SNP (Single Nucleotide Polymorphism) marker for promoting chicken preadipocyte differentiation and identifying broiler chicken with high abdominal fat rate and application of SNP marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) marker for promoting chicken preadipocyte differentiation and identifying broiler chicken with high abdominal fat rate and application of the SNP marker, and belongs to the technical field of animal molecular genetics. The SNP marker for promoting the chicken preadipocyte differentiation and identifying the broiler chicken with the high abdominal fat rate comprises an SNP marker for promoting the chicken preadipocyte differentiation and identifying the broiler chicken with the high abdominal fat rate, the SNP marker takes a sequence as shown in SEQ ID NO.1 as a starting sequence, the site 51 is A or G, if the SNP is of a GG genotype, the broiler chicken is the broiler chicken with the high abdominal fat rate, and the A at the site 51 is replaced with G, so that the chicken preadipocyte differentiation is promoted. The method is mainly used for promoting chicken preadipocyte differentiation and identifying broilers with high abdominal fat rate.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of animal molecular genetics, and particularly relates to a SNP marker for promoting differentiation of chicken preadipocytes and identifying high abdominal fat rate broilers and application thereof. BACKGROUND

[0002] In the past more than half a century, the traditional breeding method of fast-growing white-feathered broilers through phenotypic value selection has made remarkable achievements in growth rate and meat yield. However, with rapid growth, the physiological maladaptation and related diseases of broilers have significantly increased, such as excessive accumulation of body fat, ascites syndrome, sudden death syndrome, leg disease, increased stress sensitivity, and decreased immune function. Among them, excessive accumulation of body fat in broilers has become a prominent problem. Excessive accumulation of fat in broilers not only reduces feed conversion efficiency and carcass lean meat rate, affects the yield of segmented meat, but also increases the burden of processors due to the disposal of excessive fat, even pollutes the environment, causing huge economic losses; and over-fatness in broiler breeders not only seriously affects the egg laying rate, fertilization rate and hatching rate, but also induces the occurrence of fatty liver syndrome and increases the dead-on-arrival rate during the laying period. Therefore, controlling the excessive accumulation of fat in the body of chickens and breeding low-fat broiler lines have become an important research topic in modern broiler breeding.

[0003] The genetic basis of chicken abdominal fat deposition characteristics is very complex, involving the interaction of numerous genes and genetic loci. From the perspective of breeding practice, genetic improvement is the fundamental solution to the problem of excessive abdominal fat deposition in chickens. However, traditional breeding methods have little effect in breeding low-fat broilers. In contrast, marker-assisted selection (MAS) has become a key technical means in modern breeding systems due to its precision and efficiency. Therefore, screening and identifying molecular markers that significantly affect the growth and development of abdominal adipose tissue in broilers, and selecting low abdominal fat rate individuals as breeders by removing high abdominal fat rate individuals through marker genotypes, can effectively improve the excessive accumulation of abdominal fat in offspring. SUMMARY

[0004] Therefore, the present application aims to provide a SNP marker for promoting differentiation of chicken preadipocytes and identifying high abdominal fat rate broilers and application thereof, so as to solve the problem of screening high abdominal fat rate broilers.

[0005] To achieve the above-mentioned purpose, the present application adopts the following technical solutions: The present application provides a SNP marker for promoting differentiation of chicken preadipocytes, wherein the SNP marker is a SNP marker with the sequence shown in SEQ ID NO. 1 as the starting sequence, and 51 is A or G.

[0006] The present application provides a primer combination for amplifying the above-mentioned SNP marker.

[0007] The application provides a recombinant vector containing the SNP marker.

[0008] Further limitation, the starting vector is pCMV-HA.

[0009] The application provides a recombinant microbial cell containing the SNP site.

[0010] The application provides a method for identifying broilers with high abdominal fat rate, and the steps of the method are as follows: Step 1: extracting DNA of broilers; Step 2: using the DNA obtained in step 1 as a template, and performing PCR reaction by using the primer combination; Step 3: performing genotype analysis on the PCR product obtained in step 2; if the genotype is GG, the broiler is a broiler with high abdominal fat rate.

