Engineered guide RNA and polynucleotides

Abstract

Disclosed herein are engineered guide RNAs and compositions comprising the same for treating a disease or condition in a subject. Also disclosed herein are methods of treating a disease or condition in a subject by administering the engineered guide RNA or pharmaceutical composition described herein.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority under 35 U.S.C. §119 to provisional application 63 / 528,027 filed on July 20, 2023 and provisional application 63 / 434,986 filed on December 23, 2022, the disclosures of which are incorporated herein by reference. Background Art

[0003] Compositions that mediate RNA editing may be viable therapies for genetic diseases. However, there is a need for highly effective compositions that can maximize on-target RNA editing while minimizing off-target RNA editing. In addition, there is also a need for compositions that can promote RNA editing. Summary of the Invention

[0004] Disclosed herein is a composition comprising an engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA has complementarity to a target sequence of a target SNCA RNA and comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784; wherein upon hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA, a guide-target RNA scaffold is formed, the guide-target RNA scaffold having one or more structural features that did not exist within the engineered guide RNA prior to the hybridization, and the one or more structural features are selected from the group consisting of a bulge, an internal loop, and a hairpin; and wherein the formation of the guide-target RNA scaffold causes knockdown of alpha-synuclein encoded by the target SNCA RNA. In some embodiments, the engineered guide RNA comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs: 293-299 or 333-340. In some embodiments, the engineered guide RNA comprises the polynucleotide sequence of any one of SEQ ID NOs: 293-299 or 333-340. In some embodiments, the target sequence of a target SNCA RNA comprises a translation initiation site. In some embodiments, the translation initiation site is a SNCA codon 1 translation initiation site of exon 2. In some embodiments, the translation initiation site is a SNCA codon 1 translation initiation site of exon 2 corresponding to position 226 of SNCA transcript variant 1 with accession number NM_000345.4. In some embodiments, the one or more structural features comprise at least a first 6 / 6 symmetric internal loop and at least a second 6 / 6 symmetric loop. In some embodiments, the first 6 / 6 symmetric internal loop is relative to a target adenosine at position 0; at a position selected from the group consisting of: 33, 32, 30, 28, and 26. In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 337. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 338 or SEQ ID NO: 339.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a U / G wobble base at position 5 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 340. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 298 or SEQ ID NO: 299. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 299. In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 333. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 334. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 335.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, a G / U wobble base at position -3 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 336. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 295. In some embodiments, the first 6 / 6 symmetric internal loop is at position 30 relative to a target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetric internal loop at position -18 relative to position 0, a 3 / 3 symmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 297. In some embodiments, the first 6 / 6 symmetric internal loop is at position 28 relative to a target adenosine at position 0.In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -8 relative to position 0, an A / C mismatch at position 0, a G / U wobble base pair at position 2 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 293. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -10 relative to position 0, a 0 / 1 asymmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 294. In some embodiments, the first 6 / 6 symmetric internal loop is at position 26 relative to a target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to SEQ ID NO: 296. In some embodiments, the one or more structural features comprise a bulge, and wherein the bulge is a symmetric bulge. In some embodiments, the one or more structural features comprise a bulge, and wherein the bulge is an asymmetric bulge. In some embodiments, the one or more structural features comprise an internal loop, and wherein the internal loop is a symmetric internal loop. In some embodiments, the one or more structural features comprise an internal loop, and wherein the internal loop is an asymmetric internal loop. In some embodiments, the guide-target RNA scaffold comprises a wobble base pair. In some embodiments, the one or more structural features comprise a hairpin, and wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, upon hybridization of the engineered guide RNA to a target sequence of a target SNCA RNA, the engineered guide RNA facilitates RNA editing by an RNA editing entity on one or more adenosines in the target sequence of the target SNCA RNA. In some embodiments, the RNA editing entity comprises ADAR1, ADAR2, ADAR3, or any combination thereof. In some embodiments, the composition comprises an engineered polynucleotide encoding the engineered guide RNA.In some embodiments, the engineered polynucleotide is comprised in or on a vector. In some embodiments, the vector is a viral vector, and wherein the engineered polynucleotide is packaged in the viral vector. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector, a derivative thereof. In some embodiments, the viral vector is an adeno-associated virus (AAV), and wherein the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant of any of these. In some embodiments, the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof. In some embodiments, the target sequence of the target SNCA RNA has a polynucleotide sequence that is at least 80% identical to SEQ ID NO: 300. In some embodiments, the engineered guide RNA comprises the sequence of any one of SEQ ID NOs: 2-285, SEQ ID NOs: 293-299, SEQ ID NOs: 333-357, SEQ ID NOs: 375-376, SEQ ID NOs: 380-381, SEQ ID NOs: 390-440, or SEQ ID NOs: 777-784.

[0005] Also disclosed herein is a composition comprising an engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA has a length of 85 nucleotides to 100 nucleotides and hybridizes to at least 80 bases of a target RNA sequence, and the target RNA sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300. In some embodiments, upon hybridization of the engineered guide RNA to the at least 80 bases of the target RNA sequence, the engineered guide RNA facilitates RNA editing of one or more adenosines in the at least 80 bases of the target RNA sequence by an RNA editing entity. In some embodiments, the engineered guide RNA, upon hybridization to the at least 80 bases of the target RNA sequence, forms a guide-target RNA scaffold comprising one or more structural features. In some embodiments, the one or more structural features comprise a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the one or more structural features comprise a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the one or more structural features comprise an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the one or more structural features comprise a wobble base pair. In some embodiments, the one or more structural features comprise a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, the RNA editing entity comprises ADAR1, ADAR2, ADAR3, or any combination thereof. In some embodiments, the composition comprises an engineered polynucleotide encoding the engineered guide RNA. In some embodiments, the engineered polynucleotide encoding the engineered guide RNA is comprised in or on a vector. In some embodiments, the vector is a viral vector, and wherein the engineered polynucleotide encoding the engineered guide RNA is packaged in the viral vector. In some embodiments, the viral vector is an adeno-associated viral vector (AAV vector) or a derivative thereof. In some embodiments, the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant thereof. In some embodiments, the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof.

[0006] Also disclosed herein is a pharmaceutical composition comprising: (a) a composition as described herein; and (b) a pharmaceutically acceptable excipient, carrier, or diluent.

[0007] Also disclosed herein is a method of treating a disease or disorder in a subject in need thereof, the method comprising: administering to the subject a therapeutically effective amount of a composition as described herein, or a pharmaceutical composition as described herein. In some embodiments, the disease or disorder comprises a synucleinopathy. In some embodiments, the synucleinopathy comprises Parkinson’s disease. In some embodiments, the subject is a human or a non-human animal. In some embodiments, the pharmaceutical composition or composition is in unit dosage form. In some embodiments, the administration is sufficient to treat one or more symptoms of a disease or disorder. In some embodiments, the disease or disorder is a synucleinopathy. In some embodiments, the one or more symptoms treated comprise muscle rigidity, bradykinesia, rest tremor, or any combination thereof. In some embodiments, the administration is sufficient to reduce aggregation of alpha-synuclein relative to: (a) the level of aggregation prior to administration; (b) the cumulative level of aggregation in the subject in the absence of administration; or (c) both.

[0008] Also disclosed herein is a method of treating Parkinson’s disease in a subject in need thereof, the method comprising: administering to the subject an amount of a composition as described herein, or a pharmaceutical composition as described herein, sufficient to treat the Parkinson’s disease in the subject. In some embodiments, the administration is sufficient to treat one or more symptoms of Parkinson’s disease in a subject relative to prior to administration. In some embodiments, the one or more symptoms treated comprise muscle rigidity, bradykinesia, rest tremor, or any combination thereof. In some embodiments, the subject exhibits an increased Unified Parkinson’s Disease Rating Scale (UPDRS) score following the administration relative to the UPDRS score prior to administration.

[0009] Also disclosed herein is a method of reducing expression of alpha-synuclein in a subject in need thereof, the method comprising administering to the subject a composition as described herein; wherein the administration is sufficient to reduce expression of alpha-synuclein in the subject relative to the amount of alpha-synuclein prior to the administration, thereby reducing expression of the alpha-synuclein in the subject. In some embodiments, the engineered guide RNA has sufficient complementarity to a target sequence of a target SNCA RNA to hybridize the engineered guide RNA to the target sequence of the target SNCA RNA, wherein the target sequence comprises a translation initiation site in the target SNCA RNA. In some embodiments, the translation initiation site is the SNCA codon 1 translation initiation site of exon 2. In some embodiments, the target SNCA RNA comprises a pre-mRNA transcript of SNCA. In some embodiments, hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA causes an RNA editing entity present in the subject to edit one or more adenosines in the target sequence. In some embodiments, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the pre-mRNA transcript of SNCA has editing of the one or more adenosines in the target sequence. In some embodiments, the editing of the one or more adenosines in the target sequence of the target SNCA RNA contributes to reduced expression of alpha-synuclein in the subject. In some embodiments, the reduced expression of alpha-synuclein is at least a 10% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is at least a 20% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is at least a 25% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is at least a 30% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is at least a 35% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is at least a 30% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is at least a 40% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is at least a 45% reduction relative to the amount of alpha-synuclein present prior to the administration.In some embodiments, the reduced expression of alpha-synuclein is at least a 50% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is about a 10% to at most a 20% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is about a 20% to at most about a 30% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is about a 30% to at most about a 40% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is about a 40% to at most about a 50% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is about a 50% to at most about a 60% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the reduced expression of alpha-synuclein is about a 60% to at most about a 70% reduction relative to the amount of alpha-synuclein present prior to the administration. In some embodiments, the target sequence of the target SNCA RNA comprises a sequence having at least 80% identity to SEQ ID NO: 300. In some embodiments, the hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA causes an exon skipping in the pre-mRNA transcript of the SNCA. In some embodiments, the exon skipping produces a SNCA mRNA alternative splice variant that does not comprise exon 2 of the wild-type SNCA mRNA transcript. In some embodiments, the exon skipping causes a reduction in alpha-synuclein. In some embodiments, the reduced expression of the alpha-synuclein in the subject comprises a decrease in alpha-synuclein levels in a biological sample from the subject relative to: (i) alpha-synuclein levels in a biological sample obtained from the subject prior to the administration; or (ii) a reference alpha-synuclein level obtained from a subject having Parkinson’s disease, as determined according to an in vitro assay. In some embodiments, the method further comprises decreasing the level of alpha-synuclein RNA transcripts comprising exon 2 in the subject relative to: (i) the level of alpha-synuclein RNA transcripts comprising exon 2 in a biological sample obtained from the subject prior to the administration; or (ii) a reference level of alpha-synuclein RNA transcripts comprising exon 2 obtained from a subject having Parkinson’s disease, as determined according to an in vitro assay. In some embodiments, the method treats the disease or condition in the subject.In some embodiments, the disease or the condition is at least one selected from the group consisting of a neurodegenerative disease, Parkinson’s disease, tremor, muscle rigidity, muscle rigidity, bradykinesia, Lewy body dementia (DLB), multiple system atrophy (MSA), pure autonomic failure (PAF), and REM sleep behavior disorder (RBD).

[0010] INCORPORATED BY REFERENCE

[0011] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. BRIEF DESCRIPTION OF DRAWINGS

[0012] The novel features of the disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the illustrative principles of the present disclosure are utilized, and the accompanying drawings of which:

[0013] Figure 1 A legend showing various exemplary structural features present in a guide-target RNA scaffold formed after hybridization of a potential guide RNA of the present disclosure to a target RNA is shown. The exemplary structural features shown include an 8 / 7 asymmetric loop (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base pair with 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side).

[0014] Figure 2 A schematic of an alpha-synuclein (SNCA, a-Syn) target is shown, which indicates the translation initiation site (TIS) in exon 2 of the RNA transcript.

[0015] Figure 3Plots showing quantification of expression of a-Syn protein relative to beta actin control from Western blots. WT-SH-SY5Y cells are shown as gray bar with circles. TISc.1A>G endogenous mutation is shown at 0. TISc.5A>G endogenous mutation does not affect a-syn protein expression as shown by black squares. 3'UTR A>G endogenous mutation does not affect a-syn protein expression as shown by white bar with triangles. Y-axis: Total a-Syn / beta-Actin, X-axis: Undifferentiated SH-SY5Y cells or differentiated SH-SY5Y cells.

[0016] Figures 4A-4B Plots showing selection of guide RNA constructs for targeting SNCA. Figure 4A Plots showing percentage of RNA editing by gRNAs relative to control RNA in the presence of ADAR1 or ADAR1 + ADAR2 from high throughput screen. Y-axis: Percentage of RNA editing; X-axis: Guide (numbered 1-50), C: Control. Figure 4B Plots showing selected guide RNAs for further optimization with different secondary structures.

[0017] Figures 5A-5C Plots showing each of the selected guides targeting SNCA in on-target editing and off-target editing results. Figure 5A Schematic of RNA editing of unedited transcript, on-target editing, on-target and off-target editing, upstream off-target editing, and downstream target editing. Figure 5B Plots showing percentage of editing in the presence of ADAR1. Figure 5C Plots showing percentage of editing in the presence of both ADAR1 and ADAR2.

[0018] Figure 6 Plots showing on-target editing score of engineered guide RNAs based on parent guide RNA having polynucleotide sequence of SEQ ID NO: 298, SEQ ID NO: 375, or SEQ ID NO: 784. Editing score increases with guide length. Y-axis: On-target editing score; X-axis: Macrofootprint shown in guide length. Mismatched positions include 80.40, 80.45, 90.50, 95.55, and 100.60.

[0019] Figures 7A-7B Plots showing results of a dumbbell scan. Figure 7A Schematic of dumbbell scan of targeting site of guide RNA relative to nucleobase comprising a mismatch. Figure 7BA heat map is shown indicating the positions of the left and right barbells of exemplary guide RNAs based on a parent guide RNA having a polynucleotide sequence of SEQ ID NO: 298, SEQ ID NO: 375, or SEQ ID NO: 784 with the highest RNA editing ability.

