Sweet waxy corn molecular detection system based on du1 gene InDel marker and application of sweet waxy corn molecular detection system
By designing a molecular detection system based on the du1 gene InDel marker, and utilizing three-primer PCR amplification and agarose gel electrophoresis, the problems of high equipment dependence, high cost, and weak intuitiveness of KASP marker technology were solved. This enabled low-cost, rapid, and accurate detection of du1 gene Mu insertion mutations, significantly shortening the breeding cycle of sweet and glutinous corn.
Patent Information
- Application Number
- CN202511226956.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-10-17
AI Technical Summary
Existing KASP marker technology suffers from high equipment dependence, high cost, poor throughput flexibility, and weak result intuitiveness, making it difficult to meet the needs for large-scale, low-cost, and rapid screening of Mu insertion mutations in the maize du1 gene.
A molecular detection system based on the du1 gene InDel marker was designed. Specific electrophoretic bands were generated by three-primer PCR amplification, and genotype was directly determined by agarose gel electrophoresis, reducing equipment requirements and simplifying the operation process.
It enables low-cost, rapid, and accurate detection of the du1 gene Mu insertion mutation, reducing detection costs, simplifying the operation process, making it suitable for large-scale breeding population screening, and shortening the breeding cycle.
Smart Images

Figure BDA0005572875020000081 
Figure BDA0005572875020000082 
Figure BDA0005572875020000083
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of crop molecular breeding and detection technology, and in particular to a sweet and waxy corn molecular detection system based on du1 gene InDel marker, a rapid detection method for Mu insertion of corn du1 gene, and an efficient breeding method for sweet and waxy corn. BACKGROUND
[0002] Waxy corn (wx) is popular in the market due to its high amylopectin content and soft and waxy taste. However, its endosperm texture is too soft, which limits the product diversity. Loss-of-function mutation of dull endosperm 1 (du1) gene can reduce the amylopectin content and increase the amylose proportion, thereby significantly improving the texture of waxy corn and imparting it with a special taste of "sweet and smooth", forming a new type of "sweet and waxy" corn with high added value.
[0003] In corn germplasm resources, Mu transposon insertion is one of the important mutation sources leading to loss of function of du1 gene, and the insertion site is accurately located at chr10:60530427 (http: / / chinamu.jaas.ac.cn / result.html?keyword=Zm00001eb413290&mutatetype=&geneversion=V5.0,B73RefGen_v5) of chromosome 10, and efficient and accurate identification of the mutation is the key to breeding sweet and waxy corn.
[0004] Currently, there are methods for detecting the mutation using competitive allele-specific PCR (KASP) marker technology, such as CN116555468A which discloses a du1 mutant, its encoding gene, detection primer combination and application. However, KASP technology still has significant limitations:
[0005] (1) High dependence on equipment: Must use expensive real-time fluorescent PCR instrument for detection, which puts high requirements on the hardware conditions of most breeding units.
[0006] (2) High detection cost: The cost of synthesizing fluorescent probes is high, and the cost of detecting a single sample is significantly higher than that of conventional PCR.
[0007] (3) Poor flexibility of throughput: More suitable for medium to high throughput detection, and its economy and convenience are insufficient for rapid screening of small-scale (several tens to several hundred) samples in early generations of breeding.
[0008] (4) Weak result intuitiveness: Cannot directly observe the results by ordinary electrophoresis, and relies on software analysis, which is not conducive to rapid decision-making in the field.
[0009] Therefore, there is an urgent need in the art for a low-cost, simple-to-operate, intuitive, and high-end instrument-independent detection technology to overcome the above-mentioned defects of KASP markers, and to realize large-scale, high-efficiency, and low-cost screening of du1-Mu mutations in breeding populations. SUMMARY
[0010] In view of the deficiencies of the existing KASP marker technology, the purpose of the present application is to provide a sweet and waxy corn molecular detection system based on du1 gene InDel molecular markers and its application.
