PCR (Polymerase Chain Reaction) primer group, kit and method for rapidly identifying parabramis pekinensis, megalobrama amblycephala and hybrids thereof

Abstract

The invention discloses a PCR (Polymerase Chain Reaction) primer group, kit and method for rapidly identifying parabramis pekinensis, megalobrama amblycephala and hybrids thereof, and particularly belongs to the technical field of molecular biology identification, the primer group comprises a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown as SEQ ID No: 1, and the nucleotide sequence of the reverse primer R is shown as SEQ ID No: 2. Through the kit and the method designed by the PCR primer group, rapid identification of parabramis pekinensis, megalobrama amblycephala and hybrids thereof is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological identification, and particularly relates to a PCR primer set, a kit and a method for rapidly identifying bream, bighead carp and their hybrids. Background Art

[0002] The Changchun bream and the amblycephalus, belonging to the genera Bream and Megalobrama, respectively, of the order Cypriniformes and subfamily Catulinae, family Cyprinidae, are widely distributed across my country and are important freshwater fish species found in rivers and lakes in eastern my country. Both species are known for their delicious, nutritious meat, rapid growth, and high survival rates in aquaculture. They are now being promoted nationwide as high-quality aquaculture species.

[0003] In terms of reproduction, Changchun bream lay floating eggs, while amblycephalic bream lays sticky eggs. Due to their similar breeding seasons, overlapping habitats, and the influence of non-compliant stocking practices, natural hybridization can occur in the absence of human intervention, leading to the further decline and mixing of my country's bream and amblycephalic bream germplasm resources. Therefore, to restore wild resources and protect wild populations, several provinces and cities have included Changchun bream and amblycephalic bream in lists of species for stocking. Simultaneously, efforts are underway to develop and utilize wild germplasm resources and collect and preserve wild broodstock.

[0004] Currently, identification of bream species is primarily based on morphological recognition and molecular markers. For example, reference 10.3724 / SP.J.1118.2017.16100 published comparative growth and morphological analyses of hybrid offspring between Megalobrama amblycephala and Megalobrama triangularis or Megalobrama changchunensis. The results showed that the hybrid offspring were morphologically similar to their parent species. Another example, reference 10.3724 / SP.J.1231.2014.4888, reported on the construction of microsatellite DNA fingerprints and genetic structure analysis for different bream populations. Based on 60 microsatellite marker primer pairs reported in the literature, cross-population PCR validation was performed to develop universal microsatellite primers for various bream species, including Megalobrama amblycephala and Megalobrama changchunensis, and conduct population genetics analysis. Furthermore, DNA fingerprinting technology developed using 18 universal microsatellite loci can provide a reference for hybridization and parentage identification in bream species. For example, document 10.27158 / d.cnki.ghznu.2022.000662 published the development of mitochondrial single nucleotide polymorphisms (SNPs) in Changchun bream, bighead carp and their hybrids. Through PCR amplification, sequencing and sequence comparison, some SNP sites with species identification functions can be screened.

[0005] For the breeding, breeding promotion and stocking of Procyprinus and Megalobrama, the above methods have great defects: 1. The hybrid offspring of Procyprinus and Megalobrama are similar to the mother in morphological characteristics, and the characteristics are based on the premise of fully developed individuals. Procyprinus and Megalobrama are both fish with lateral body shape, which are extremely similar in visible characteristics, and mainly rely on morphological measurement and statistics for identification, which is extremely dependent on the professional quality and measurement and statistics level of the operator in actual operation, and cannot be quickly implemented; 2. In the water stage, purebred fry and hybrid fry are both transparent and translucent in incomplete development, and the morphological characteristics are more blurred, and even cannot be measured and counted in morphology; 3. Microsatellite marker technology is mainly used for population genetic structure and pedigree analysis in aquaculture, and there is no report on a single microsatellite marker with the identification function of Procyprinus and Megalobrama hybrid. The DNA fingerprint identification of Procyprinus and Megalobrama relies on multiple microsatellite sites, which needs sequencer or capillary electrophoresis and other advanced instruments and equipment, which has the problems of large workload, long cycle and is not conducive to efficient and rapid identification in actual production. 4. The technology of mitochondrial SNP method for identifying Procyprinus, Megalobrama and their hybrids also needs PCR, sequencing and sequence alignment, which is not conducive to efficient and rapid identification in actual production. Therefore, the traditional morphological identification and molecular markers cannot meet the current actual demand, and it is urgent for researchers to develop hybrid reagent kits and identification methods.