[0020] Figures 8A-8B Depicted are macrofootprint optimization of exemplary guide RNAs using a transient transfection assay. Figure 8A Shown is the effect of guide RNA length on the editing efficiency of selected guide RNAs by ADARs. Figure 8B Depicted are the editing profiles of exemplary guides as a function of nucleotide position.

[0021] Figures 9A-9B Depicted are SNCA RNA editing in mouse primary neurons treated with selected gRNAs. Figure 9A Figure 2 shows a plot of relative SNCA protein levels after delivery of gRNA1 or gRNA2 to mouse primary neurons relative to control RNA. Y-axis: relative SNCA protein levels; X-axis: condition; regulatory element variants reg1, reg2, reg3, and reg4. Figure 9B RNA editing in response to gRNA1 or gRNA2 is shown relative to control RNA. Y-axis: Percentage of SNCA TIS editing; X-axis: Condition; Regulatory element variants reg1, reg2, reg3, and reg4. Error bars represent standard deviation.

[0022] Figures 10A-10B Shown are selected gRNAs targeting SNCA that result in targeted α-synuclein knockdown and RNA editing in vivo. Figure 10A Figure 2 shows the micrograms (μg) of human SNCA (hSNCA) per milligram (mg) of total protein in the brains of mice treated with gRNA. Y-axis: μg hSNCA / mg of total protein; X-axis: condition; regulatory element variants reg1, reg2, reg3, and reg4. Statistics: One-way ANOVA with Dunnett's post hoc test. **p < 0.005, *p < 0.05 compared to control gRNA. Figure 10BRNA editing in response to gRNA1 or gRNA2 relative to control RNA administered in vivo is shown. Y-axis: percent SNCA TIS editing; X-axis: condition; regulatory element variants reg1, reg2, reg3, and reg4. Mice were administered AAV-gRNA by bilateral ICV at a dose of 1.55e11 vg / mouse. Y-axis: pg hSNCA / mg total protein; X-axis: condition. N=8 mice. Statistics: one-way ANOVA with Dunnett’s post-test **p<0.005, *p<0.05 compared to control gRNA.

[0023] Figures 11A-11B Variable splice variants detected in mouse models and in vitro in primary neurons are shown. Figure 11A A schematic of splice variants detected in SNCA is shown. Figure 11B Gels of RT-PCR products from primary neurons and brain samples treated with gRNAs targeting SNCA are shown. Bands are indicated as shown in exon 2 with arrows.

[0024] Figures 12A-12C Relationship between gRNA configuration and exon skipping in SNCA transcripts in mouse models and in vitro in primary neurons is shown. Figure 12A A plot (densitometry) of the approximate percent of novel splice variants (NSV) in primary neurons for guide RNAs targeting SNCA relative to control gRNA is shown. Y-axis: percent novel splice variants (NSV); X-axis: condition; Reg: regulatory element. Figure 12B A plot (densitometry) of the approximate percent of novel splice variants (NSV) in mouse brains for guide RNAs targeting SNCA relative to control gRNA following intracerebral injection is shown. Y-axis: percent novel splice variants (NSV); X-axis: condition; regulatory element variants reg1 and reg3. Figure 12C A plot of the percent of transcripts with exon 1 to exon 3 splice junctions for control, LCOR gRNA, gRNA1, and gRNA2 is shown. Y-axis: percent of transcripts with 1 to 3 splice junctions; X-axis: condition. SNCA transcripts were measured by droplet digital PCR (ddPCR).

[0025] Figure 13 Viral genome and gRNA quantification in mice treated with gRNAs targeting SNCA is shown. Figure 13Plots showing viral genome / diploid genome (VG / DG) isolated from mouse brains treated with selected gRNAs. Y-axis: VG / DG; X-axis: condition; N=8 / group. Regulatory element variants regl and reg3. Statistics: one-way ANOVA with Dunnett’s post-test **p<0.005, *p<0.05 compared to control gRNA.

[0026] Figures 14A-14C Plots showing a-Syn protein knockdown in human neural stem cell (NSC)-derived dopaminergic neurons treated with selected gRNAs targeting SNCA. Figure 14A Images showing various NSC-derived dopaminergic neuronal cultures treated with SNCA gRNAs. Top panel shows a population of primary neuronal cells. Bottom panel shows a mixed cell population. Figure 14B Plots showing a-Syn protein levels relative to non-transduced control cells. Y-axis: relative a-Syn protein levels normalized to non-transduced control cells. + indicates presence of two hnRNP Al in the vector; - indicates absence of hnRNP Al in the vector. X-axis: condition. Each condition was tested in duplicate. Figure 14C Plots showing percentage of TIS editing in human NSC-derived dopaminergic neurons treated with SNCA gRNAs. + indicates presence of two hnRNP Al in the vector; - indicates absence of hnRNP Al in the vector. X-axis: condition. Each condition was tested in duplicate.

[0027] Figures 15A-15B Plots showing a-Syn protein knockdown in human neural stem cell (NSC)-derived dopaminergic neurons treated with selected gRNAs targeting SNCA. Figure 15A Plots showing percentage of TIS editing in human neurons treated with gRNA1, gRNA2, gRNA3, and control. Y-axis: percentage of SNCA TIS editing; + indicates presence of two hnRNP Al in the vector; - indicates absence of hnRNP Al in the vector. X-axis: condition. Figure 15B Plots showing relative SNCA protein levels relative to control RNA following delivery of gRNA1, gRNA2, or gRNA3 and control gRNA to human neurons. Y-axis: relative SNCA protein levels; X-axis: condition; + indicates presence of two hnRNP Al in the vector; - indicates absence of hnRNP Al in the vector.

[0028] Figures 16A-16C Plots showing treatment of NSC-derived neurons and iPSC-derived neurons with SNCA TIS guides facilitates exon skipping of exon 2. Figure 16AGel showing PCR amplified SNCA transcript products in NSC-derived neurons. Figure 16B Plot (ddPCR) showing percentage of SNCA transcript in NSC-derived neurons that display SNCA exon 2 skipping in response to gRNA treatment. Y-axis: Percentage of exon 2 skipping; X-axis: Condition; + indicates presence of two hnRNP A1 in the vector; - indicates absence of hnRNP A1 in the vector. Each condition was tested in duplicate. Figure 16C Gel showing PCR amplified SNCA transcript products in iPSC-derived neurons.

[0029] Figure 17 Schematic of droplet digital PCR (ddPCR) assay for SNCA novel splice variant. The assay has been validated for use in hSNCA mice and human cell lines. The assay measures the amount of transcript with a novel splice junction between hSNCA exon 1 and hSNCA exon 3 relative to the canonical exon 2.

[0030] Figure 18 Schematic of gRNA modifications to be tested to minimize off-target effects at the -4 position of the targeting portion of the gRNA sequence. The gRNA is modified to 1. move the bulge closer to the target mismatch site; 2. increase the size of the bulge; and introduce a U deletion at the site at the -4 position; and any combination of 1-4.

[0031] Figure 19 Plot showing in vitro RNA editing by gRNAs targeting SNCA-TIS. Y-axis: Percentage of RNA editing; X-axis: Guide constructs. Parent - P0: SEQ ID NO: 295; Progeny - P15: SEQ ID NO: 333, P16: SEQ ID NO: 390, P18: SEQ ID NO: 334, P20: SEQ ID NO: 335, P22: SEQ ID NO: 391, P24: SEQ ID NO: 336, P26: SEQ ID NO: 392, P28: SEQ ID NO: 393, P28: SEQ ID NO: 394, Structural diversity: SEQ ID NO: 395. DETAILED DESCRIPTION

[0032] RNA editing

[0033] RNA editing refers to the process by which RNA is modified by enzymes after its synthesis at a particular nucleoside. RNA editing can include any one of insertion, deletion, or substitution of nucleotides. Examples of RNA editing include chemical modifications such as pseudouridylation (isomerization of uridine residues) and deamination (removal of an amine group from cytidine to produce uridine, or C to U editing; or from adenosine to inosine, or A to I editing). RNA editing can be used to correct mutations (e.g., to correct missense mutations) to restore protein expression, and to introduce mutations or edit coding regions of RNA to achieve protein knockdown.

[0034] Described herein are engineered guide RNAs that facilitate RNA editing by RNA editing entities (e.g., adenosine deaminases acting on RNA (ADARs)) or biologically active fragments thereof. For example, the engineered guide RNAs of the present disclosure can facilitate editing of the transcription start site (e.g., codon 1 transcription start site) of a target SNCA mRNA (e.g., the engineered guide RNA of any one of SEQ ID NOS: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784). In some cases, ADAR can be an enzyme that catalyzes the chemical conversion of adenosine to inosine in RNA. Because inosine has properties similar to guanosine (e.g., inosine will form two hydrogen bonds with cytosine), inosine can be recognized by translational cellular machinery as guanosine. Thus, “adenosine-to-inosine (A-to-I) RNA editing” effectively changes the primary sequence of the RNA target. In general, ADAR enzymes share a common domain structure, including a variable number of amino-terminal dsRNA binding domains (dsRBDs) and a carboxy-terminal catalytic deaminase domain. Human ADARs possess two or three dsRBDs. There is evidence that ADARs can form homo- and heterodimers with other ADARs when bound to double-stranded RNA, but it is currently not determined whether dimerization is required for editing to occur. The engineered guide RNAs disclosed herein can facilitate RNA editing by any one or any combination of the three human ADAR genes (ADAR 1-3) that have been identified. ADARs have a typical modular domain organization, including at least two copies of a dsRNA binding domain (dsRBD; ADAR1 with three dsRBDs; ADAR2 and ADAR3 with two each) in their N-terminal region, followed by a C-terminal deaminase domain.

[0035] The engineered guide RNAs of the present disclosure (e.g., engineered guide RNAs comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) facilitate RNA editing by endogenous ADAR enzymes (e.g., SNCA exon 2 codon 1 transcription start site). In some embodiments, the engineered guide RNAs of the present disclosure can be encoded by a polynucleotide comprising a polynucleotide sequence of any one of SEQ ID NOs: 286-292, 325-332, 358-379, 441-776, or 785-792. In some embodiments, an exogenous ADAR can be delivered with the engineered guide RNAs disclosed herein to facilitate RNA editing. In some embodiments, the ADAR is human ADAR1. In some embodiments, the ADAR is human ADAR2. In some embodiments, the ADAR is human ADAR3. In some embodiments, the ADAR is human ADAR1, human ADAR2, human ADAR2, or any combination thereof.

[0036] TIS. In some embodiments, the engineered guide RNA of the present disclosure targets a target sequence of a target SNCA RNA comprising a translation initiation site (TIS), wherein the adenosine of the TIS is edited. In some embodiments, the engineered guide RNA of the present disclosure (e.g., an engineered guide RNA comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) can target a codon 1 TIS of exon 2 corresponding to a canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4). In some embodiments, an engineered guide RNA targeting the SNCA codon 1 TIS of exon 2 comprises a polynucleotide sequence of any one of SEQ ID NOs: 293-299, 334, or 340. In some embodiments, the engineered guide disclosed herein is at least partially complementary to the target SNCA RNA. In some cases, the target SNCA RNA comprises the following sequence: GCCAUUCGACGACAGUGUGGUGUAAAGGAAUUCAUUA GCCAUGGAUGUAUUCAUGAAAGGACUUUCAAAGGCCAAGGAGGGAGUUGUGGCUGCUGCUGAG (SEQ ID NO: 300). In some cases, the target SNCA RNA can comprise a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300. The engineered guide RNA of the present disclosure (e.g., SNCA) can be used to facilitate modification of a target RNA. In some embodiments, the engineered guide disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 300. In some embodiments, the engineered guide RNA hybridizes to at least 80 bases of a target RNA sequence having at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300, and facilitates protein knockdown. In some embodiments, the engineered guide RNA facilitates ADAR-mediated RNA editing of the TIS (AUG) to GUG. In some cases, this results in protein knockdown. Protein knockdown can also refer to a decrease in expression of a wild-type protein.In some cases, the engineered guides disclosed herein can facilitate ADAR-mediated RNA editing of one or more adenosines in the target RNA sequence of SEQ ID NO: 300, resulting in exon skipping. In some cases, exon skipping that occurs through editing of the SNCA codon 1 TIS results in a SNCA mRNA alternative splice variant. Without wishing to be bound by theory, alternative splicing can result in the production of SNCA mRNA alternative splice variants that lack exon 2 (containing the codon 1 TIS). Production of these alternative splice variants that lack exon 2 (and exon 2 codon 1 TIS) results in knockdown of wild-type alpha-synuclein protein. Thus, protein knockdown can be achieved through direct editing of the TIS itself (thereby reducing SNCA mRNA translation, or indirectly removing exon 2 TIS through exon skipping).

[0037] Engineered guide RNA

[0038] Disclosed herein are engineered guide RNAs (e.g., engineered guide RNAs comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) and engineered polynucleotides encoding the same for site-specific, selective editing of a target RNA (e.g., the SNCA codon 1 TIS of exon 2, which corresponds to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)) by an RNA editing entity or a biologically active fragment thereof. In some embodiments, an engineered guide RNA targeting the SNCA codon 1 TIS of exon 2 comprises a polynucleotide sequence of any one of SEQ ID NOs: 293-299, 334, or 340. In some embodiments, the engineered guide RNAs of the present disclosure can be encoded by a polynucleotide comprising a polynucleotide sequence of any one of SEQ ID NOs: 286-292, 325-332, 358-379, 441-776, or 785-792. In some embodiments, the engineered guide RNAs of the present disclosure target one or more adenosines in the RNA sequence of SEQ ID NO: 300 or a sequence having at least 80% identity to SEQ ID NO: 300.