[0011] To achieve the above-mentioned purpose, the present application provides the following technical solutions:
[0012] A sweet and waxy corn molecular detection system based on du1 gene InDel markers, which is composed of a forward primer, a reverse primer and a Mu transposon-specific primer, and the sequences are shown in SEQ ID NO: 1-3, respectively.
[0013] The insertion site of the Mu transposon is located at the 10th chromosome of corn chr10:60530427 (B73RefGen_v5).
[0014] When the above primer set is used for PCR amplification, specific electrophoretic bands are produced in different genotypes of corn:
[0015] In the wild type (without Mu insertion) corn genome, the combination of F and R primers can amplify a specific band of 419bp; and the combination of F / MuTIR or R / MuTIR primers has no visible amplification band.
[0016] In the Mu insertion heterozygous corn genome, the combination of F and R primers can amplify a 419bp band (from the wild type allele); at the same time, the combination of F / MuTIR or R / MuTIR primers can amplify specific bands of 327bp or 158bp (from the mutant allele), respectively.
[0017] In the Mu insertion homozygous corn genome, the combination of F and R primers has no amplification product (wild type site deletion); and the combination of F / MuTIR or R / MuTIR primers can amplify specific bands of 327bp or 158bp, respectively.
[0018] The sweet and waxy corn molecular detection system based on du1 gene InDel markers of the present application can be used in the following aspects:
[0019] 1) Rapid and low-cost identification of du1 gene Mu insertion mutations in corn germplasm resources;
[0020] 2) Corn molecular marker-assisted selection, especially tracking and selection of du1-Mu mutation genotypes during backcross breeding.
[0021] 3) Sweet and waxy corn new variety of rapid breeding.
[0022] A rapid detection method of corn du1 gene Mu insertion, comprising the following steps:
[0023] (1) Extracting the genomic DNA of the corn plant to be tested; the genomic DNA is extracted from the leaf blade, seed coat or endosperm tissue at the seedling stage.
[0024] (2) Using the primer set in the sweet and waxy corn molecular detection system, taking the DNA to be tested as the template, performing PCR amplification; the PCR reaction program is: 95℃ pre-denaturation for 3min; 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 30s, 36 cycles; 72℃ final extension for 5min.
[0025] (3) Performing agarose gel electrophoresis separation and staining imaging on the PCR amplification product;
[0026] (4) Determining the genotype according to the electrophoresis band size:
[0027] If a 419bp band appears and no 327bp or 158bp band appears, it is determined as the wild type;
[0028] If a 419bp band and a 327bp or 158bp band appear at the same time, it is determined as the Mu insertion heterozygous type (dominant mutant type);
[0029] If no 419bp band appears, but a 327bp or 158bp band appears, it is determined as the Mu insertion homozygous type (recessive mutant type).
[0030] A rapid breeding method of sweet and waxy corn, comprising the following steps:
[0031] (1) Taking corn material carrying du1-Mu homozygous insertion as the donor parent, and crossing and backcrossing with the excellent waxy corn (wx) inbred line receptor parent;
[0032] (2) In the BC1F1 or subsequent backcross generation population, using the rapid detection method of corn du1 gene Mu insertion, the positive single plant with the genotype of Mu insertion heterozygous type is quickly screened out;
[0033] (3) Continue to backcross with the receptor waxy corn inbred line, and use the InDel marker for assisted selection in each generation to accelerate the genetic background recovery;
[0034] (4) After backcrossing to the BC2F1 generation, the screened positive single plant is selfed, and in the selfed offspring (BC2F2), the sweet and waxy corn new germplasm with du1-Mu homozygous and wx gene homozygous is screened out by using the InDel marker.
[0035] Preferably, the size of each generation of backcross population in step (2) is 30-250 plants to ensure that a sufficient number of target positive single plants are obtained.
[0036] Compared with the prior art, the application has the following beneficial effects:
[0037] (1) The InDel marker of the application is designed based on the sequence flanking the precise insertion site of Mu transposon instead of the internal sequence of Mu transposon. The strategy ingeniously utilizes the length polymorphism of the genomic sequence caused by insertion mutation, and distinguishes the three genotypes of wild type, heterozygote and homozygote by a three-primer PCR system at one time, which is ingenious in design and has significant innovation.