[0006] Therefore, how to quickly identify and confirm the fish information from the morphologically similar Procyprinus, Megalobrama and their hybrids at one time is a problem to be solved by workers in the process of protecting wild germplasm resources. SUMMARY

[0007] The application provides a PCR primer group, a kit and a method for quickly identifying Procyprinus, Megalobrama and their hybrids, which realizes the rapid identification of Procyprinus, Megalobrama and their hybrids through the kit and the method designed by the PCR primer group.

[0008] The purpose of the application is achieved by the following technical solutions: The PCR primer group for quickly identifying Procyprinus, Megalobrama and their hybrids comprises a forward primer F and a reverse primer R, the nucleotide sequence of the forward primer F is shown in SEQ ID No: 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No: 2.

[0009] SEQ ID No: 1 GGCCCACCAAGATACTTCAGA; SEQ ID No: 2 CCCCTGTGAAAACCCCCTTA.

[0010] The application further provides a kit for identifying Siniperca chuatsi, Ictalurus pellatus and their hybrid, comprising the PCR primer set, ddH2O and 2x Taq PCR Mix; wherein the concentration of the forward primer F in the PCR primer set is 10 µmol, and the concentration of the reverse primer R is 10 µmol.

[0011] Preferably, the concentration of the forward primer F is 10 µmol, and the concentration of the reverse primer R is 10 µmol.

[0012] Preferably, the reaction conditions of the PCR are as follows: pre-denaturation at 95℃ for 3 min, denaturation at 94℃ for 10 s, annealing at 56℃ for 30 s, extension at 72℃ for 45 s, a total of 35 cycles, and finally extension at 72℃ for 5 min, and the product is cooled to 4℃ to end the reaction.

[0013] Preferably, the kit is used for (a1) and (a2) as follows: (a1) identifying Siniperca chuatsi, Ictalurus pellatus and their hybrid; (a2) detecting whether the DNA sample to be tested is derived from Siniperca chuatsi, Ictalurus pellatus and their hybrid.

[0014] Compared with the prior art, the technical scheme of the application has the following advantages or beneficial effects: 1. The application develops a PCR primer set for rapidly identifying Siniperca chuatsi, Ictalurus pellatus and their hybrid, and by using the primer set and simple PCR amplification, Siniperca chuatsi, Ictalurus pellatus and their hybrid can be rapidly identified and distinguished at the molecular level. Compared with the prior art, the application has the characteristics of rapidness, accuracy and high efficiency, and is more suitable for practical application.

[0015] 2. By rapidly identifying Siniperca chuatsi, Ictalurus pellatus and their hybrid from Siniperca chuatsi, Ictalurus pellatus and their hybrid, respectively, the technical personnel can conveniently control the germplasm of the released fry, and the production of hybrid fry can be prevented in advance in fry production. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Fig. 2 shows the PCR electrophoresis detection results in the examples. DETAILED DESCRIPTION

[0017] The embodiments of the application will be described in detail below with reference to the accompanying drawings and examples, so that the implementation process of how the application applies technical means to solve technical problems and achieves corresponding technical effects can be fully understood and implemented. The embodiments of the application and each feature in the examples can be combined with each other without conflict, and the formed technical scheme is within the protection scope of the application.