[0039] In some embodiments, an engineered guide RNA of the disclosure targeting SNCA comprises a microfootprint sequence and / or a macrofootprint sequence, each comprising a latent structure such that when the engineered guide RNA hybridizes to a target RNA, the latent structure emerges. The latent structure, when emerging, creates at least one structural feature selected from the group consisting of a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof. In some embodiments, an engineered guide RNA of the disclosure forms a guide-target RNA scaffold upon hybridization of the engineered guide RNA to the sequence of a target RNA, comprising (i) a region comprising at least one structural feature; and (ii) a macrofootprint, such as a first internal loop (also referred to as a “left bell” or “LB”) and a second internal loop (also referred to as a “right bell” or “RB”), flanking opposite ends of the guide-target RNA scaffold region, wherein the engineered guide RNA promotes an increased amount of targeted editing of an adenosine of a target RNA by an adenosine deaminase RNA editing entity relative to other comparable engineered guide RNAs lacking the first internal loop and the second internal loop. As described herein, the first internal loop and the second internal loop can be described according to their position relative to an A / C mismatch in the target RNA scaffold, where the A in the A / C mismatch is the target adenosine of the SNCA target RNA.

[0040] Provided herein are microfootprint sequences that are latent structures that, when emerging, promote editing of an adenosine of a target RNA by an adenosine deaminase. Macrofootprints can be used to direct RNA editing entities (e.g., ADAR) and direct their activity to the microfootprint. In some embodiments, a nucleotide is contained within the microfootprint sequence, the position of which is such that when the guide RNA hybridizes to the target RNA, the nucleotide is opposite to the adenosine to be edited by the adenosine deaminase and does not base pair with the adenosine to be edited. This nucleotide is referred to herein as a “mismatch position” or “mismatch,” and can be a cytosine. The microfootprint sequences as described herein have at least one structural feature selected from the group consisting of a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof when the engineered guide RNA and the target RNA are hybridized. Engineered guide RNAs with superior microfootprint sequences can be selected based on their ability to promote editing of a particular target RNA, such as SNCA mRNA.

[0041] In some embodiments, the guide RNA of the present disclosure (e.g., a guide RNA comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) can further comprise a macrofootprint. In some embodiments, the macrofootprint comprises a dumbbell macrofootprint. The microfootprint can be used to guide the RNA editing enzyme and direct its activity to the target adenosine to be edited. A “dumbbell” as described herein refers to a pair of internal loop potential structures that emerge upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is located at the 5’ end or the 3’ end of the guide-target RNA scaffold formed upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is flanked on opposite sides of the microfootprint sequence. Insertion of a dumbbell macrofootprint sequence flanked on opposite sides of the microfootprint sequence upon hybridization of the guide RNA to the SNCA target RNA results in the formation of dumbbell internal loops on opposite sides of the microfootprint, which in turn comprise at least one structural feature that promotes editing of the SNCA target RNA.

[0042] Provided herein are engineered guide RNAs (such as potential guide RNAs comprising a microfootprint sequence and / or a macrofootprint sequence) and polynucleotides encoding the same; and compositions comprising the engineered guide RNAs or the polynucleotides. As used herein, the term “engineered” with respect to a guide RNA or a polynucleotide encoding the same refers to a guide RNA or a polynucleotide encoding the same that is not naturally occurring. For example, the present disclosure provides engineered polynucleotides encoding engineered guide RNAs. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified DNA bases and unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA bases and RNA bases.

[0043] The engineered guide RNAs described herein comprise a targeting domain that is complementary to a target RNA described herein. As such, the guide RNA can be engineered to site- specifically / selectively target and hybridize to a particular target RNA, thereby facilitating editing of a particular nucleotide in the target RNA by an RNA editing entity or biologically active fragment thereof. The targeting domain can include nucleotides positioned such that when the guide RNA hybridizes to the target RNA, the nucleotides are opposite the base to be edited by the RNA editing entity or biologically active fragment thereof and do not base pair or do not fully base pair with the base to be edited. This mismatch facilitates localization of the editing by the RNA editing entity to the desired base of the target RNA. However, in some cases, there can be some off-target editing in addition to the desired editing, and in some cases, significant off-target editing.

[0044] Hybridization of the targeting domain of the target RNA and the guide RNA creates a specific secondary structure in the guide-target RNA scaffold that emerges upon hybridization, which is referred to herein as the “latent structure.” The latent structure, when emerged, becomes a structural feature described herein, including the mismatch, bulge, internal loop, and hairpin. Without wishing to be bound by theory, the presence of the structural features described herein that emerge upon hybridization of the guide RNA to the target RNA configures the guide RNA to facilitate specific or selective targeted editing of the target RNA by the RNA editing entity or biologically active fragment thereof. Moreover, the structural features in combination with the above-described mismatch generally facilitate an increase in the amount of target adenosine editing, less off-target editing, or both, compared to constructs comprising only the mismatch or constructs with perfect complementarity to the target RNA. Thus, rational design of the latent structure in the engineered guide RNA of the present disclosure to create specific structural features in the guide-target RNA scaffold can be a powerful tool to facilitate target RNA editing with high specificity, selectivity, and robust activity.

[0045] Provided herein are engineered guides and polynucleotides encoding the same; and compositions comprising the engineered guide RNA or the polynucleotides. As used herein, the term “engineered” with respect to a guide RNA or a polynucleotide encoding the same refers to a guide RNA or a polynucleotide encoding the same that is not naturally occurring. For example, the present disclosure provides engineered polynucleotides encoding engineered guide RNAs. In some embodiments, the engineered guide comprises RNA. In some embodiments, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified DNA bases and unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA bases and RNA bases.

[0046] In some examples, the engineered guide provided herein comprises an engineered guide that can be configured to form, upon hybridization with a target RNA molecule, at least in part, a guide-target RNA scaffold with at least a portion of the target RNA molecule, wherein the guide-target RNA scaffold comprises at least one structural feature, and wherein the guide-target RNA scaffold recruits an RNA editing entity and facilitates chemical modification of a nucleotide base in the target RNA molecule by the RNA editing entity.

[0047] In some examples, the target RNA of the engineered guide RNA of the present disclosure can be a pre-mRNA or an mRNA. In some embodiments, the engineered guide RNA of the present disclosure hybridizes to a sequence of a target RNA. In some embodiments, a portion of the engineered guide RNA (e.g., a targeting domain) hybridizes to a sequence of the target RNA. The portion of the engineered guide RNA that hybridizes to the target RNA has sufficient complementarity to the sequence of the target RNA such that hybridization occurs.

[0048] A. Targeting Domain

[0049] The engineered guide RNAs disclosed herein can be engineered in any manner suitable for RNA editing. In some examples, the engineered guide RNA generally comprises at least one targeting sequence that allows it to hybridize to a region of a target RNA molecule (e.g., SNCA codon 1 TIS of exon 2, which corresponds to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)). The targeting sequence can also be referred to as a “targeting domain” or a “targeting region.”

[0050] In some cases, the targeting domain of the engineered guide allows the engineered guide to target an RNA sequence through base pairing (e.g., Watson Crick base pairing). In some examples, the targeting sequence can be located at the N-terminus or the C-terminus of the engineered guide. In some cases, the targeting sequence can be located at both termini. The targeting sequence can be of any length. In some cases, the targeting sequence can be at least about: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or up to about 200 nucleotides in length.In some cases, the targeting sequence can be no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, or 200 nucleotides in length. In some examples, the engineered guide comprises a targeting sequence that can be about 60 to about 500, about 60 to about 200, about 75 to about 100, about 80 to about 200, about 90 to about 120, or about 95 to about 115 nucleotides in length. In some examples, the engineered guide RNA comprises a targeting sequence that can be about 100 nucleotides in length.

[0051] In some cases, the targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target RNA. In some cases, the targeting sequence has less than 100% complementarity to the target RNA sequence. For example, the targeting sequence and the region of the target RNA that can be bound by the targeting sequence can have a single base mismatch.

[0052] The targeting sequence can have sufficient complementarity to the target RNA to allow the targeting sequence to hybridize to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, the antisense complementarity refers to non-contiguous fragments of the sequence. In some embodiments, the antisense complementarity refers to contiguous fragments of the sequence.

[0053] In some cases, an engineered guide RNA targeting SNCA can comprise multiple targeting sequences. In some cases, one or more target sequence domains in an engineered guide RNA can bind to one or more regions of a target SNCA RNA. For example, a first targeting sequence can be configured to be at least partially complementary to a first region of a target RNA (e.g., a first exon of a pre-mRNA), while a second targeting sequence can be configured to be at least partially complementary to a second region of the target RNA (e.g., a second exon of the pre-mRNA). In some cases, multiple targeting sequences can be operably linked to provide for the contiguous hybridization of multiple regions of a target RNA. In some cases, multiple targeting sequences can provide for the non-contiguous hybridization of multiple regions of a target RNA. “Non-contiguous” overlap or hybridization refers to the hybridization of a first region of a target SNCA RNA to a first targeting sequence, and the hybridization of a second region of the target SNCA RNA to a second targeting sequence, where the first and second regions of the target SNCA RNA are non-contiguous (e.g., there is an intervening sequence between the first and second regions of the target RNA). For example, a targeting sequence can be configured to bind to a portion of a first exon, and can comprise an internal asymmetric loop (e.g., oligo-tether) configured to bind to a portion of a second exon, while the intervening sequence between the portion of exon 1 and the portion of exon 2 is not hybridized by the targeting sequence or oligo-tether. The use of engineered guide RNAs configured for non-contiguous hybridization as described herein can provide a number of benefits. For example, such a guide can target a pre-mRNA during transcription (or shortly thereafter), and can then facilitate the co-transcriptional chemical modification using a deaminase (e.g., ADAR), thereby increasing the overall efficiency of chemical modification. Furthermore, the use of an oligo-tether to provide non-contiguous hybridization while skipping the intervening sequence can result in a shorter, more specific guide RNA with fewer off-target edits.

[0054] In some cases, an engineered guide RNA configured for non-contiguous hybridization to a target SNCA RNA (e.g., an engineered guide RNA comprising a target sequence with an oligomeric tether) can be configured to bind to different regions or target SNCA RNA separated by an insert sequence. In some cases, the insertion sequence can be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55 , 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650 0, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800,1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, or 10000 nucleotides. In some cases, the targeting sequence and the oligo tether can target different non-contiguous regions of the same intron or exon. In some cases, the targeting sequence and the oligo tether can target different non-contiguous regions of adjacent exons or introns. In some cases, the targeting sequence and the oligo tether can target different non-contiguous regions of distal exons or introns.

[0055] In some embodiments, a guide RNA or polynucleotide encoding a guide RNA disclosed herein can comprise a target sequence disclosed in Table 2, such as any one of SEQ ID NOS: 293-299, 333-357 (represented as DNA sequences in SEQ ID NOS: 286-292, 325-332, 358-374). In some embodiments, a composition can comprise an engineered guide RNA comprising any one of SEQ ID NOS: 293-299, 333-357. In some embodiments, a composition can comprise an engineered guide RNA comprising any one of SEQ ID NOS: 293-299, 334, or 340. In some embodiments, a composition can comprise an engineered guide RNA having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOS: 293-299, 333-357. In some embodiments, a composition can comprise an engineered guide RNA having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOS: 293-299, 334, or 340. In some embodiments, a composition can comprise a polynucleotide encoding an engineered guide RNA comprising any one of SEQ ID NOS: 293-299, 333-357. In some embodiments, a composition can comprise a polynucleotide encoding an engineered guide RNA comprising any one of SEQ ID NOS: 293-299, 334, or 340. In some embodiments, a composition can comprise a polynucleotide encoding an engineered guide RNA having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any one of SEQ ID NOS: 293-299, 333-357.In some embodiments, the composition can comprise a polynucleotide encoding an engineered guide RNA having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to any of any of SEQ ID NOs: 293-299, 334, or 340.

[0056] In some embodiments, hybridization of the targeting domain of the engineered guide RNA to the target SNCA RNA causes protein knockdown. For example, hybridization of the targeting domain of the engineered guide RNA to the sequence of the target SNCA RNA containing the exon 2 codon 1 TIS can cause silencing of the codon 1 TIS. The occurrence of this silencing can be due to, for example, ADAR-mediated editing of the adenosine of the codon 1 TIS when hybridization of the targeting domain to the target SNCA RNA causes the exon 2 TIS to be skipped, thereby silencing it by removing it from the mature SNCA mRNA. In some cases, silencing of the exon 2 codon 1 TIS can occur due to both ADAR-mediated editing of the exon 2 TIS and exon skipping of exon 2.

[0057] B. Engineered guide RNA with a recruiting domain

[0058] In some examples, the subject engineered guide RNA comprises a recruiting domain that recruits an RNA editing entity (e.g., ADAR), where in some examples the recruiting domain forms and exists without binding to a target RNA. A “recruiting domain” can be referred to herein as a “recruiting sequence” or “recruiting region.” In some examples, the engineered guides of the present disclosure can facilitate editing of a nucleotide base in a target sequence (e.g., SEQ ID NO: 300) of a target RNA that results in a modification of expression of a polypeptide encoded by the target RNA. The modification can be an increase in polypeptide expression or a decrease in polypeptide expression. In some cases, the engineered guide can be configured to facilitate editing of a nucleotide or polynucleotide base of a region of RNA by an RNA editing entity (e.g., ADAR). To facilitate editing, the engineered guide RNA of the present disclosure can recruit an RNA editing entity (e.g., ADAR). Various RNA editing entity recruiting domains can be utilized. In some examples, the recruiting domain comprises: a glutamate ionotropic receptor AMPA type subunit 2 (GluR2), an Alu sequence, or in the case of recruiting APOBEC, an APOBEC recruiting domain.

[0059] In some examples, more than one recruiting domain can be included in an engineered guide of the disclosure. In examples where a recruiting domain can be present, upon hybridization of the targeting sequence to the target sequence of the target RNA, the recruiting domain can serve to position the RNA editing entity to effectively react with the subject target RNA. In some cases, the recruiting domain can allow for transient binding of the RNA editing entity to the engineered guide. In some examples, the recruiting domain allows for permanent binding of the RNA editing entity to the engineered guide. The recruiting domain can be of any length. In some cases, the recruiting domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, up to about 80 nucleotides in length. In some cases, the recruiting domain can be no more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 nucleotides in length. In some cases, the recruiting domain can be about 45 nucleotides in length. In some cases, at least a portion of the recruiting domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of the recruiting domain comprises about 45 nucleotides to about 60 nucleotides.