[0038] (2) The device threshold is extremely low: only basic molecular biology equipment such as ordinary PCR instrument and agarose gel electrophoresis device is needed, without expensive fluorescent PCR instrument, so that any breeding unit with basic laboratory conditions can implement it, greatly reducing the technical popularization threshold.
[0039] (3) The detection cost is greatly reduced: the cost is only one tenth of that of KASP marker or even lower using conventional synthetic primers, which is particularly suitable for large-scale population sample screening at low cost in the breeding process.
[0040] (4) The operation is simple and fast: from DNA extraction to the result can be completed within 3-4 hours, and the electrophoresis result can be seen by naked eye, which is very beneficial to rapid decision-making and single plant screening in the breeding field (such as field), and speeds up the breeding process.
[0041] (5) The result is intuitive and accurate: the genotype is directly judged by the band size, the co-dominant feature is clear, and the deviation caused by the interpretation of fluorescent signal is avoided, and the accuracy is high.
[0042] (6) Practicality: the breeding strategy provided by the application combines efficient molecular marker assisted selection with conventional backcross breeding, which can quickly and accurately introduce du1-Mu mutation into any excellent waxy corn elite line, significantly shortening the breeding period of sweet and crisp waxy corn new varieties (shortening 2-3 generations), and has high industrial application value. BRIEF DESCRIPTION OF DRAWINGS
[0043] Figure 1 The electropherogram of the InDel molecular marker for identifying the genotype of the corn du1 gene of the application is shown in the figure. Among them: (+ / +) wild type (419bp); (+ / -) heterozygote (419bp / 327bp or 158bp); (- / -) homozygote (327bp or 158bp).
[0044] Figure 2Phenotype of mature seeds of waxy maize (wxwx wild type control material) and sweet waxy maize (du1du1wxwx double recessive mutant material). DETAILED DESCRIPTION
[0045] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments of the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work are within the protection scope of the present application.
[0046] In the following experimental examples, if no special provision is made, all the methods are conventional methods, and the experimental reagents and materials involved are conventional biochemical reagents and materials if no special provision is made.
[0047] Experimental Example 1 Verification of du1-InDel marker
[0048] I. Experimental design principle
[0049] An InDel molecular marker is developed at the du1 gene mutation site, and the mInDel software is used to analyze the genomic data: comparing the sequence difference between the mutant and the wild type (B73), identifying the insertion / deletion polymorphism region, and designing the flanking primer to amplify the difference region.
[0050] II. Experimental materials
[0051] (1) Wild type material: corn inbred line B73 is selected as the wild type control.
[0052] (2) Mutant material: including B73_mu mutant and BC2F3 generation lines obtained by Mu insertion transfection technology.
[0053] (3) Research population: an F2 generation separation population is constructed, and the sample number is 300 to ensure the statistical significance of the experimental results.
[0054] III. Experimental method:
[0055] (1) Extraction of plant genomic DNA
[0056] Sample preparation: Take fresh and healthy leaves of the corn plants to be tested at the six-leaf stage, cut about 100 mg of leaf tissue (avoid the main veins), and place them in a pre-cooled 2 mL centrifuge tube. Use a vacuum freeze dryer (Biomedica Instruments Co., Ltd.) for dehydration treatment, add 1 pre-cooled stainless steel bead (diameter 5 mm) to the freeze-dried sample tube, and use a multi-sample tissue grinder (Shanghai Jingxin) for crushing. Use a new plant genomic DNA extraction kit (Shanghai Pudi Biology) to extract genomic DNA, and finally use a nucleic acid protein analyzer to analyze the DNA quality: the concentration standard should be ≥20 ng / μL (PCR applicable), and the purity standard requires OD260 / OD280 to be 1.80-2.00.