[0018] It should be clear that the embodiments described below are only some of the embodiments of the present application, but not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0019] Embodiment 1: Screening of microsatellite loci of Siniperca kneri Based on the T2T (telomere-to-telomere) genome of Siniperca kneri tested by the team, the genome size is 1.0 G, the N50 value is 36.79 MB, and the genome of 24 pairs of chromosomes of Siniperca kneri is mounted. The MISA software is used to screen the microsatellite loci of the T2T genome of Siniperca kneri. The screening standard is that one nucleotide is at least 10 repeats, two nucleotides are at least 6 repeats, three and four nucleotides are at least 5 repeats, five and six nucleotides are at least 5 repeats, and less than 100 bp between two microsatellite loci is considered as one microsatellite locus. A total of 366939 microsatellite loci are screened in the T2T genome of Siniperca kneri, and the total frequency is 358.74·Mb -1 .

[0020] Embodiment 2: Design of microsatellite primers of Siniperca kneri and e-PCR The upstream and downstream sequences of 250 bp of the microsatellite loci are extracted, and the primer3 software is used for batch primer design, in which the amplification fragment length is 80-1800 bp, the primer size is 20-27 bp, the primer GC content is 35-65%, the optimum is 50%, the TM value is 55-65℃, the optimum is 57℃, and 3 pairs of primers are designed for each microsatellite marker site. The e-PCR software is used to detect the number of potential binding sites of the designed primers. A total of 196830 microsatellite markers successfully designed primers.

[0021] Embodiment 3: Screening of microsatellite marker loci for identification of Siniperca kneri, Megalobrama amblycephala and their hybrid Through e-PCR of Megalobrama amblycephala, the results with 1 binding site and 0 number of alignment gaps (Gaps) are screened, and a total of 192025 microsatellite markers successfully designed primers. 50 pairs of e-PCR detection suitable primers are screened, and ordinary primers are first synthesized to perform preliminary detection on 1 tail of DNA of Siniperca kneri, Megalobrama amblycephala and hybrid. The PCR reaction system is genomic DNA (concentration 50 ng·µL -1) 0.5 µL, 2× Taq PCR Mix (Tiangen Biochemical Technology (Beijing) Co., Ltd.) 10 µL, 0.8 µL each of upstream and downstream primers (10 µmol), and ddH2O to 20 µL. PCR reaction conditions were 35 cycles of initial denaturation at 95°C for 3 minutes, denaturation at 94°C for 10 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 45 seconds. A final extension at 72°C for 5 minutes was performed, and the product was cooled to 4°C to terminate the reaction. 2 µL of the reaction product was electrophoresed on a 1.5% agarose gel at 130 V for 30 minutes, and the gel was then photographed. Initial screening identified one suitable microsatellite identification locus: repeat core (TA) 7, located on chromosome 4 of the amblycephalic bream, with a start site at 19806532 and a stop site at 19806545. Forward primer F: GGCCCACCAAGATACTTCAGA (shown in SEQ ID NO. 1), reverse primer R: CCCCTGTGAAAACCCCCTTA (shown in SEQ ID NO. 2). These primers amplified a product of approximately 154 bp in Changchun bream and approximately 732 bp in amblycephalic bream.

[0022] Further HEX-labeled fluorescent primers were synthesized and used to test the range of amplification products from multiple individuals. The amplification product type from 30 individuals of Changchun bream was approximately 154 bp (150-158 bp), and the amplification product type from 30 individuals of amblycephalic bream was approximately 732 bp (728-736 bp).

[0023] Example 4: Accuracy test of identification of Changchun bream, amblycephala and their hybrids Sixteen Changchun bream, giant bream, and their hybrids were collected from the breeding base, and fin rays were cut to extract genomic DNA, which was standardized to 50 ng·µL. -1 PCR amplification and electrophoresis were performed using 48 DNA samples. The conditions for PCR amplification, electrophoresis, and gel imaging were the same as those in point 3.