[0060] In some embodiments, the recruiting domain comprises a GluR2 sequence or a functional fragment thereof. In some cases, the GluR2 sequence can be recognized by an RNA editing entity, such as ADAR or a biologically active fragment thereof. In some embodiments, the GluR2 sequence can be a non-naturally occurring sequence. In some cases, the GluR2 sequence can be modified, e.g., to enhance recruitment. In some embodiments, the GluR2 sequence can comprise a portion of a naturally occurring GluR2 sequence and a synthetic sequence.

[0061] In some examples, the recruitment domain comprises a GluR2 sequence, or a sequence having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity and / or length to GUGGAAU AGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 1). In some cases, the recruitment domain has at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 1. In some examples, the recruitment domain has at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and / or length to SEQ ID NO: 1.

[0062] Further contemplated are RNA editing entity recruitment domains. In one embodiment, the recruitment domain comprises an apolipoprotein B mRNA-editing enzyme, catalytic polypeptide-like (APOBEC) domain. In some cases, the APOBEC domain can comprise a non-naturally occurring sequence or a naturally occurring sequence. In some embodiments, the APOBEC domain coding sequence can comprise a modification moiety. In some cases, the APOBEC domain coding sequence can comprise a portion of a naturally occurring APOBEC domain coding sequence. In another embodiment, the recruitment domain can be from an Alu domain.

[0063] Any number of recruitment domains can be present in the engineered guide of the present disclosure. In some examples, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruitment domains can be included in the engineered guide. The recruitment domains can be located anywhere in the engineered guide RNA. In some cases, the recruitment domains can be located at the N-terminus, in the middle, or at the C-terminus of the engineered guide RNA. The recruitment domains can be upstream or downstream of the targeting sequence. In some cases, the recruitment domains flank the targeting sequence of the subject guide. The recruitment sequences can comprise all ribonucleotides or deoxyribonucleotides, although in some cases recruitment domains comprising ribonucleotides and deoxyribonucleotides cannot be excluded.

[0064] C. Engineered guide RNA with latent structure

[0065] In some examples, the engineered guide disclosed herein for facilitating an RNA editing entity to edit a target RNA can be an engineered latent guide RNA. An “engineered latent guide RNA” refers to an engineered guide RNA that comprises a latent structure. A “latent structure” refers to a structural feature that is substantially formed upon hybridization of the guide RNA to a target RNA. For example, the sequence of the guide RNA provides one or more structural features, but these structural features are substantially formed only upon hybridization to a target RNA, and thus the one or more latent structural features emerge as structural features upon hybridization to a target RNA. Upon hybridization of the guide RNA to a target RNA, the structural features are formed, and the latent structure provided in the guide RNA is thus revealed.

[0066] A double-stranded RNA (dsRNA) substrate is formed upon hybridization of the engineered guide RNA of the present disclosure to a target RNA (e.g., SNCA codon 1 TIS). The resulting dsRNA substrate is also referred to herein as a “guide-target RNA scaffold.”

[0067] Figure 1An illustration showing various exemplary structural features present in a guide-target RNA scaffold formed after hybridization of a potential guide RNA of the disclosure to a target RNA. The exemplary structural features shown include an 8 / 7 asymmetric bulge (8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (24 nucleotides on the target RNA side base pair with 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Unless otherwise specified, the number of nucleotides involved in a given structural feature is expressed as a ratio of the number of nucleotides on the target RNA side to the number of nucleotides on the guide RNA side. Also shown in this illustration is the position annotation for each figure. For example, the target nucleotide to be edited is designated as position 0. Downstream (3’) of the target nucleotide to be edited, each nucleotide is counted in increments of +1. Upstream (5’) of the target nucleotide to be edited, each nucleotide is counted in increments of -1. Thus, the example 2 / 2 symmetric bulge in this illustration is located at positions +12 to +13 in the guide-target RNA scaffold. Similarly, the 2 / 3 asymmetric bulge in this illustration is located at positions -36 to -37 in the guide-target RNA scaffold. As used herein, the position annotation is provided with respect to the target nucleotide to be edited and the target RNA side of the guide-target RNA scaffold. As used herein, if a single position is annotated, the structural feature extends away from that position from position 0 (the target nucleotide to be edited). For example, if a potential guide RNA is annotated herein as forming a 2 / 3 asymmetric bulge at position -36, the 2 / 3 asymmetric bulge is formed on the target RNA side of the guide-target RNA scaffold from position -36 to -37 relative to the target nucleotide to be edited (position 0). As another example, if a potential guide RNA is annotated herein as forming a 2 / 2 symmetric bulge at position +12, the 2 / 2 symmetric bulge is formed on the target RNA side of the guide-target RNA scaffold from position +12 to +13 relative to the target nucleotide to be edited (position 0).

[0068] In some examples, the engineered guides disclosed herein lack a recruiting region, and recruitment of the RNA editing entity can be achieved by structural features of the guide-target RNA scaffold formed by hybridization of the engineered guide RNA and the target RNA. In some examples, the engineered guide does not comprise a structural feature that recruits the RNA editing entity (e.g., ADAR) when present in an aqueous solution and not bound to a target RNA molecule. The engineered guide RNA forms one or more structural features that recruit the RNA editing entity (e.g., ADAR) together with the target RNA molecule upon hybridization with the target RNA.

[0069] In the absence of a recruiting sequence, the engineered guide RNA is still able to associate with the subject RNA editing entity (e.g., ADAR) to facilitate editing of the target RNA and / or modulate expression of the polypeptide encoded by the subject target RNA. This can be achieved by structural features formed in the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA with the target RNA. The structural features can include any of the following: a mismatch, a symmetric bulge, an asymmetric bulge, a symmetric internal loop, an asymmetric internal loop, a hairpin, a wobble base pair, or any combination thereof.

[0070] A double-stranded RNA (dsRNA) substrate is formed upon hybridization of the engineered guide RNA of the present disclosure with the target RNA. The resulting dsRNA substrate is also referred to herein as a “guide-target RNA scaffold.” Structural features that can be present in the guide-target RNA scaffold of the present disclosure are described herein. Examples of features include a mismatch, a bulge (a symmetric bulge or an asymmetric bulge), an internal loop (a symmetric internal loop or an asymmetric internal loop), or a hairpin (a recruiting hairpin or a non-recruiting hairpin). The engineered guide RNA of the present disclosure can have from 1 to 50 features. The engineered guide RNA of the present disclosure can have from 1 to 5, from 5 to 10, from 10 to 15, from 15 to 20, from 20 to 25, from 25 to 30, from 30 to 35, from 35 to 40, from 40 to 45, from 45 to 50, from 5 to 20, from 1 to 3, from 4 to 5, from 2 to 10, from 20 to 40, from 10 to 40, from 20 to 50, from 30 to 50, from 4 to 7, or from 8 to 10 features. In some embodiments, the structural features (e.g., a mismatch, a bulge, an internal loop) can be formed by a latent structure in the engineered potential guide RNA upon hybridization of the engineered potential guide RNA with the target RNA, and thus formation of the guide-target RNA scaffold. In some embodiments, the structural features are not formed by a latent structure, but are preformed structures (e.g., a GluR2 recruiting hairpin or a hairpin from U7 snRNA).

[0071] A double-stranded RNA (dsRNA) substrate (i.e., guide-target RNA scaffold) forms upon hybridization of an engineered guide RNA of the disclosure to a target RNA. As disclosed herein, a “mismatch” refers to a single nucleotide in a guide RNA that does not pair with an opposite single nucleotide in a target RNA within a guide-target RNA scaffold. A mismatch can comprise any two single nucleotides that do not base pair. When the number of participating nucleotides on the guide RNA side and the target RNA side exceeds 1, the resulting structure is no longer considered a mismatch, but is considered a bulge or internal loop, depending on the size of the structural feature. In some embodiments, a mismatch is an A / C mismatch. An A / C mismatch can comprise a C in an engineered guide RNA of the disclosure opposite an A in a target RNA. An A / C mismatch can comprise an A in an engineered guide RNA of the disclosure opposite a C in a target RNA. A G / G mismatch can comprise a G in an engineered guide RNA of the disclosure opposite a G in a target RNA.

[0072] In some embodiments, a mismatch located 5’ of an editing site can facilitate base flipping of a target A to be edited. A mismatch can also contribute to conferring sequence specificity.

[0073] Accordingly, a mismatch can be a structural feature of potential structure formation provided by an engineered potential guide RNA.

[0074] In another aspect, a structural feature comprises a wobble base. A wobble base pair refers to two bases that weakly base pair. For example, a wobble base pair of the disclosure can refer to a G paired with a U. Accordingly, a wobble base pair can be a structural feature of potential structure formation provided by an engineered potential guide RNA.

[0075] In some cases, a structural feature can be a hairpin. As disclosed herein, a hairpin comprises an RNA duplex, where a portion of a single RNA strand folds back on itself to form the RNA duplex. The portion of the single RNA strand folds back on itself due to having a nucleotide sequence that base pairs with itself, where the nucleotide sequence is separated by an intervening sequence that does not base pair with itself, thereby forming a base paired portion and an intervening loop portion that is not base paired. A hairpin can have from 10 to 500 nucleotides in length across the duplex structure. The loop portion of a hairpin can be from 3 to 15 nucleotides in length. A hairpin can be present within any of the engineered guide RNAs disclosed herein. An engineered guide RNA disclosed herein can have from 1 to 10 hairpins. In some embodiments, an engineered guide RNA disclosed herein has 1 hairpin. In some embodiments, an engineered guide RNA disclosed herein has 2 hairpins. As disclosed herein, a hairpin can comprise a recruiting hairpin or a non-recruiting hairpin. A hairpin can be located anywhere within an engineered guide RNA of the disclosure. In some embodiments, one or more hairpins are proximal to or present at the 3’ end of an engineered guide RNA of the disclosure, proximal to or present at the 5’ end of an engineered guide RNA of the disclosure, proximal to or within a targeting domain of an engineered guide RNA of the disclosure, or any combination thereof.

[0076] In some aspects, a structural feature comprises a non-recruiting hairpin. As disclosed herein, a non-recruiting hairpin does not have a primary function of recruiting a RNA editing entity. In some cases, a non-recruiting hairpin does not recruit a RNA editing entity. In some cases, a non-recruiting hairpin has a dissociation constant for binding a RNA editing entity under physiological conditions that is insufficient to bind. For example, a non-recruiting hairpin has a dissociation constant for binding a RNA editing entity at 25 °C that is greater than about 1 mM, 10 mM, 100 mM, or 1 M, as determined in an in vitro assay. A non-recruiting hairpin can exhibit a function that improves the positioning of an engineered guide RNA to a target RNA. In some embodiments, a non-recruiting hairpin improves nuclear retention. In some embodiments, a non-recruiting hairpin comprises a hairpin from U7 snRNA. Thus, a non-recruiting hairpin, such as a hairpin from U7 snRNA, is a preformed structural feature that can be present in a construct comprising an engineered guide RNA construct, rather than a structural feature formed from a potential structure provided in an engineered potential guide RNA.

[0077] A hairpin of the disclosure can have any length. In one aspect, a hairpin can be from about 10-500 or more nucleotides. In some cases, a hairpin can comprise about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267,268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500 or more nucleotides. In other cases, the hairpin can also comprise 10 to 20, 10 to 30, 10 to 40, 10 to 50, 10 to 60, 10 to 70,10 to 80, 10 to 90, 10 to 100, 10 to 110, 10 to 120, 10 to 130, 10 to 140, 10 to 150, 10 to 160, 10 to 170, 10 to 180, 10 to 190, 10 to 200, 10 to 210, 10 to 220, 10 to 230, 10 to 240, 10 to 250, 10 to 260, 10 to 270, 10 to 280, 10 to 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to 460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.

[0078] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) forms when an engineered guide RNA of the disclosure hybridizes to a target RNA. As disclosed herein, a bulge refers to a structure that forms substantially only upon formation of a guide-target RNA scaffold, in which consecutive nucleotides in either the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand. A bulge can alter the secondary or tertiary structure of the guide-target RNA scaffold. A bulge can independently have from 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold, and from 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or a bulge can independently have from 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold, and from 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge as used herein does not refer to a structure in which a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA are not base-paired, a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA that are not base-paired are referred to herein as a mismatch. Furthermore, when the number of participating nucleotides on either the guide RNA side or the target RNA side exceeds 4, the resulting structure is no longer considered a bulge, but is considered an internal loop. In some embodiments, a guide-target RNA scaffold of the disclosure has 2 bulges. In some embodiments, a guide-target RNA scaffold of the disclosure has 3 bulges. In some embodiments, a guide-target RNA scaffold of the disclosure has 4 bulges. Thus, a bulge can be a structural feature of potential structure formation provided by an engineered potential guide RNA.

[0079] In some embodiments, the presence of a bulge in the guide-target RNA scaffold can position or can help position ADAR to selectively edit target As in the target RNA and reduce off-target editing of non-target As in the target RNA. In some embodiments, the presence of a bulge in the guide-target RNA scaffold can recruit or help recruit additional amounts of ADAR. The bulge in the guide-target RNA scaffold disclosed herein can recruit other proteins, such as other RNA editing entities. In some embodiments, a bulge located 5’ of the editing site can facilitate base flipping of the target A to be edited. The bulge can also help confer sequence specificity of the A of the target RNA to be edited over other As present in the target RNA. For example, the bulge can help direct ADAR editing by constraining it in a direction that produces selective editing of the target A.

[0080] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) forms when the engineered guide RNA of the present disclosure hybridizes to the target RNA. The bulge can be a symmetric bulge or an asymmetric bulge. A “symmetric bulge” forms when there is an equal number of nucleotides on each side of the bulge. For example, a symmetric bulge in the guide-target RNA scaffold of the present disclosure can have an equal number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure can be formed by 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetric bulge can be a structural feature of potential structure formation provided by the engineered potential guide RNA.