[0011] The application provides a method for promoting differentiation of chicken preadipocytes, and the immortal chicken preadipocyte line 2 is transfected with the recombinant vector or the sequence shown in SEQ ID NO. 1 as a starting sequence, and A at position 51 is replaced by G.

[0012] Further limitation, the differentiation promotion is to increase the lipid content of the immortal chicken preadipocyte line 2 and promote the lipid droplet deposition of the immortal chicken preadipocyte line 2.

[0013] The application provides application of the SNP marker, the primer combination, the recombinant vector or the recombinant microbial cell in genetic breeding related to promotion of differentiation of chicken preadipocytes and identification of broilers with high abdominal fat rate.

[0014] Further limitation, the chicken preadipocyte is the immortal chicken preadipocyte line 2.

[0015] Compared with the prior art, the application has the beneficial effect that the G allele of the FADS2 gene A>G site is beneficial to promote differentiation of chicken preadipocytes, the A allele has no effect on differentiation of chicken preadipocytes, and the G allele only exists in broilers with high fat line (high abdominal fat rate). BRIEF DESCRIPTION OF DRAWINGS

[0016] The drawings constituting a part of the application are used to provide further understanding of the application, the schematic embodiments of the application and the description thereof are used to explain the application, and do not constitute improper limitation on the application. In the drawings: Figure 1 It is a comparison result diagram of relative reporter gene activity of the FADS2 gene 5:16345061 A>G site; Figure 2 It is a structure diagram of pCMV-FADS2 fusion plasmid; Figure 3 Figure 4 is a diagram of the results of enzyme digestion identification of pCMV-FADS2-A and pCMV-FADS2-G plasmids; Note: a) enzyme digestion identification of CDS fragment; b) enzyme digestion identification of CDS + mutation site fragment; c) enzyme digestion identification of mutation site fragment (1: pCMV-FADS2-A plasmid enzyme digestion map; 2: pCMV-FADS2-A plasmid; 3: pCMV-FADS2-G plasmid enzyme digestion map; 4: pCMV-FADS2-G plasmid); Figure 4 Figure 5 is a diagram of sequencing results of pCMV-FADS2-A and pCMV-FADS2-G plasmids; Note: a) pCMV-FADS2-A sequencing results; b) pCMV-FADS2-G plasmid sequencing results (blue box represents FADS2 gene CDS region stop codon; red box represents SNP site); Figure 5 Figure 6 is a diagram of protein expression of pCMV-FADS2-A and pCMV-FADS2-G plasmids; Note: 1: pCMV-FADS2-A; 2: pCMV-FADS2-G; 3: pCMV-FADS2; 4: pCMV-HA; 5: ICP2 cells; Figure 6 Figure 7 is a diagram of the effects of pCMV-FADS2-A and pCMV-FADS2-G plasmids on chicken preadipocyte differentiation; Note: a) oil red O staining results (160 μM); b) oil red O extraction colorimetric results at different time points; c) 24 h differentiation oil red O extraction colorimetric results; d) 48 h differentiation oil red O extraction colorimetric results (scale in the figure is 200 μm, * indicates significant difference (P < 0.05), ** indicates extremely significant difference (P < 0.01)); Figure 7 Figure 8 is a diagram of agarose gel electrophoresis detection of PCR products. DETAILED DESCRIPTION

[0017] ICP2 cells are successfully constructed immortalized chicken preadipocyte cell lines, and the source document is Wang W, Zhang T, Wu C, Wang S, Wang Y, Li H, Wang N. Immortalization of chicken preadipocytes by retroviral transduction of chicken TERT and TR. PLoS One. 2017 May 9;12(5):e0177348. doi: 10.1371 / journal.pone.0177348. PMID: 28486516; PMCID:PMC5423695. The research material used in the present application is Northeast Agricultural University broiler abdominal fat bidirectional selection line-high fat line and low fat line (hereinafter referred to as high and low fat line), which is the only fast large white type broiler abdominal fat bidirectional selection line in China, established by taking AA ancestral broiler as the material, abdominal fat rate and plasma very low density lipoprotein content as the selection index. The line has been selected for 29 generations from 1996 to now. The statistical analysis results show that the abdominal fat rates of the high and low fat lines have shown significant differences since the 4th generation. At the 27th generation, the abdominal fat rate of the high fat line was 6.44±0.07%, and that of the low fat line was 0.45±0.01%.

