43 weeks old was significantly different (P<0.01). The average sperm forwardness of the C / C genotype individuals at 43 weeks old was 0.662, which was significantly higher than that of the C / A and A / A genotype individuals (P<0.01), 0.021 higher than that of the C / A genotype individuals and 0.037 higher than that of the A / A genotype individuals. The average sperm forwardness of the C / A genotype individuals was 0.641, which was significantly higher than that of the A / A genotype individuals (P<0.01), 0.016 higher than that of the A / A genotype individuals.

[0049] As shown in Tables 2 and 3, the average fertilization rate of the C / C genotype individuals was 94.2%, and the average fertilized egg hatching rate was 91.8%, which was significantly higher than that of the C / A and A / A genotype individuals (P<0.05). The results showed that the duck MFN2 gene molecular marker was significantly related to the sperm forwardness of the duck, and affected the fertilization rate and the fertilized egg hatching rate. According to the actual breeding goal, the C / C genotype individuals can be selected to improve the sperm forwardness, fertilization rate and fertilized egg hatching rate of the duck, and the breeding efficiency can be improved.

[0050] Table 1. Association analysis of the molecular marker at position 5456191 on chromosome 22 with sperm forwardness

[0051] Genotype Number / animal 43 weeks old sperm forwardness Standard deviation CV C / C 135 0.662 a ]] 0.039 5.89％ C / A 103 0.641 b ]] 0.04 6.24％ A / A 109 0.625 c ]] 0.041 6.56％

[0052] Table 2. Association analysis of molecular marker at base pair 5456191 on chromosome 22 with fertilization rate

[0053] Genotype Fertilization rate Standard deviation CV C / C 94.2% a ]] 0.6 0.64％ C / A 93.2% b ]]> 0.7 0.75％ A / A 92.3% c ]]> 0.8 0.87％

[0054] Table 3. Association analysis of molecular marker at base pair 5456191 on chromosome 22 with hatching rate of fertilized eggs

[0055] Genotype Fertilized egg hatching rate Standard deviation CV C / C 91.8% a ]]> 0.5 0.54％ C / A 90.6% b ]]> 0.6 0.66％ A / A 89.5% c ]]> 0.7 0.78％

[0056] Note: The same column data with the same letter indicates no significant difference, and different letters indicate significant difference (P < 0.05).

[0057] The basic principles, main features and advantages of the present application are shown and described above. However, the above description is only a specific embodiment of the present application, and the technical features of the present application are not limited thereto. Any other embodiments obtained by those skilled in the art without departing from the technical solutions of the present application should be covered in the patent scope of the present application.

Claims

1. The use of a reagent for detecting the MFN2 gene molecular marker in detecting the forward tropism of duck sperm is characterized in that: The molecular marker is located at base 5456191 of chromosome 22 of the duck reference genome GCF_015476345.1_ZJU1.0 version, and the molecular marker site has C / C, C / A and A / A polymorphisms.

2. The use according to claim 1, characterized in that The reagent includes a primer pair, which includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO:

2.

3. The use according to claim 1, characterized in that The method of application comprises the following steps: Step S1, performing PCR amplification on a duck DNA sample to be tested using a duck DNA-specific primer pair to obtain an amplified product; the duck DNA-specific primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO: 2; Step S2, performing Sanger sequencing on the amplified product; Step S3: Determine the molecular marker genotype of the target site based on the sequencing results of step S2.

4. The use according to claim 3, characterized in that In step S1, the final concentration of the PCR amplification reaction system is 25 μl, specifically: The reaction conditions for PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 2 min; and storage at 20°C.

5. The use according to claim 3, characterized in that The amplified product is 300 bp in length and contains the 5456191st base on chromosome 22 of the duck reference genome GCF_015476345.1_ZJU1.0 version.

6. The use according to claim 3, characterized in that In step S3, the judgment standard is that the sperm forward orientation of ducks with C / C genotype at the MFN2 gene SNP site is higher than that of ducks with C / A genotype and ducks with A / A genotype, and the sperm forward orientation of ducks with C / A genotype is higher than that of ducks with A / A genotype.

Images