[0081] A double-stranded RNA (dsRNA) substrate (i.e., guide-target RNA scaffold) forms when an engineered guide RNA of the disclosure hybridizes to a target RNA. The bulge can be a symmetric bulge or an asymmetric bulge. An “asymmetric bulge” forms when there are different numbers of nucleotides on each side of the bulge. For example, an asymmetric bulge in a guide-target RNA scaffold of the disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold.An asymmetric bulge of the disclosure can be formed from 1 nucleotide on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed from 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed from 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed from 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed from 2 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed from 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the disclosure can be formed from 3 nucleotides on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetric bulge can be a structural feature formed by the latent structure provided by the engineered latent guide RNA.

[0082] In some embodiments, an asymmetric bulge can be a 1 / 0 asymmetric bulge. In some embodiments, a 1 / 0 asymmetric bulge can be a U deletion. A “U deletion” refers to a 1 / 0 asymmetric bulge in which the U nucleotide of the engineered guide RNA that is opposite the non-target A of the target RNA in the guide-target RNA scaffold is deleted from the engineered guide RNA. In some cases, a 1 / 0 asymmetric bulge comprising a U deletion can reduce editing of the non-target A relative to a comparable guide RNA lacking the U deletion.

[0083] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of an engineered guide RNA of the disclosure to a target RNA. As disclosed herein, an internal loop refers to a structure that is formed substantially only upon formation of a guide-target RNA scaffold, in which nucleotides in the engineered guide RNA or the target RNA are not complementary to their positional counterparts on the opposite strand, and in which one side of the internal loop (on the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold) has 5 or more nucleotides. When the number of participating nucleotides on the guide RNA side and the target RNA side drops below 5, the resulting structure is no longer considered an internal loop, but is considered a bulge or a mismatch, depending on the size of the structural feature. An internal loop can be a symmetric internal loop or an asymmetric internal loop. An internal loop that is present near the editing site can help to flip the base of the target A in the target RNA to be edited.

[0084] One side of the internal loop (on the target RNA side or on the engineered guide RNA side of the guide-target RNA scaffold) can be formed by 5-150 nucleotides. One side of the internal loop can be formed by 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides therebetween. One side of the internal loop can be formed by 5 nucleotides. One side of the internal loop can be formed by 10 nucleotides. One side of the internal loop can be formed by 15 nucleotides. One side of the internal loop can be formed by 20 nucleotides. One side of the internal loop can be formed by 25 nucleotides. One side of the internal loop can be formed by 30 nucleotides. One side of the internal loop can be formed by 35 nucleotides. One side of the internal loop can be formed by 40 nucleotides. One side of the internal loop can be formed by 45 nucleotides. One side of the internal loop can be formed by 50 nucleotides. One side of the internal loop can be formed by 55 nucleotides. One side of the internal loop can be formed by 60 nucleotides. One side of the internal loop can be formed by 65 nucleotides. One side of the internal loop can be formed by 70 nucleotides. One side of the internal loop can be formed by 75 nucleotides. One side of the internal loop can be formed by 80 nucleotides. One side of the internal loop can be formed by 85 nucleotides. One side of the internal loop can be formed by 90 nucleotides. One side of the internal loop can be formed by 95 nucleotides. One side of the internal loop can be formed by 100 nucleotides. One side of the internal loop can be formed by 110 nucleotides. One side of the internal loop can be formed by 120 nucleotides. One side of the internal loop can be formed by 130 nucleotides. One side of the internal loop can be formed by 140 nucleotides. One side of the internal loop can be formed by 150 nucleotides. One side of the internal loop can be formed by 200 nucleotides. One side of the internal loop can be formed by 250 nucleotides. One side of the internal loop can be formed by 300 nucleotides. One side of the internal loop can be formed by 350 nucleotides. One side of the internal loop can be formed by 400 nucleotides. One side of the internal loop can be formed by 450 nucleotides. One side of the internal loop can be formed by 500 nucleotides. One side of the internal loop can be formed by 600 nucleotides. One side of the internal loop can be formed by 700 nucleotides. One side of the internal loop can be formed by 800 nucleotides. One side of the internal loop can be formed by 900 nucleotides. One side of the internal loop can be formed by 1000 nucleotides.Thus, the internal loop can be a structural feature formed by the potential structure formed by the engineered potential guide RNA.

[0085] A double-stranded RNA (dsRNA) substrate (i.e., guide-target RNA scaffold) forms when an engineered guide RNA of the disclosure hybridizes to a target RNA. An internal loop can be a symmetric internal loop or an asymmetric internal loop. A symmetric internal loop forms when there is an equal number of nucleotides on each side of the internal loop. For example, a symmetric internal loop in a guide-target RNA scaffold of the disclosure can have an equal number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 15 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 20 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 20 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 30 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 30 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 40 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 40 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 50 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 60 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the disclosure can be formed by 70 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 70 nucleotides on the target RNA side of the guide-target RNA scaffold.The symmetric internal loop of the disclosure can be formed by 80 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 80 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 90 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 100 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 100 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 110 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 120 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 130 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 130 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 140 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 140 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 200 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 250 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 300 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 300 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 350 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 400 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 450 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the disclosure can be formed by 500 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 500 nucleotides on the target RNA side of the guide-target RNA scaffold.The symmetric internal loop of the present disclosure can be formed by 600 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 600 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 700 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 700 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 800 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 800 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 900 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold target and 1000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, the symmetric internal loop can be a structural feature of the potential structure formed by the engineered potential guide RNA.

[0086] A double-stranded RNA (dsRNA) substrate (i.e., a guide-target RNA scaffold) is formed upon hybridization of the engineered guide RNA of the present disclosure to the target RNA. The internal loop can be a symmetric internal loop or an asymmetric internal loop. An asymmetric internal loop is formed when there are different numbers of nucleotides on each side of the internal loop. For example, an asymmetric internal loop in the guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.

[0087] An asymmetric internal loop of the disclosure can be formed by 5 to 150 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides on the engineered side of the guide-target RNA scaffold is different than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 to 1000 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold and 5 to 1000 nucleotides on the target RNA side of the guide-target RNA scaffold, wherein the number of nucleotides on the engineered side of the guide-target RNA scaffold is different than the number of nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold.An asymmetric internal loop of the disclosure can be formed from 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 7 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.An asymmetric internal loop of the disclosure can be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 8 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 5 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 200 nucleotides of the target RNA side of the guide-target RNA scaffold and 5 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 5 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 5 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 5 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 100 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 150 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 200 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 300 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 400 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 500 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 50 nucleotides of the target RNA side of the guide-target RNA scaffold and 1000 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 1000 nucleotides of the target RNA side of the guide-target RNA scaffold and 50 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 500 nucleotides of the target RNA side of the guide-target RNA scaffold and 50 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 400 nucleotides of the target RNA side of the guide-target RNA scaffold and 50 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold.An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 50 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 200 nucleotides of the target RNA side of the guide-target RNA scaffold and 50 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 50 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 50 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 150 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 200 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 300 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 400 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 500 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 100 nucleotides of the target RNA side of the guide-target RNA scaffold and 1000 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 1000 nucleotides of the target RNA side of the guide-target RNA scaffold and 100 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 500 nucleotides of the target RNA side of the guide-target RNA scaffold and 100 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 400 nucleotides of the target RNA side of the guide-target RNA scaffold and 100 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 100 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold.An asymmetric internal loop of the disclosure can be formed from 200 nucleotides of the target RNA side of the guide-target RNA scaffold and 100 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 100 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 200 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 300 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 400 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 500 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 150 nucleotides of the target RNA side of the guide-target RNA scaffold and 1000 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 1000 nucleotides of the target RNA side of the guide-target RNA scaffold and 150 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 500 nucleotides of the target RNA side of the guide-target RNA scaffold and 5 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 400 nucleotides of the target RNA side of the guide-target RNA scaffold and 150 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 150 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 200 nucleotides of the target RNA side of the guide-target RNA scaffold and 300 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 200 nucleotides of the target RNA side of the guide-target RNA scaffold and 400 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 200 nucleotides of the target RNA side of the guide-target RNA scaffold and 500 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold.An asymmetric internal loop of the disclosure can be formed from 200 nucleotides of the target RNA side of the guide-target RNA scaffold and 1000 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 1000 nucleotides of the target RNA side of the guide-target RNA scaffold and 200 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 500 nucleotides of the target RNA side of the guide-target RNA scaffold and 200 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 400 nucleotides of the target RNA side of the guide-target RNA scaffold and 200 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 200 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 400 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 500 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 300 nucleotides of the target RNA side of the guide-target RNA scaffold and 1000 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 1000 nucleotides of the target RNA side of the guide-target RNA scaffold and 300 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 500 nucleotides of the target RNA side of the guide-target RNA scaffold and 300 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 400 nucleotides of the target RNA side of the guide-target RNA scaffold and 300 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 400 nucleotides of the target RNA side of the guide-target RNA scaffold and 500 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 400 nucleotides of the target RNA side of the guide-target RNA scaffold and 1000 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 1000 nucleotides of the target RNA side of the guide-target RNA scaffold and 400 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold.An asymmetric internal loop of the disclosure can be formed from 500 nucleotides of the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered polynucleotide side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 500 nucleotides of the target RNA side of the guide-target RNA scaffold and 1000 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric internal loop of the disclosure can be formed from 1000 nucleotides of the target RNA side of the guide-target RNA scaffold and 500 nucleotides of the engineered guide RNA side of the guide-target RNA scaffold. Thus, an asymmetric internal loop can be a structural feature formed from potential structure provided by the engineered potential guide RNA.

[0088] As disclosed herein, a "base pairing (bp) region" refers to a region of the guide-target RNA scaffold in which bases in the guide RNA pair with the opposite bases in the target RNA. A base pairing region can extend from one end or the proximal end of one end of the guide-target RNA scaffold to or proximal to the other end of the guide-target RNA scaffold. A base pairing region can extend between two structural features. A base pairing region can extend from one end or the proximal end of one end of the guide-target RNA scaffold to or proximal to a structural feature. A base pairing region can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, a base pairing region has 1 bp to 100 bp, 1 bp to 90 bp, 1 bp to 80 bp, 1 bp to 70 bp, 1 bp to 60 bp, 1 bp to 50 bp, 1 bp to 45 bp, 1 bp to 40 bp, 1 bp to 35 bp, 1 bp to 30 bp, 1 bp to 25 bp, 1 bp to 20 bp, 1 bp to 15 bp, 1 bp to 10 bp, 1 bp to 5 bp, 5 bp to 10 bp, 5 bp to 20 bp, 10 bp to 20 bp, 10 bp to 50 bp, 5 bp to 50 bp, at least 1 bp, at least 2 bp, at least 3 bp, at least 4 bp, at least 5 bp, at least 6 bp, at least 7 bp, at least 8 bp, at least 9 bp, at least 10 bp, at least 12 bp, at least 14 bp, at least 16 bp, at least 18 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 60 bp, at least 70 bp, at least 80 bp, at least 90 bp, at least 100 bp.

[0089] The disclosure provides an engineered guide RNA (e.g., an engineered guide RNA comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) that targets a sequence of a SNCA target RNA (e.g., codon 1 TIS of exon 2, which corresponds to the canonical TIS at nucleotide position 226 of SNCA transcript variant 1 (NCBI Reference Sequence: NM_000345.4)). In some embodiments, the target RNA comprises the sequence of SEQ ID NO: 300. In some cases, the target RNA can comprise a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 300.

[0090] In some embodiments, an engineered guide RNA of the disclosure that targets the SNCA codon 1 TIS in exon 2 comprises one or more structural features, wherein the one or more structural features comprise at least a first 6 / 6 symmetric internal loop and at least a second 6 / 6 symmetric loop. In some embodiments, the first 6 / 6 symmetric internal loop is relative to the target adenosine at position 0; at a position selected from the group consisting of: 33, 32, 30, 28, and 26.

[0091] In some embodiments, the first 6 / 6 symmetric internal loop is relative to the target adenosine at position 0 at position 33. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 337.

[0092] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 338 or SEQ ID NO: 339.

[0093] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a U / G wobble base at position 5 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 340.

[0094] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity with SEQ ID NO: 298 or SEQ ID NO: 299.

[0095] In some embodiments, the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity with SEQ ID NO: 299.

[0096] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity with SEQ ID NO: 333.

[0097] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 334.

[0098] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 335.

[0099] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, a G / U wobble base at position -3 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 336.

[0100] In some embodiments, the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 295.

[0101] In some embodiments, the first 6 / 6 symmetric internal loop is at position 30 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetric internal loop at position -18 relative to position 0, a 3 / 3 symmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 297.

[0102] In some embodiments, the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetric internal loop at position -8 relative to position 0, an A / C mismatch at position 0, a G / U wobble base pair at position 2 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 293.

[0103] In some embodiments, the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetric internal loop at position -10 relative to position 0, a 0 / 1 asymmetric bulge at position -6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 294.

[0104] In some embodiments, the first 6 / 6 symmetric internal loop is at position 26 relative to the target adenosine at position 0. In some embodiments, the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetric bulge at position 5 relative to position 0, and any combination thereof. In some embodiments, the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97%, 99%, or 100% sequence identity to SEQ ID NO: 296.

[0105] D. Guides with Macrofootprints

[0106] The guide RNAs of the present disclosure can also comprise a macrofootprint. In some embodiments, the macrofootprint comprises a dumbbell macrofootprint. The microfootprint can serve to guide the RNA editing enzyme and direct its activity to the target adenosine to be edited. A “dumbbell” as described herein refers to a pair of internal loop potential structures that emerge upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is located at the 5’ end or the 3’ end of the guide-target RNA scaffold formed upon hybridization of the guide RNA to the target RNA. In some embodiments, each internal loop is flanked on opposite sides of the microfootprint sequence. The insertion of the dumbbell macrofootprint sequence flanking opposite sides of the microfootprint sequence results in the formation of dumbbell internal loops on opposite sides of the microfootprint upon hybridization of the guide RNA to the target RNA. In some cases, the dumbbell internal loops can comprise at least one structural feature that contributes to the editing of a particular target RNA.