[0018] Example 1. Take FADS2 The 100bp fragment of 50bp upstream and downstream of the SNP 5:16345061 A>G site, Wild type: GGTGCTCACATTTCCCAATTAATTGCTAGTCTCTGATTGGCCAACAGCTG A GATAGGAACACTGGTTTTGCTCAGATACCCACAAAGTGAGAAGAAACCAG (SEQ ID NO. 1); Mutant type: GGTGCTCACATTTCCCAATTAATTGCTAGTCTCTGATTGGCCAACAGCTG G GATAGGAACACTGGTTTTGCTCAGATACCCACAAAGTGAGAAGAAACCAG (SEQ ID NO. 2), inserted into the multiple cloning site downstream of the sea lamprey gene of the psi-CHECK II vector, and the different allele luciferase reporter gene plasmids psi- FADS2 -A and psi- FADS2 -G.

[0019] (1) Construct the vector: extract the abdominal fat tissue RNA of Lin Dian chicken and reverse transcribe it into cDNA (reverse transcription reagent: Yixing Hieff UNICON Universal Blue qPCR SYBR Green Master Mix). Amplify the FADS2The full-length gene (primer sequence: F: tggccatggaggcccGAATTCGGATGGGGAAGGGGGGCGAG, SEQ ID NO.3; R: ccgcggccgcggtacCTCGAGTCACGGAGGTAAGCATCCA, SEQ ID NO.4). (Amplification enzyme: TaKaRaEx Premier™ DNA Polymerase) was used to amplify the obtained FADS2 The full-length gene fragment was connected to the pCMV-HA empty vector, and the two enzyme cutting sites were EcoR Ⅰ and Xho Ⅰ, obtain pCMV- FADS2 Plasmid. psi- FADS2 -A (containing FADS2+ SEQ NO.1 vector), psi- FADS2 -G (contains FADS2+ SEQ NO.2 vector), pCMV- FADS2 -A (containing FADS2+ SEQ NO.1 vector) and pCMV- FADS2 -G (containing SEQ FADS2+ NO.2 carriers) are all synthesized by the company.

[0020] The psi- FADS2 -A and psi- FADS2 -G plasmids were transfected into ICP2 cells, and the activities of Renilla and Firefly luciferase were measured 48 hours later. FADS2 -A group had no significant difference in relative luciferase activity; psi- FADS2 -G group and control group and psi- FADS2 -A group, the relative luciferase activity was significantly increased ( Figure 1 ), indicating that the SNP site is a functional SNP.

[0021] In pCMV- FADS2 Based on the eukaryotic expression plasmid, a DNA fragment containing 100 bp upstream and downstream of the SNP A>G site was inserted into the pCMV- FADS2 Plasmid FADS2 Downstream of the CDS region, a construct containing FADS2 The fusion plasmid pCMV- FADS2 -A and pCMV- FADS2 -G Figure 2 ).go through Xho Ⅰ and NotI The 100 bp DNA fragments upstream and downstream of the mutant site A allele and G allele were subjected to enzyme digestion verification, and the results showed that the size of the enzyme digestion fragments was consistent with the expected size Figure 3 ).

[0022] The plasmids subjected to correct enzyme digestion were subjected to Sanger sequencing. The sequencing results showed that the 100 bp DNA fragments upstream and downstream of the mutant site A allele and G allele were inserted after the stop codon of the CDS region, indicating that the plasmid construction was successful FADS2 . Figure 4 ).