[0057] (2) Primer design of du1 mutant InDel marker
[0058] The primer design method of the InDel marker includes the following steps: according to the insertion position of du1 mutation, obtain the corn genomic sequence information 300 bp upstream and downstream of the position; use mInDel software to preprocess, InDel analysis, primer design and evaluation of corn genomic sequence; select better specific InDel molecular marker PCR amplification of corn genomic DNA for verification.
[0059] 1. Specific insertion position of du1 gene insertion transposon mutant and acquisition of the mutant
[0060] By querying the Mutator transposon insertion mutant public database (http: / / chinamu.jaas.ac.cn / cindex.html), the du1 (dull endosperm1) Mu transposon insertion site was obtained.
[0061] The specific information is as follows:
[0062] Donor material: B73_mu mutant
[0063] Mutation type: Mutator transposon insertion
[0064] Reference genome version: B73 RefGen_v5 (MaizeGDB ID: Zm-B73-REFERENCE-NAM-5.0)
[0065] Precise insertion site: chr10:60,530,427
[0066] Corresponding gene model: Zm00001eb413290 (du1 gene, starch synthase)
[0067] 2. Acquisition of genomic flanking sequence of du1 gene insertion transposon mutant
[0068] The genomic sequence, protein sequence and gene annotation file of the whole genome V5 version of corn were downloaded from EnsemblPlant (http: / / plants.ensembl.org / index.html) database, and then the sequence of the upstream and downstream 300 bp (chr10:60530127-60530727) of the mutation position was extracted according to the insertion position (chr10:60530427) of the du1 mutant by using fastacmd software.
[0069] 3. Prediction and verification of InDel molecular marker based on the insertion position of du1 mutant
[0070] Based on the upstream and downstream genomic sequence data of the insertion position of the corn du1 mutant, InDel analysis was performed by using mInDel software, the primer sequence used in the identification experiment of the du1 mutant material was designed, and the screening standard was as follows: first, located in the upstream and downstream 300 bp (chr10:60530127-60530727) of the insertion position (chr10:60530427) of the du1 mutant, InDel length: 15-25 bp, flanking sequence conservation > 95%, primer design Tm around 59°C.
[0071] The primer set consists of three primers:
[0072] Forward primer (F), 5'-GGT CAT TGG TTT CGG ATG CC-3', the nucleotide sequence of which is shown as SEQ ID NO: 1;
[0073] Reverse primer (R), 5'-ATG AAT AGC ACA ACA CCT CTC C-3', the nucleotide sequence of which is shown as SEQ ID NO: 2;
[0074] Mu transposon specific primer (MuTIR), 5'-GAA GCC AAC GCC AWC GCC TCY ATT TCG TCG AAT-3'(Note: W=A / T, Y=C / T), the nucleotide sequence of which is shown as SEQ ID NO: 3.
[0075] - 300 bp conservative sequence upstream of the insertion site:
[0076] ATTTACAAAAATAG GGTCATTGGTTTCGGATGCCGACAAAATTGCCTACTAAACTTGGCATGCCAAGACGAGACACGCGTGAACACTTTTCTCCCAGCCGAGGGCAAGCGCCCACGCAAAAACGGATCCGGACACACGTTAAAGCGAAGCATAAAAACTCACACAACACACGTGGAACATTCTAGAACATCATACACAAGCAACACCGGCACTCATGACACATCAGCCAACCCAACTGTGCACATCTCATGAGCTAGGGAACCCACAGTTGGACAAACAAAACATTGGACCCCCCCAAGC (SEQ ID NO:4)
[0077] -300 bp of conserved sequence downstream of the insertion site:
[0078] AAGGTGACACGTCCAGCTCTTATACAGGACAACCACACTTCACAGGAAAAAACAAGGCGTGAAAGAAAGAACCGATTTTGTTCTGTTTAAATGGCATTTCC GGAGAGGTGTTGTGCTATTCAT TTGCGTCTTGTGAAGTGATTCTAGTTCAGAGAAAGAAAGAAGTTGAGAATGAGAAGCAAGTGAGGCGCGTTTGCTGGGAAGTGGTTCTTGTGAGGTTTAGGAGTTCACCCTTCTTTTCTTCCCCTTCTAGAAATGGAGATGGTCCTACGGTCGCAGAGCCCTCTCTGCCTTCGGAGT (SEQ ID NO:5)
[0079] PCR amplification with the primer sets above produced specific electrophoretic bands in different genotypes of maize:
[0080] In wild type (no Mu insertion) maize genome, the combination of F and R primers amplified a specific band of 419 bp; while the combination of F / MuTIR or R / MuTIR primers did not produce any amplification band.