[0107] In some embodiments, the presence of a dumbbell flanking the microfootprint can improve one or more aspects of editing. For example, the presence of a dumbbell macrofootprint in addition to the microfootprint can result in a greater amount of on-target adenosine editing relative to an otherwise comparable guide RNA that lacks the dumbbell. Additionally and / or alternatively, the presence of a dumbbell macrofootprint in addition to the microfootprint can result in a lesser amount of local off-target adenosine editing relative to an otherwise comparable guide RNA that lacks the dumbbell. Furthermore, while the effect of various microfootprint structural features can vary from target to target based on selection in high-throughput screens, the increase in one or more aspects of editing provided by the dumbbell macrofootprint structure can be independent of the particular target RNA. For example, the macrofootprint (e.g., dumbbell macrofootprint) and microfootprint can provide an increased amount of on-target adenosine editing relative to an otherwise comparable guide RNA that lacks the dumbbell upon hybridization of the guide RNA to the target RNA. In other embodiments, the presence of a dumbbell macrofootprint in addition to the microfootprint described herein can result in a lesser amount of local off-target adenosine editing relative to an otherwise comparable guide RNA that forms a guide-target RNA scaffold that lacks the dumbbell upon hybridization of the guide RNA to the target RNA.

[0108] As described herein, a "microfootprint" sequence refers to a sequence with a potential structure that, when manifested, facilitates editing of an adenosine of a target RNA by an adenosine deaminase. A macrofootprint can be used to direct or focus an RNA editing entity (e.g., ADAR) and direct its activity to the microfootprint. In some embodiments, a nucleotide within a microfootprint sequence is positioned such that, upon hybridization of the guide RNA to the target RNA, the nucleotide is opposite an adenosine to be edited by the ADAR enzyme and does not base pair with the adenosine to be edited. This nucleotide is referred to herein as a "mismatch position" or "mismatch," and can be a cytosine. A microfootprint sequence as described herein has at least one structural feature selected from the group consisting of a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof when the engineered guide RNA and the target RNA are hybridized. An engineered guide RNA with a high-quality microfootprint sequence can be selected based on its ability to facilitate editing of a particular target RNA. An engineered guide RNA selected for its ability to facilitate editing of a particular target can adopt various microfootprint potential structures, which can vary depending on the target.

[0109] In some embodiments, the presence of a dumbbell flanking the microfootprint can improve one or more aspects of editing. For example, the presence of a dumbbell macrofootprint in addition to a microfootprint can result in a greater amount of on-target adenosine editing relative to an otherwise comparable guide RNA lacking a dumbbell. Additionally and / or alternatively, the presence of a dumbbell macrofootprint in addition to a microfootprint can result in a lesser amount of local off-target adenosine editing relative to an otherwise comparable guide RNA lacking a dumbbell. Furthermore, while the effect of various microfootprint structural features can vary from target to target based on selection in high-throughput screens, the increase in one or more aspects of editing provided by a dumbbell macrofootprint structure can be independent of a particular target RNA. For example, a macrofootprint (e.g., a dumbbell macrofootprint) and a microfootprint can provide an increased amount of on-target adenosine editing relative to an otherwise comparable guide RNA lacking a dumbbell when the guide RNA is hybridized to the target RNA. In other embodiments, the presence of a dumbbell macrofootprint in addition to a microfootprint as described herein can result in a lesser amount of local off-target adenosine editing relative to an otherwise comparable guide RNA that forms a guide-target RNA scaffold lacking a dumbbell when the guide RNA is hybridized to the target RNA.

[0110] A dumbbell design in an engineered guide RNA includes two symmetric internal loops with a target A to be edited positioned between the two symmetric loops for selective editing of the target A. Each of the two symmetric internal loops is formed by 6 nucleotides on the guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a dumbbell can be a structural feature formed by a potential structure provided by an engineered potential guide RNA.

[0111] As disclosed herein, a "macrofootprint" sequence can be positioned such that it flanks a microfootprint sequence. Further, while a macrofootprint sequence can flank a microfootprint sequence, additional potential structures flanking either end of the macrofootprint can also be incorporated. In some embodiments, such additional potential structures are included as part of the macrofootprint. In some embodiments, such additional potential structures are separate, distinct, or both separate and distinct from the macrofootprint. In some embodiments, a macrofootprint sequence can include a dumbbell macrofootprint sequence comprising potential structures that, when manifested, produce a first internal loop and a second internal loop.

[0112] In some embodiments, the first internal loop of the dumbbell or the second internal loop of the dumbbell is located at least about 5 bases (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) from the A / C mismatch relative to the base of the first internal loop or the second internal loop closest to the A / C mismatch. In some embodiments, the first internal loop of the dumbbell or the second internal loop of the dumbbell is located at most about 50 bases (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5) from the A / C mismatch relative to the base of the first internal loop or the second internal loop closest to the A / C mismatch.

[0113] In some embodiments, the first internal loop or the second internal loop independently comprises at least about 5 bases or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150) of the engineered guide RNA; about 150 bases or less (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5) of the engineered guide RNA; or a base number of at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) and at least about 5 bases or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150) of the target RNA; about 150 bases or less (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5) of the target RNA; or a base number of at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-50) of the target RNA.

[0114] In some embodiments, provided herein are engineered guide RNAs comprising a dumbbell macrofootprint. In some embodiments, provided herein are engineered guide RNAs comprising a microfootprint. In some embodiments, provided herein are engineered guide RNAs comprising a macrofootprint and a microfootprint. In some cases, an engineered guide RNA disclosed herein can comprise a microfootprint, but no macrofootprint. In some cases, an engineered guide RNA disclosed herein can comprise a macrofootprint, but no microfootprint.

[0115] In some embodiments, the macrofootprint sequence can comprise a dumbbell macrofootprint sequence comprising a potential structure that, when manifested, produces a first internal loop and a second internal loop.

[0116] In some examples, the first internal loop is located near the 5' end of the guide-target RNA scaffold and the second internal loop is located near the 3' end of the guide-target RNA scaffold. The length of the dsRNA includes the 5' end and the 3' end, where up to half of the guide-target RNA scaffold length at the 5' end can be considered "near the 5' end" and up to half of the guide-target RNA scaffold length at the 3' end can be considered "near the 3' end." Non-limiting examples of the 5' end can include about 50% or less, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5% of the total length of the dsRNA at the 5' end. Non-limiting examples of the 3' end can include about 50% or less, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, or about 5% of the total length of the dsRNA at the 3' end.

[0117] In some embodiments, engineered guide RNAs of the disclosure comprising a dumbbell macrofootprint sequence (manifested as a first internal loop and a second internal loop) can improve RNA editing efficiency, generally increasing the amount or percentage of RNA editing, and for editing at a target nucleotide, for example, at a target adenosine. In some embodiments, engineered guide RNAs of the disclosure comprising a first internal loop and a second internal loop can also promote a decrease in the amount of or reduce off-target nucleotide editing, such as off-target adenosine or unintended adenosine editing. In some examples, the decrease or reduction can be in the number of off-target edits or the percentage of off-target edits.

[0118] Each of the first and second internal loops of the dumbbell macrofootprint can independently be symmetrical or asymmetrical, where the symmetry is determined by the number of bases or nucleotides of the engineered guide RNA and the number of bases or nucleotides of the target RNA that collectively form each of the first and second internal loops.

[0119] E. Additional engineered guide RNA components

[0120] The disclosure provides engineered guide RNAs with additional structural features and components. For example, the engineered guide RNAs described herein can be circular. In another example, the engineered guide RNAs described herein can comprise a U7, a SmOPT sequence, or a combination of both sequences.

[0121] In some cases, the engineered guide RNA can be cyclized. In some cases, the engineered guide RNA provided herein can be cyclic or in a cyclic configuration. In some aspects, at least a portion of the cyclic guide RNA lacks a 5' hydroxyl group or a 3' hydroxyl group. In some embodiments, the circular engineered guide RNA can include a guide RNA comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784.

[0122] In some examples, the engineered guide RNA can comprise a backbone comprising a plurality of sugar and phosphate moieties covalently linked together. In some examples, the backbone of the engineered guide RNA can comprise a phosphodiester bond between a first hydroxyl group in the phosphate group on the 5' carbon of deoxyribose in DNA or ribose in RNA and a second hydroxyl group on the 3' carbon of deoxyribose in DNA or ribose in RNA.

[0123] In some embodiments, the backbone of the engineered guide RNA may lack a 5' reduced hydroxyl group, a 3' reduced hydroxyl group, or both that can be exposed to a solvent. In some embodiments, the backbone of the engineered guide may lack a 5' reduced hydroxyl group, a 3' reduced hydroxyl group, or both that can be exposed to a nuclease. In some embodiments, the backbone of the engineered guide may lack a 5' reduced hydroxyl group, a 3' reduced hydroxyl group, or both that can be exposed to a hydrolase. In some cases, the backbone of the engineered guide may be represented as a polynucleotide sequence in a circular 2-dimensional format with one nucleotide connected to another. In some cases, the backbone of the engineered guide may be represented as a polynucleotide sequence in a circular 2-dimensional format with one nucleotide connected to another. In some cases, the 5' hydroxyl group, the 3' hydroxyl group, or both may be connected by a phosphorus-oxygen bond. In some cases, the 5' hydroxyl group, the 3' hydroxyl group, or both may be modified to a phosphate with a phosphorus-containing moiety.

[0124] As described herein, engineered guides can include a circular structure. Engineered polynucleotides can be circularized from a precursor engineered polynucleotide. Such a precursor engineered polynucleotide can be a precursor engineered linear polynucleotide. In some cases, the precursor engineered linear polynucleotide can be a precursor to a circular engineered guide RNA. For example, the precursor engineered linear polynucleotide can be a linear mRNA transcribed from a plasmid, which can be configured to be circularized within a cell using techniques described herein. The precursor engineered linear polynucleotide can be constructed to have domains that allow for circularization when inserted into a cell, such as a ribozyme domain and a ligation domain. The ribozyme domain can include a domain capable of cleaving the linear precursor RNA at a particular site (e.g., adjacent to the ligation domain). The precursor engineered linear polynucleotide can comprise, from 5’ to 3’: a 5’ ribozyme domain, a 5’ ligation domain, a circularization region, a 3’ ligation domain, and a 3’ ribozyme domain. In some cases, the circularization region can comprise a guide RNA described herein. In some cases, the precursor polynucleotide can be specifically processed at two sites by 5’ and 3’ ribozymes, respectively, to release exposed ends on the 5’ and 3’ ligation domains. The freely exposed ends can be ligation-competent, such that the ends can be ligated to form a mature circular structure. For example, the free ends can include a 5’-OH and a 2’,3’-cyclic phosphate, which are ligated by RNA ligation in a cell. Linear polynucleotides with ligation and ribozyme domains can be transfected into a cell, where they can be circularized by endogenous cellular enzymes. In some cases, the polynucleotide can encode an engineered guide RNA comprising a ribozyme and ligation domain described herein, which can be circularized within a cell. For example, PCT / US2021 / 034301 provides a description of circular guide RNAs and their structures, sequences of circular guide RNAs, and methods of engineering circular polynucleotide domains, and each of these descriptions in PCT / US2021 / 034301 are incorporated by reference herein.

[0125] The engineered polynucleotides described herein (e.g., circular guide RNAs) can include a spacer domain. As described herein, a spacer domain can refer to a domain that provides space between other domains. The spacer domain can be used between the region to be circularized and the flanking junction sequence to increase the overall size of the mature circular guide RNA. When the region to be circularized includes a targeting domain configured to associate with a target sequence as described herein, the addition of a spacer can provide the engineered polynucleotide with improved (e.g., increased specificity, enhanced editing efficiency, etc.) against the target polynucleotide relative to a comparable engineered polynucleotide lacking a spacer domain. In some cases, the spacer domain is configured to not hybridize to the target RNA. In some embodiments, a precursor engineered polynucleotide or circular engineered guide sequence can comprise, in 5' to 3' order: a first ribozyme domain; a first junction domain; a first spacer domain; a targeting domain that can be at least partially complementary to a target RNA, a second spacer domain, a second junction domain, and a second ribozyme domain. In some cases, the first spacer domain, the second spacer domain, or both are configured to not bind to the target RNA when the targeting domain binds to the target RNA.

[0126] A circular or looped RNA can be formed by using a self-cleaving entity such as a ribozyme, tRNA, aptamer, catalytically active fragment of any of these, or any combination thereof. For example, a ribozyme, tRNA, aptamer, catalytically active fragment of any of these, or any combination thereof can be added to the 3’ end, 5’ end, or both of a precursor engineered RNA. In another example, a ribozyme, tRNA, aptamer, catalytically active fragment of any of these, or any combination thereof can be added to the 3’ end, 5’ end, or both of a precursor engineered RNA. A self-cleaving ribozyme can include, for example, a RNase P RNA hammerhead ribozyme (e.g., Schistosoma mansoni ribozyme), glmS ribozyme, HDV-like ribozyme, R2 element, peptidyl transferase 23S rRNA, GIR1 branch ribozyme, leadzyme, group II intron, hairpin ribozyme, VS ribozyme, CPEB3 ribozyme, CoTC ribozyme, or group I intron. In some cases, a self-cleaving ribozyme can be a trans-acting ribozyme that links one RNA end it is on to a separate RNA end. In some embodiments, an aptamer can be added to each end of an engineered guide RNA. A ligase can be contacted with the aptamer at each end of the engineered guide RNA to form a covalent linkage between the aptamers, thereby forming a circular engineered guide RNA. In some cases, a self-cleaving element or aptamer can be configured to facilitate self-circularization of an engineered polynucleotide or pro-polynucleotide (e.g., from a precursor engineered polypeptide) after transcription in a cell. In some cases, circularization of a guide RNA can be shown by PCR. For example, primers can be developed that bind to the ends of a guide RNA and are directed outward, such that a product is formed only when the guide is circularized.