[0023] The two plasmids pCMV-FADS2-A and pCMV-FADS2-G with correct sequencing were transfected into ICP2 cells, and proteins were extracted after 24 h. Western Blot verification showed that the pCMV-FADS2-A and pCMV-FADS2-G plasmids could express proteins, and the size was the same as that of the pCMV-FADS2 plasmid without inserting the 100 bp fragments of the two alleles Figure 5 ), indicating that the insertion of the 100 bp DNA fragments upstream and downstream of the alleles did not affect the size of the FADS2 protein. These results proved that the two plasmids pCMV-FADS2-A and pCMV-FADS2-G were successfully constructed.

[0024] (2) Transfection and induction of differentiation. The well-grown immortalized chicken preadipocyte cell line 2 (ICP2) cells were plated in a 12-well plate, and when the cells grew to 50%, the KeygenMax 3000 transfection reagent was used for transfection. The induction medium containing 160 μM oleic acid was replaced at 6 h after transfection (referred to as differentiation 0 h), and the new induction medium was regularly replaced every 24 h to maintain the differentiation process.

[0025] (3) Oil red O staining and extraction of colorimetric ① Take the 12-well plate as an example, discard the cell culture medium, wash with PBS for 3 times, and add 4% paraformaldehyde 500 μL per well for fixation for 30 min. At this time, prepare the oil red O working solution, i.e. mix the oil red O stock solution and sterilized water 3:2 thoroughly, and filter for use (presently prepared); ② Discard the fixing solution, wash with PBS for 3 times, and place in a 65°C oven for drying; ③ Add oil red O working solution 500 μL per well, and avoid light for 15 min of staining; ④ Discard the oil red O working solution, wash with PBS for 3 times, and add 60% isopropanol 500 μL per well, and discard immediately; ⑤ After washing with PBS for 2 times, take a photo under an inverted microscope; ⑥Discard PBS, add 100% isopropanol 500 μL per well, shake on a horizontal shaker at room temperature for 15 min; ⑦Absorb isopropanol, measure OD value at 510 nm (OD510) using a microplate reader.

[0026] (4) Cell number correction of oil red O extraction colorimetric results Before oil red O extraction colorimetry, the OD value of each well of cells (OD450) was measured at 450 nm using a cell counting Kit-8 reagent kit (APExBIO). The final result of oil red O extraction colorimetry was expressed as: OD510 / OD450.

[0027] (5) Luciferase activity detection The Biyun Tian Dual-Lumi™ II dual luciferase reporter gene detection kit (RG089S) was used, and the detection process was as follows: Sample pretreatment: ①Discard the culture medium after transfection for 48 h, and wash the residual liquid with PBS.

[0028] ②Accurately add 100 μL 1×PLB lysis solution per well.

[0029] ③Use a shaker to shake at 450 rpm at room temperature for 15 min.

[0030] ④Transfer the lysis solution to a centrifuge tube, centrifuge at 12,000 rpm at 4°C for 10 min to take the supernatant.

[0031] Dual luciferase detection: ⑤Firefly detection system: 10 μL LARII working solution + 20 μL supernatant, vortex well after detection Fluc activity value.

[0032] ⑥Renilla detection system: add 20 μL Stop&Glo to the above system, vortex well after detection Rluc activity value.

[0033] Data analysis: ⑦Calculate relative activity: Rluc activity value / Fluc activity value.

[0034] (6) Western blot Cell total protein extraction: ①Take the 12-well plate as an example. After the cell culture medium was absorbed, the cells were washed with PBS for 3 times, 100 μL of 0.25% trypsin and 0.04% EDTA mixed digestion solution was added per well, and the cells were digested at room temperature for 1 min, then a small amount of basic culture medium was added to terminate the digestion; ②Collect the digested cells into 1.5 mL EP tubes, centrifuge at 4500 rpm for 10 min, discard the supernatant, add 80 μL RIPA protein lysis solution (containing 1% PMSF), mix well, and lyse on ice for 30 min, and store at -80 ℃ for use.

[0035] Western Blot: ①Gel preparation: use the Yezengel reagent kit to prepare a gel with a concentration of 10% for separation.