[0024] like Figure 1 The results showed that the amplified product of 16 Changchun bream was a single band of approximately 154 bp, the amplified product of 16 amblycephalic bream was a single band of approximately 732 bp, and the amplified product of the hybrid was a double band of approximately 154 bp and 732 bp. The accuracy of this locus in distinguishing Changchun bream, amblycephalic bream, and their hybrids was 100%.

[0025] In the research content: the habitat of Siniperca kneri and Megalobrama amblycephala overlaps and the breeding period is close, so natural hybridization can occur between the two. However, most fish hybrids, such as Siniperca kneri and Culter oxycephalus, Megalobrama amblycephala and Culter oxycephalus, are artificially cultivated and do not occur naturally. In the embodiment, on the one hand, the identification of purebred Siniperca kneri and Megalobrama amblycephala can provide technical support for scientific propagation and release, and help restore wild germplasm resources; on the other hand, the germplasm of the original parent fish is controlled at the source, and hybrid parent fish is prevented from participating in breeding, thus preventing the production of hybrid fry from the source and adding an additional safety insurance for the safety of germplasm resources.

[0026] The application is not limited to the above specific embodiments, and the above embodiments are only used to enable a detailed description of the use of the application, and the production methods and technical details with equal functions also belong to part of the content of the application. In fact, those skilled in the art can find different adjustment schemes according to their needs according to the foregoing description, and these adjustments should be within the scope of the claims attached herein.

Claims

1. A PCR primer set for rapid identification of bream (Changchun bream), bream (Amblycephalus amblycephalus) and their hybrids, characterized in that: The primer set includes a forward primer F and a reverse primer R. The nucleotide sequence of the forward primer F is shown in SEQ ID No: 1, and the nucleotide sequence of the reverse primer R is shown in SEQ ID No:

2.

2. A kit for identifying bream (Changchun bream), bream (Amblycephala bream) and their hybrids, characterized in that: The method comprises the PCR primer set according to claim 1, ddH2O and 2×Taq PCR Mix; wherein the concentration of the forward primer F in the PCR primer set is 8-12 μmol, and the concentration of the reverse primer R is 8-12 μmol.

3. The kit according to claim 2, wherein The concentration of forward primer F was 10 μmol, and the concentration of reverse primer R was 10 μmol.

4. A method for identifying Changchun bream, amblycephala and their hybrids, characterized in that: The steps include: S01, extracting DNA from bream (Changchun bream), bighead carp (Megalodon amblycephalus) and their hybrids; S02. Using the DNA obtained in the above step as an amplification template, performing PCR amplification using the PCR primer set, and detecting the PCR amplification product by agarose gel electrophoresis; S03. If the amplified product is a single band of approximately 154 bp, it is determined to be Changchun bream; if the amplified product is a single band of approximately 732 bp, it is determined to be a large head bream; if the amplified product is a double band of approximately 154 bp and 732 bp, it is determined to be a hybrid of the two.

5. The method according to claim 4, characterized in that In step S02, the PCR reaction system is: 0.8 μL of upstream and downstream primers with a concentration of 10 μmol and a concentration of 50 ng·μL -1 0.5 µL of genomic DNA and 10 µL of 2× Taq PCR Mix were added, and the reaction system was finally made up to 20 µL with ddH2O.

6. The method according to claim 4, characterized in that In step S02, the PCR reaction conditions are as follows: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 10 s; annealing at 56°C for 30 s; extension at 72°C for 45 s; 35 cycles in total; and a final extension at 72°C for 5 min. The product is cooled to 4°C to terminate the reaction.

7. Use of the PCR primer set according to any one of claims 1 to 6, characterized in that: is as follows (a1) or (a2): (a1) Identification of Changchun bream, amblycephalic bream and their hybrids; (a2) Detect whether the DNA sample is derived from Changchun bream, bighead carp and their hybrids.

Images