[0127] In some cases, circularization can occur through reverse splicing and ligation of exons. For example, an RNA can be engineered from 5’ to 3’ to include a forward-complementary sequence intron, an exon (which can include a guide sequence), and then a reverse-complementary sequence intron. Upon transcription, the complementary sequence introns can hybridize and form a dsRNA. The internal exon containing the guide sequence can be removed by splicing and ligated by endogenous ligases to form a circular guide. In one example, an engineered guide RNA can initiate circularization in a cell through a self-catalytic reaction of an encoded ribozyme. Upon cleavage by one or more ribozymes, a linear polynucleotide will be circularized by intracellular RNA ligation of the 5’ and 3’ ends of the ligation sequence by endogenous ligases.

[0128] Suitable self-cleaving molecules can include ribozymes. For example, a ribozyme domain can be produced from catalytic RNA. Ribozymes can include RNase P, rRNA (such as peptidyl transferase 23S rRNA), lead-dependent ribozyme, group I intron ribozyme, group II intron ribozyme, GIR1 branch ribozyme, glmS ribozyme, hairpin ribozyme, hammerhead ribozyme, HDV ribozyme, Twister ribozyme, Twister sister ribozyme, VS ribozyme, Pistol ribozyme, Hatchet ribozyme, viroid, or any combination thereof. The ribozyme can include a P3 Twister U2A ribozyme. The ribozyme can comprise 5’GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCT 3’ (SEQ ID NO: 313). The ribozyme can comprise 5’GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU 3’ (SEQ ID NO: 314). The ribozyme can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’GCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCT 3’ (SEQ ID NO: 313). The ribozyme can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’GCCAUCAGUCGCCGGUCCCAAGCCCGGAUAAAAUGGGAGGGGGCGGGAAACCGCCU 3’ (SEQ ID NO: 314). The ribozyme can include a P1 Twister ribozyme. The ribozyme can comprise 5’AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC 3’ (SEQ ID NO: 317). The ribozyme can comprise 5’AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC 3’ (SEQ ID NO: 318). The ribozyme can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’AACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC 3’ (SEQ ID NO: 317).The ribozyme can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’ AACACUGCCAAUGCCGGUCCCAAGCCCGGAUAAAAGUGGAGGGUACAGUCCACGC 3’ (SEQ ID NO: 318).

[0129] The ligation domain can facilitate covalent or non-covalent linkage of the first nucleotide to the second nucleotide. In some embodiments, the ligation domain can recruit a ligation entity to facilitate a ligation reaction. In some cases, the ligation domain can recruit a recombination entity to facilitate homologous recombination. In some cases, the first ligation domain can facilitate covalent or non-covalent linkage to the second ligation domain. In some embodiments, the first ligation domain can facilitate complementary pairing of the second ligation domain. In some cases, the ligation domain can comprise 5’ AACATGCCGACTGATGGCAG 3’ (SEQ ID NO: 320). In some embodiments, the ligation domain can comprise 5’ GATGTCAGGTGCGGCTGACTACCGTC 3’ (SEQ ID NO: 321). In some cases, the ligation domain can comprise 5’ AACCAUGCCGACUGAUGGCAG 3’ (SEQ ID NO: 322). In some cases, the ligation domain can comprise 5’ GAUGUCAGGUGCGGCUGACUACCGUC 3’ (SEQ ID NO: 323). In some cases, the ligation domain can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’ AACATGCCGACTGATGGCAG 3’ (SEQ ID NO: 320). In some cases, the ligation domain can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’ GATGTCAGGTGCGGCTGACTACCGTC 3’ (SEQ ID NO: 321). In some cases, the ligation domain can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’ AACCAUGCCGACUGAUGGCAG 3’ (SEQ ID NO: 322). In some cases, the ligation domain can have at least about 70%, 75%, 80%, 85%, 90%, 95%, or 100% sequence homology to 5’ GAUGUCAGGUGCGGCUGACUACCGUC 3’ (SEQ ID NO: 323).

[0130] The compositions and methods of the present disclosure provide engineered polynucleotides encoding guide RNAs operably linked to a portion of a small nuclear ribonucleic acid (snRNA) sequence. The engineered polynucleotides can include at least a portion of a small nuclear ribonucleic acid (snRNA) sequence. U7 and U1 small nuclear RNAs, whose natural role is splicesome processing of pre-mRNAs, have been redesigned for decades to alter splicing at desired disease targets. Replacing the first 18 nucleotides of U7 snRNA (naturally hybridizes to the spacer element of histone pre-mRNAs) with short targeting (or antisense) sequences of disease genes, redirects the splicing machinery to alter splicing around the target site. Additionally, converting the wild-type U7 Sm domain binding site to an optimized consensus Sm binding sequence (SmOPT) can increase the expression level, activity, and subcellular localization of the artificial antisense engineered U7 snRNA. Many subsequent research groups have adapted this modified U7 SmOPT snRNA chassis with antisense sequences of other genes to recruit splicesome elements and modify RNA splicing against additional disease targets.

[0131] snRNAs are a class of small RNA molecules found in the nucleus of eukaryotic cells. They are involved in a variety of important processes, such as RNA splicing (removal of introns from pre-mRNAs), regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintenance of telomeres. They are always associated with specific proteins, and the resulting RNA-protein complex is called a small nuclear ribonucleoprotein (snRNP) or sometimes snurps. There are many snRNAs, which are named U1, U2, U3, U4, U5, U6, U7, U8, U9, and U10.

[0132] snRNAs of the U7 type are generally involved in the maturation of histone mRNAs. This snRNA has been identified in a large number of eukaryotic species (56 so far), and the U7 snRNA of each of these species should be considered equally convenient for the present disclosure.

[0133] Wild-type U7 snRNA includes a stem-loop structure, a U7-specific Sm sequence, and a sequence antisense to the 3’ end of histone pre-mRNAs.

[0134] In addition to the SmOPT domain, U7 contains a sequence that is antisense to the 3' end of the histone pre-mRNA. When this sequence is replaced with a targeting sequence that is antisense to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Thus, stable expression of a modified U7 snRNA containing both the SmOPT domain and a targeting antisense sequence results in a specific change in mRNA splicing. While an AAV-2 / 1-based vector expressing an appropriately modified murine U7 gene and its native promoter and 3' elements enabled efficient gene transfer into skeletal muscle by covering and skipping mouse Dmd exon 23 and completing dystrophin rescue, the engineered polynucleotides described herein (whether administered directly or via, e.g., an AAV vector) can facilitate editing of a deaminase to a target RNA.

[0135] The engineered polynucleotide can comprise at least in part a snRNA sequence. The snRNA sequence can be a U1, U2, U3, U4, U5, U6, U7, U8, U9, or U10 snRNA sequence.

[0136] In some cases, an engineered polynucleotide comprising at least a portion of a snRNA sequence (e.g., a snRNA promoter, a snRNA hairpin, etc.) can have superior properties for treating or preventing a disease or disorder relative to a comparable polynucleotide lacking these features. For example, as described herein, an engineered guide RNA comprising at least a portion of a snRNA sequence can facilitate exon skipping of an exon more efficiently than a comparable polynucleotide lacking such features. Further, as described herein, an engineered polynucleotide comprising at least a portion of a snRNA sequence can facilitate editing of a nucleotide base in a target RNA (e.g., a pre-mRNA or a mature RNA) more efficiently than a comparable polynucleotide lacking these features. Promoters and snRNA components are described in PCT / US2021 / 028618 and PCT / US2022 / 078801, and each of these descriptions in PCT / US2021 / 028618 and PCT / US2022 / 078801 are incorporated by reference herein.

[0137] Disclosed herein are engineered RNAs comprising (a) an engineered guide RNA as described herein, and (b) a U7 snRNA hairpin sequence, a SmOPT sequence, or a combination thereof. In some embodiments, the U7 hairpin comprises a human U7 hairpin sequence or a mouse U7 hairpin sequence. In some cases, the human U7 hairpin sequence comprises TAGGCTTTCTGGCTTTTTACCGGAAAGCCCCT (SEQ ID NO: 301 or RNA: UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 302). In some cases, the mouse U7 hairpin sequence comprises CAGGTTTTCTGACTTCGGTCGGAAAACCCCT (SEQ ID NO: 303 or RNA: CAGGUUUUCUGACUUCGGUCGGAAAACCCCU SEQ ID NO: 304). In some embodiments, the SmOPT sequence has the sequence of AATTTTTGGAG (SEQ ID NO: 305 or RNA: AAUUUUUGGAG SEQ ID NO: 306). In some embodiments, a guide RNA targeting SNCA codon 1 TIS of exon 2 comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784 can include a guide RNA comprising a U7 hairpin sequence (e.g., a human or mouse U7 hairpin sequence), a SmOPT sequence, or a combination thereof. In some cases, a combination of a U7 hairpin sequence and a SmOPT sequence can comprise a SmOPT U7 hairpin sequence, wherein the SmOPT sequence is linked to the U7 sequence. In some cases, the U7 hairpin sequence, the SmOPT sequence, or a combination thereof is located downstream (e.g., 3') of an engineered guide RNA disclosed herein.

[0138] Also disclosed herein are promoters for driving expression of the guide RNAs disclosed herein. In some cases, the promoter for driving expression can be 5’ of the guide RNA sequence disclosed herein. In some cases, the promoter can comprise a U1 promoter, a U7 promoter, a U6 promoter, or any combination thereof. In some cases, the promoter can comprise a CMV promoter. In some cases, the U7 promoter or U6 promoter can be a mouse U7 promoter or a mouse U6 promoter. In some cases, the U1 promoter, U7 promoter, or U6 promoter can be a human U1 promoter, a human U7 promoter, or a human U6 promoter. In some cases, the human U6 promoter can comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the sequence: GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACC (SEQ ID NO: 307). In some cases, the mouse U6 promoter can comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the sequence: GTACTGAGTCGCCCAGTCTCAGATAGATCCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAGCTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGACAGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTATTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTTGGAGAAAAGCCTTGTTTG (SEQ ID NO: 308).In some cases, the human U7 promoter can comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the following sequence: TTAACAACAACGAAGGGGCTGTGACTGGCTGCTTTCTCAACCAATCAGCACCGAACTCATTTGCATGGGCTGAGAACAAATGTTCGCGAACTCTAGAAATGAATGACTTAAGTAAGTTCCTTAGAATATTATTTTTCCTACTGAAAGTTACCACATGCGTCGTTGTTTATACAGTAATAGGAACAAGAAAAAAGTCACCTAAGCTCACCCTCATCAATTGTGGAGTTCCTTTATATCCCATCTTCTCTCCAAACACATACGCA (SEQ ID NO: 309). In some cases, the mouse U7 promoter can comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the following sequence: TTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGC (SEQ ID NO: 310).In some cases, the human U1 promoter can comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the sequence: TAAGGACCAGCTTCTTTGGGAGAGAACAGACGCAGGGGCGGGAGGGAAAAAGGGAGAGGCAGACGTCACTTCCTCTTGGCGACTCTGGCAGCAGATTGGTCGGTTGAGTGGCAGAAAGGCAGACGGGGACTGGGCAAGGCACTGTCGGTGACATCACGGACAGGGCGACTTCTATGTAGATGAGGCAGCGCAGAGGCTGCTGCTTCGCCACTTGCTGCTTCGCCACGAAGGGAGTTCCCGTGCCCTGGGAGCGGGTTCAGGACCGCTGATCGGAAGTGAGAATCCCAGCTGTGTGTCAGGGCTGGAAAGGGCTCGGGAGTGCGCGGGGCAAGTGACCGTGTGTGTAAAGAGTGAGGCGTATGAGGCTGTGTCGGGGCAGAGCCCGAAGATCTC (SEQ ID NO: 311).In some cases, the CMV promoter can comprise a sequence having at least about 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the sequence: ATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGAGGATCGAACC (SEQ ID NO: 312).

[0139] E. Chemically modified guide RNA

[0140] An engineered guide RNA for treating a disease or disorder in a subject as described herein can comprise at least one chemical modification. In some embodiments, an engineered guide RNA can comprise at least one, two, three, four, five, six, seven, eight, nine, ten, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 50, 100, or more chemical modifications. In some embodiments, an engineered guide RNA described herein can comprise no chemical modifications. In some cases, an engineered guide RNA disclosed herein with a dumbbell macrofootprint can be manufactured, chemically modified, and delivered directly to a subject in need thereof as an RNA (without a vector, such as AAV).

[0141] Exemplary chemical modifications include any of the following: 5' adenosine acid, 5' guanosine-triphosphate cap, 5' N7-methylguanosine-triphosphate cap, 5' triphosphate cap, 3' phosphate, 3' thiophosphate, 5' phosphate, 5' thiophosphate, cis-Syn thymidine dimer, trimer, C12 spacer, C3 spacer, C6 spacer, dSpacer, PC spacer, rSpacer, Spacer 18, Spacer 9, 3'-3' modification, 5'-5' modification, abasic, acridine, azobenzene, biotin, biotin BB, biotin TEG, cholesteryl TEG, desulfitobiotin TEG, DNP TEG, DNP-X, DOTA, dT-biotin, dibiotin, PC biotin, psoralen C2, psoralen C6, TINA, 3'DABCYL, Black Hole Quencher 1, Black Hole Quencher 2, DABCYL SE, dT-DABCYL, RDye QC-1, QSY-21, QSY-35, QSY-7, QSY-9, carboxyl linker, thiol linker, 2' deoxyribonucleoside analog purine, 2' deoxyribonucleoside analog pyrimidine, ribonucleoside analog, 2'-O-methyl ribonucleoside analog, sugar modified analog, wobble / universal base, fluorescent dye label, 2' fluoro RNA, 2' O-methyl RNA, methylphosphonate, phosphodiester DNA, phosphodiester RNA, phosphorothioate DNA, phosphorothioate RNA, UNA, pseudouridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 2-O-methyl 3-thiophosphate, or any combination thereof.

[0142] Chemical modifications can be made at any position of the engineered guide RNA. In some cases, the modification can be at the 5’ or 3’ end, or both. In some cases, the polynucleotide can comprise a modification at a base selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150. In some cases, more than one modification can be made to the engineered guide RNA. In some cases, the modification can be permanent. In other cases, the modification can be temporary. In some cases, a plurality of modifications can be made to the engineered guide RNA. The engineered guide RNA modification can alter the physicochemical properties of the nucleotide, such as its conformation, polarity, hydrophobicity, chemical reactivity, base-pairing interactions, or any combination thereof.