[0036] ②Electrophoresis: Add an appropriate amount of electrophoresis solution to the electrophoresis tank. Add 80 μg of protein sample or 5 μL of protein Marker to each well. Set the electrophoresis conditions to 90 V constant voltage for 30 min. Then adjust the voltage to 120 V and continue electrophoresis for 60 min.

[0037] ③Membrane transfer: After electrophoresis, accurately measure the area of the target protein on the gel. According to the measured size, cut a NC membrane that matches the size of the target protein gel area. Soak filter paper, NC membrane and sponge in transfer buffer. Stack them in the order of sponge, filter paper, gel, NC membrane, filter paper, and sponge, making sure there are no air bubbles between each layer. Place the assembled transfer clamp into the transfer tank, add 1 L of 1x transfer buffer, and add ice to keep the temperature low. Set the transfer conditions to 200 mA, constant current, and transfer for 1 h.

[0038] ④Blocking: After transfer, wash the NC membrane with PBST 3 times for 5 min each. Place the NC membrane in 5% skimmed milk powder at room temperature for blocking for 2 h. After blocking, wash the NC membrane with PBST 3 times for 5 min each.

[0039] ⑤Primary antibody incubation: Place the NC membrane in the primary antibody solution diluted 1:1000 and incubate at 4°C overnight.

[0040] ⑥Secondary antibody incubation: After removing the primary antibody, place the NC membrane on a shaker and wash with PBST 4 times for 5 min each. Dilute the HRP-labeled secondary antibody with 5% skimmed milk powder to a ratio of 1:5000. Place the NC membrane in the diluted secondary antibody and incubate at room temperature for 1 h.

[0041] ⑦Exposure and color development: After removing the secondary antibody, place the NC membrane on a shaker and wash with PBST 4 times for 5 min each. Prepare the working solution of the hypersensitive ECL chemiluminescence liquid (mix A and B at a ratio of 1:1). Uniformly cover the working solution on the NC membrane and incubate for 1 min. Place the NC membrane in the gel imaging system for photographing and recording.

[0042] (7) Design primer software Primer Premier 5, basic parameters for primer design: ①Primer length 18~30 bp; ②Tm value 55~65℃, annealing temperature 60℃ or so; ③GC content 40~70%. ④Special attention to avoid primer dimer and the presence of non-specific amplification; ⑤Avoid consecutive 4 bases, especially G and C, 3' end of the last 5 bases do not appear more than 3 G or C; ⑥Primer sequence as follows: FADS2-F: GCTGGGAGAAACATAGGAAGG (SEQ ID NO. 5); FADS2-R: ACAATTCCTAGGGAACACTTG (SEQ ID NO. 6); (8) PCR reaction system as shown in Table 1: Table 1

[0043] (9) PCR reaction conditions as shown in Table 2: Table 2

[0044] PCR product size: 298 bp.

[0045] (10) Electrophoresis detection: PCR product 5 μl, preparation of 1% agarose gel electrophoresis detection. Electrophoresis parameters: 150 V, 100 mA, 10~20 min; gel imaging system to observe the electrophoresis band, the results as shown in Figure 7 .

[0046] (11) Sequencing: ① PCR product purification and recovery The purpose of PCR band cut gel recovery, method see SanPrep column DNA gel recovery kit (Sheng Wu B518131).

[0047] ②Data analysis Find the results in the result group, and use sequence analysis software for analysis, to confirm the genotype.