[0081] In Mu insertion heterozygous maize genome, the combination of F and R primers amplified a band of 419 bp (from wild type allele); meanwhile, the combination of F / MuTIR or R / MuTIR primers amplified a specific band of 327 bp or 158 bp (from mutant allele), respectively.
[0082] In Mu insertion homozygous corn genome, F and R primer combination has no amplification product (wild type site deletion); while F / MuTIR or R / MuTIR primer combination can amplify 327bp or 158bp specific bands respectively.
[0083] (3) Detection system optimization:
[0084] ① PCR reaction system (25 μL):
[0085]
[0086]
[0087] ② Amplification procedure:
[0088] Due to the special nature of Mu insertion mutants, MuTIR primers need to be added when identification is required, and F or R primers are used for identification at the same time, in order to obtain accurate mutant plants. The extension efficiency of 2x Taq Master Mix is 1000 bp / min, and the extension time at 72℃ is determined according to the length of the primer amplified fragment. The reaction procedure is as follows:
[0089] 95℃ pre-denaturation for 3min; 95℃ denaturation for 30sec, 58℃ annealing for 30sec, 72℃ extension for 30sec, 36 cycles; 72℃ final extension for 5min.
[0090] (4) Agarose gel electrophoresis
[0091] a. Prepare 1.5% (M / V) agarose gel, use Solarbio's agarose, add appropriate amount of 1x TAE buffer, microwave oven for 2min to completely dissolve, cool down, add 5 μL EB dye, mix well, pour into the mold, and let it solidify.
[0092]
[0093] b. Electrophoresis: transfer the gel to the electrophoresis tank, use 1x TAE as the buffer solution in the middle, after loading, electrophorese at 120V for 1h. Ultraviolet development and photography.
[0094] c. Result determination:
[0095]
[0096]
[0097] Example 2 Creation of new germplasm of sweet and waxy corn
[0098] Using du1-Mu homozygous mutant as donor and excellent waxy corn inbred line 'Hengbai522' as recipient, F1 was obtained by hybridization, and the recipient was used as a recurrent parent for backcross.
[0099] In the BC1F1 population, 30 plants were planted, leaf DNA was extracted, and the method of the application was used for detection. 11 positive single plants of genotype heterozygous (i.e. both 419 bp and 327 / 158 bp bands) were screened out, and the identification results are as follows.
[0100]
[0101]
[0102] The screened positive single plants were further backcrossed with 'Hengbai 522' to obtain a BC2F1 population, and heterozygous single plants were also screened. Finally, in the BC2F2 population, single plants of du1-Mu homozygous and agronomic traits similar to the recurrent parent were screened out by the method of the application, i.e. the desired sweet and waxy corn new germplasm. The application uses B73 and Hengbai 522 as controls, and 5 strains are identified by InDel markers, of which 2 are sweet and waxy double recessive lines (genotype: du1du1wxwx), and part of the electrophoretic color development gel results are shown in Figure 1 ; the breeding cycle is shortened to 2 years (4 years are required by the traditional method), the mature sweet and waxy corn kernels collapse at the top, the density and thousand kernel weight decrease, and the mature kernel phenotype of waxy corn (wxwx) and sweet and waxy corn (du1du1wxwx) is shown in Figure 2 .
[0103] Although embodiments of the application have been shown and described, it is to be understood that various modifications, substitutions, replacements and changes can be made to these embodiments without departing from the principles and spirit of the application, and the scope of the application is defined by the appended claims and their equivalents.