[0048] In order to verify FADS2 the effect of gene 5:16345061 A>G site on chicken preadipocyte differentiation, pCMV- FADS2 -A and pCMV- FADS2-G plasmids were transfected into ICP2 cells, and ICP2 cells transfected with pCMV-HA plasmid were used as the control group. Oleic acid was added 6 h after transfection to induce cell differentiation, which was defined as differentiation 0 h. Oil Red O staining and Oil Red O extraction colorimetry were then used to detect changes in lipid deposition in cells after 24 h and 48 h of differentiation. Oil red O staining results showed that during the differentiation of chicken preadipocytes, the pCMV- FADS2 -A group overexpressed pCMV- FADS2 -G group had significantly increased lipid droplet deposition ( Figure 6 a). At the same time, the results of Oil Red O extraction colorimetry showed that in 0-48h, whether pCMV- FADS2 -Group A or pCMV- FADS2 -G group lipid content continued to increase, indicating normal cell differentiation ( Figure 6 b); At 24 h of differentiation, overexpression of pCMV- FADS2 The lipid content in the cells of group -G was significantly higher than that in group pCMV- FADS2 -Group A (P<0.05, Figure 6 c); At 48 h of differentiation, overexpression of pCMV- FADS2 The lipid content in the cells of group G was significantly higher than that in the cells overexpressing pCMV- FADS2 -A group cells and control group ( P <0.01, Figure 6 d). Description FADS2 The G allele at the A>G locus of the gene is beneficial to promoting the differentiation of chicken preadipocytes, while the A allele has no effect on the differentiation of chicken preadipocytes.

[0049] Example 2. Method for identifying broilers with high abdominal fat content Step 1: Extract genomic DNA from wing vein blood of broiler chickens; Step 2: Using the DNA obtained in step 1 as a template, perform a PCR reaction using the primer combination shown in SEQ ID NO. 3 and SEQ ID NO. 4; Step 3: The PCR product obtained in Step 2 is subjected to genotyping analysis. If the genotype is GG, it indicates that the chicken has a high abdominal fat percentage (containing the gene described in SEQ ID NO. 2). This is consistent with the abdominal fat percentage of the broiler sample.

[0050] In the 19th, 23rd, and 27th generation individuals of the high- and low-abdominal-fat bidirectional selection lines of broiler chickens bred at Northeast Agricultural University, the G allele was only present in the high-fat line (Table 3).

[0051] Table 3

[0052] The detailed description of the application set forth above merely exemplifies the application. The detailed description set forth is not intended to be all-inclusive of the aspects of the application. A person having ordinary skill in the art can make modifications and variations to the application as described. It is contemplated that the application encompassed by the following claims can include these modifications and variations. The embodiments selected for the purposes of example are intended to illustrate the principles of the application and to enable others skilled in the art to best utilize the application.

Claims

1. A SNP marker for promoting chicken preadipocyte differentiation, characterized in that: The SNP marker is based on the sequence shown in SEQ ID NO. 1, with position 51 being A or G.

2. A primer combination for amplifying the SNP marker according to claim 1, characterized in that: The primer combination is shown in SEQ ID NO.3 and SEQ ID NO.

4.

3. A recombinant vector containing the SNP marker according to claim 1.

4. The recombinant vector according to claim 1, characterized in that The starting vector is pCMV-HA.

5. A recombinant microbial cell containing the SNP site according to claim 1.

6. A method for identifying broilers with high abdominal fat content, characterized in that: The steps of the method are as follows: Step 1: Extract DNA from broiler chickens; Step 2: Using the DNA obtained in step 1 as a template, perform a PCR reaction using the primer combination of claim 2; Step 3: Perform genotyping analysis on the PCR product obtained in step 2; if the genotype is GG, it indicates a broiler with a high abdominal fat rate.

7. A method for promoting the differentiation of chicken preadipocytes, characterized in that: In the immortalized chicken preadipocyte cell line 2, the sequence shown in SEQ ID NO. 1 is used as the starting sequence, and the A at position 51 is replaced with G, or the recombinant vector according to claim 3 or 4 is transfected into the immortalized chicken preadipocyte cell line 2.

8. The method according to claim 7, characterized in that Promoting differentiation increases the lipid content of immortalized chicken preadipocyte line 2 and promotes lipid droplet deposition of immortalized chicken preadipocyte line 2.

9. Use of the SNP marker according to claim 1, the primer combination according to claim 2, the recombinant vector according to claim 3 or 4, or the recombinant microbial cell according to claim 5 in promoting chicken preadipocyte differentiation and identifying genetic breeding related to high abdominal fat percentage broilers.

10. The use according to claim 9, characterized in that Chicken preadipocytes were immortalized chicken preadipocyte line 2.

Images