Claims
1. A molecular detection system for sweet and refreshing waxy corn based on the dul gene InDel marker, characterized by: It consists of a forward primer, a reverse primer and a Mu transposon-specific primer, and the sequences are shown in SEQ ID NOs: 1-3 respectively.
2. The sweet and refreshing waxy corn molecular detection system based on dul gene InDel marker according to claim 1, characterized in that: The Mu insertion site is located on maize chromosome 10 chr10:60530427, reference genome B73RefGen_v5.
3. The sweet and refreshing waxy corn molecular detection system based on dul gene InDel marker according to claim 2, characterized in that: The forward primer, reverse primer and transposon-specific primer can achieve co-dominance detection through conventional PCR amplification and agarose gel electrophoresis, specifically as follows: In the wild-type maize genome, the combination of the forward primer and the reverse primer amplified a 419 bp band, while the combination of the forward primer or the reverse primer with the Mu transposon-specific primer did not amplify any band. In the genome of Mu insertion heterozygous maize, the combination of forward primer and reverse primer amplified a 419 bp band, and the combination of forward primer or reverse primer with Mu transposon-specific primer amplified a 327 bp or 158 bp band, respectively. In the maize genome homozygous for Mu insertion, the combination of forward primer and reverse primer did not amplify any band, while the combination of forward primer or reverse primer with Mu transposon-specific primer amplified 327 bp or 158 bp bands, respectively.
4. The use of the sweet and refreshing waxy corn molecular detection system based on dul gene InDel marker according to any one of claims 1 to 3, characterized in that: It includes the rapid detection and genotyping of Mu insertion mutations in the maize du1 gene, the tracking and selection of du1-Mu alleles in maize molecular marker-assisted selection breeding, and the rapid breeding of new sweet and sticky corn varieties.
5. A rapid detection method for the insertion of the du1 gene Mu in maize, characterized in that: The following steps are involved: (1) Extracting genomic DNA from the maize germplasm resources to be tested; (2) using the primer set in the sweet and refreshing glutinous corn molecular detection system according to claim 1 to perform PCR amplification on the corn genomic DNA to be tested; (3) The PCR amplification products were analyzed by agarose gel electrophoresis, and the genotype was determined based on the band size.
6. The rapid detection method for the insertion of the maize dul gene Mu according to claim 5, characterized in that: In the step (1), the genomic DNA is extracted from seedling leaves, seed coats or endosperm tissues.
7. The rapid detection method for the insertion of the maize dul gene Mu according to claim 5, characterized in that: In step (2), the PCR reaction procedure is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, 36 cycles; and final extension at 72°C for 5 min.
8. The rapid detection method for the insertion of the maize dul gene Mu according to claim 5, characterized in that: In step (3), if only the 419 bp band appears, it is determined to be wild type; if the 419 bp band and the 327 bp or 158 bp band appear at the same time, it is determined to be Mu insertion heterozygous; If only the 327bp or 158bp band appears and there is no 419bp band, it is determined to be a homozygous Mu insertion type.
9. A method for rapid breeding of sweet and refreshing glutinous corn, characterized in that: The following steps are involved: (1) Using the material containing du1-Mu insertion as the donor and the waxy maize inbred line as the recipient backcross; (2) In a backcross generation population, screening for Mu insertion heterozygous individual plants using the rapid detection method described in any one of claims 5 to 8; (3) Continue backcrossing to the BC2F1 generation and then self-pollinate, and screen out new sweet and refreshing waxy corn germplasm that is homozygous for du1-Mu and homozygous for the waxy gene from the self-pollination segregation population.
10. The method for rapid breeding of sweet and refreshing glutinous corn according to claim 9, characterized in that: The backcross population size per generation is 30-250 plants.
Citation Information
Patent Citations
Du1 mutant as well as coding gene, detection primer combination and application thereof
CN116555468A
Application of ZmFS1 gene in corn disease control
CN119351450A
Apomictic maize
CN1202199A
i (dull 1) coding for a starch synthase and uses thereof
CN1285871A
Dull1 coding for a novel starch synthase and uses thereof
US5981728A