[0143] In some embodiments, the chemical modification can also be a phosphorothioate substituent. In some cases, natural phosphodiester linkages can be susceptible to rapid degradation by cellular nucleases, while modification of the internucleotide linkage with a phosphorothioate (PS) linkage substituent can make it more stable to hydrolysis by cellular degradation. The modification can increase the stability of the polynucleic acid. The modification can also enhance biological activity. In some cases, the phosphorothioate enhanced RNA polynucleic acid can inhibit RNase A, RNase Tl, bovine serum nuclease, or any combination thereof. These properties can allow the use of PS-RNA polynucleic acids to be used in applications that can have a high probability of exposure to nucleases in vivo or in vitro. For example, a phosphorothioate (PS) linkage can be introduced between the last 3-5 nucleotides at the 5' or 3' end of the polynucleic acid, which can inhibit exonuclease degradation. In some cases, phosphorothioate linkages can be added throughout the polynucleic acid to reduce endonuclease attack.

[0144] In some embodiments, the chemical modification can occur at the 3' OH group, 5' OH group, backbone, sugar component, or nucleotide base. The chemical modification can include a non-naturally occurring linker molecule that is an inter- or intra-chain crosslink. In one aspect, the chemically modified nucleic acid comprises a modification of one or more of the 3' OH or 5' OH group, backbone, sugar component, or nucleotide base, or the addition of a non-naturally occurring linker molecule. In some embodiments, the chemically modified backbone includes a backbone other than a phosphodiester backbone. In some embodiments, the modified sugar includes a sugar other than deoxyribose (in modified DNA) or ribose (modified RNA). In some embodiments, the modified base includes a base other than adenine, guanine, cytosine, thymine, or uracil. In some embodiments, the engineered guide RNA comprises at least one chemically modified base. In some cases, the engineered guide RNA can comprise 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, or more modified bases. In some cases, the chemical modification to the base moiety includes natural modifications and synthetic modifications of adenine, guanine, cytosine, thymine, or uracil, and purine or pyrimidine bases.

[0145] In some embodiments, chemical modifications of the engineered guide RNA can include modification of any one or any combination of the following: modification of one or both non- linking phosphate oxygens in the phosphodiester backbone linkage; modification of one or more linking phosphate oxygens in the phosphodiester backbone linkage; modification of the ribose component; replacement of the phosphate moiety with a“dephospho” linker; modification or replacement of a naturally occurring nucleobase; modification of the ribo-phosphate backbone; modification of the 5’ end of the polynucleotide; modification of the 3’ end of the polynucleotide; modification of the deoxyribo-phosphate backbone; substitution of the phosphate group; modification of the ribo-phosphate backbone; modification of the sugar of the nucleotide; modification of the base of the nucleotide; or stereo- purity of the nucleotide. Chemical modifications of the engineered guide RNA include any modification contained herein, while some exemplary modifications are listed in Table 3.

[0146] Table 3. Exemplary chemical modifications

[0147]

[0148]

[0149] Modification of the phosphate backbone

[0150] In some embodiments, the chemical modification can include modification of one or both of the non-linking phosphate oxygens in the phosphodiester backbone linkage, or modification of one or more of the linking phosphate oxygens in the phosphodiester backbone linkage. As used herein, “alkyl” can mean a saturated hydrocarbon group that can be straight-chained or branched. Exemplary alkyl groups include methyl (Me), ethyl (Et), propyl (e.g., n-propyl or isopropyl), butyl (e.g., n-butyl, isobutyl, or t-butyl), or pentyl (e.g., n-pentyl, isopentyl, or neopentyl). An alkyl group can contain 1 to about 20, 2 to about 20, 1 to about 12, 1 to about 8, 1 to about 6, 1 to about 4, or 1 to about 3 carbon atoms. As used herein, “aryl” can mean a monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) aromatic hydrocarbon, such as phenyl, naphthyl, anthryl, phenanthryl, indanyl, or indenyl. In some embodiments, an aryl group has 6 to about 20 carbon atoms. As used herein, “alkenyl” can mean an aliphatic group containing at least one double bond. As used herein, “alkynyl” can mean a straight-chained or branched hydrocarbon chain containing 2-12 carbon atoms and characterized by having one or more triple bonds. Examples of alkynyl groups can include ethynyl, propargyl, or 3-hexynyl. “Arylalkyl” or “aralkyl” can mean an alkyl moiety in which an alkyl hydrogen atom can be replaced by an aryl group. Arylalkyl includes groups in which more than one hydrogen atom has been replaced by an aryl group. Examples of “arylalkyl” or “aralkyl” include benzyl, 2-phenylethyl, 3-phenylpropyl, 9-fluorenyl, benzhydryl, and triphenylmethyl. “Cycloalkyl” can mean a cyclic, bicyclic, tricyclic, or polycyclic non-aromatic hydrocarbon group having 3 to 12 carbons. Examples of cycloalkyl moieties include, but are not limited to, cyclopropyl, cyclopentyl, and cyclohexyl. “Heterocyclyl” can mean a monovalent radical of a heterocyclic ring system. Representative heterocyclyl groups include, but are not limited to, tetrahydrofuranyl, tetrahydrothiophenyl, pyrrolidinyl, pyrrolidonyl, piperidinyl, pyrrolinyl, piperazinyl, dioxanyl, dioxolanyl, diazepinyl, oxazepinyl, thiazepinyl, and morpholinyl. “Heteroaryl” can mean a monovalent radical of a heteroaromatic ring system. Examples of heteroaryl moieties can include imidazolyl, oxazolyl, thiazolyl, triazolyl, pyrrolyl, furanyl, indolyl, benzothiophenylpyrazolyl, pyridyl, pyrazinyl, pyridazinyl, pyrimidinyl, indolizinyl, purinyl, naphthyridinyl, quinolinyl, and pteridinyl.

[0151] ​​​In some embodiments, the phosphate groups of the chemically modified nucleotides can be modified by replacing one or more of the oxygens with different substituents. In some embodiments, the chemically modified nucleotides can include replacement of the unmodified phosphate moiety with a modified phosphate as described herein. In some embodiments, the modification of the phosphate backbone can include changes that result in uncharged linkages or charged linkages with asymmetric charge distribution. Examples of modified phosphate groups can include phosphorothioate, phosphonothioate, phosphoroselenoate, boranophosphonate, boranophosphonate, hydrogen phosphonate, phosphoramidate, alkyl or aryl phosphonate, and phosphotriester. In some embodiments, one of the non-bridging phosphate oxygens in the phosphate backbone moiety can be replaced with any one of the following groups: sulfur (S), selenium (Se), BR3(where R can be, for example, hydrogen, alkyl, or aryl), C (e.g., alkyl, aryl, etc.), H, NR2(where R can be, for example, hydrogen, alkyl, or aryl), or (where R can be, for example, alkyl or aryl). The phosphorus atom in the unmodified phosphate group can be achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorus atom chiral. The phosphorus atom in a phosphate group modified in this way can be a stereocenter. The stereogenic phosphorus atom can have an “R” configuration (referred to herein as Rp) or an “S” configuration (referred to herein as Sp). In some cases, the engineered guide RNA can comprise a stereopure nucleotide comprising an S conformation of phosphorothioate or an R conformation of phosphorothioate. In some embodiments, the chiral phosphate product can be present in a diastereomeric excess of 50%, 60%, 70%, 80%, 90%, or more. In some embodiments, the chiral phosphate product can be present in a diastereomeric excess of 95%. In some embodiments, the chiral phosphate product can be present in a diastereomeric excess of 96%. In some embodiments, the chiral phosphate product can be present in a diastereomeric excess of 97%. In some embodiments, the chiral phosphate product can be present in a diastereomeric excess of 98%. In some embodiments, the chiral phosphate product can be present in a diastereomeric excess of 99%. In some embodiments, both of the non-bridging oxygens of the phosphorodithioate can be replaced with sulfur. The phosphorus center in the phosphorodithioate can be achiral, preventing the formation of oligoribonucleotide diastereomers. In some embodiments, the modification to one or both of the non-bridging oxygens can also include replacement of the non-bridging oxygen with a group independently selected from S, Se, B, C, H, N, and OR (R can be, for example, alkyl or aryl). In some embodiments, the phosphate linkage can also be modified by replacing the bridging oxygen (i.e., linking the phosphate to the oxygen of the nucleoside) with nitrogen (bridging phosphoramidate), sulfur (bridging phosphorothioate), and carbon (bridging methylenephosphonate). In some cases, the replacement can occur on either or both of the linking oxygens.

[0152] In certain embodiments, the nucleic acid comprises linked nucleic acids. The nucleic acids can be linked together using any internucleic linkage. Two broad classes of internucleic linkages are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleic linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate (P=S). Representative non-phosphorus-containing internucleic linkage groups include, but are not limited to, methylene methylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-O-C(O)-S-), thioncarbamate (-O-C(O)(NH)-S-); siloxane (-O-Si(H)2-O-); and N,N*-dimethylhydrazine (-CH2-N(CH3)-N(CH3)). In certain embodiments, internucleic linkages having chiral atoms can be prepared as racemic mixtures, as individual enantiomers, such as alkylphosphonate and phosphorothioate. Non-natural nucleic acids can contain a single modification. Non-natural nucleic acids can comprise multiple modifications within one moiety or between different moieties.

[0153] In some cases, the backbone phosphate modifications of the nucleic acid include, but are not limited to, methylphosphonate, phosphorothioate, phosphoramidate (bridging or non-bridging), phosphotriester, phosphorodithioate, phosphodithioate, and boranophosphate, and can be used in any combination. Other non-phosphate linkages can also be used.

[0154] In some embodiments, the backbone modifications (e.g., methylphosphonate, phosphorothioate, phosphoramidate, and phosphorodithioate internucleotide linkages) can confer immunomodulatory activity and / or enhance the stability of the modified nucleic acid in vivo.

[0155] In some cases, the phosphorus derivative (or modified phosphate group) can be attached to a sugar or sugar analog moiety, and can be a mono-, di-, tri-phosphate, alkylphosphonate, phosphorothioate, phosphorodithioate, phosphoramidate, etc.

[0156] In some cases, backbone modification includes replacing phosphodiester linkages with alternative moieties such as anionic groups, neutral groups or cationic groups. Examples of such modifications include: linkages between anionic nucleosides; N3' to P5' phosphoramidate modifications; borane phosphate DNA; original oligonucleotides; linkages between neutral nucleosides, such as methylphosphonate; DNA connected by amides; methylene (methylimino) linkages; methylal and thioformal linkages; backbones containing sulfonyl groups; morpholino oligos; peptide nucleic acids (PNAs); and positively charged deoxyribonucleic acid guanidine (DNG) oligos. Modified nucleic acids can include chimeric or mixed backbones comprising one or more modifications, for example, a combination of phosphate linkages, such as a combination of phosphodiester and thiophosphate linkages.

[0157] In some cases, the substituent of phosphate includes, for example, linkage between short chain alkyl or cycloalkyl nucleoside, linkage between heteroatoms and alkyl or cycloalkyl nucleoside mixed, or linkage between one or more short chain heteroatoms or heterocyclic nucleoside.These include those with following: morpholino linkage (partially formed by the sugar moiety of nucleoside);Siloxane skeleton;Sulfide, sulfoxide and sulfone skeleton;Formyl acetyl and thioformyl acetyl skeleton;Methylene formyl acetyl and thioformyl acetyl skeleton;Skeleton containing olefin;Sulfaminate skeleton;Methylene imino and methylene hydrazine skeleton;Sulfonic acid ester and sulfonamide skeleton;Amide skeleton;And with N, O, S and CH2 other skeletons of mixing component parts.It should also be understood that in nucleotide substituents, the sugar and phosphate moieties of nucleotide can be replaced by, for example, amide type linkage (aminoethylglycine) (PNA).Other types of molecules (conjugates) can also be connected to nucleotides or nucleotide analogs, to enhance, for example, cellular uptake.In some cases, conjugates can be chemically connected to nucleotides or nucleotide analogs. Such conjugates include, but are not limited to, lipid moieties such as a cholesterol moiety, a thioether, e.g., hexyl-S-tritylthiol, thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or 1-di-O-hexadecyl-rac-glycerol triethylammonium-SH-phosphonate, a polyamine or polyethylene glycol chain, or adamantaneacetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

[0158] In some embodiments, the chemical modifications described herein can include modifications to the phosphate backbone. In some embodiments, the engineered guide RNAs described herein can comprise at least one chemically modified phosphate backbone. Exemplary chemical modifications to the phosphate group or backbone can include replacement of one or more of the oxygens with different substituents. In addition, the modified nucleotides present in the engineered guide RNA can include replacement of the unmodified phosphate moiety with a modified phosphate as described herein. In some embodiments, the modification to the phosphate backbone can include changes that result in uncharged linkages or charged linkages with asymmetric charge distribution. Exemplary modified phosphate groups can include phosphorothioates, phosphonothioates, phosphoroselenoates, boranophosphates, boranophosphates, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In some embodiments, one of the non-bridging phosphate oxygens in the phosphate backbone moiety can be replaced with any one of the following groups: sulfur (S), selenium (Se), BR3(where R can be, for example, hydrogen, alkyl, or aryl), C (e.g., alkyl, aryl, etc.), H, NR2(where R can be, for example, hydrogen, alkyl, or aryl), or OR (where R can be, for example, alkyl or aryl). The phosphorus atom in an unmodified phosphate group can be achiral. However, replacement of one of the non-bridging oxygens with one of the above atoms or groups of atoms can render the phosphorus atom chiral; it can also be said that the phosphorus atom in a phosphate group modified in this way can be a stereocenter. The stereocenter phosphorus atom can have an “R” configuration (referred to herein as Rp) or an “S” configuration (referred to herein as Sp). In this case, the chemically modified engineered guide RNA can be stereochemically pure (e.g., either the S or R conformation). In some cases, the chemically modified engineered guide RNA comprises a stereochemically pure phosphate modification. For example, the chemically modified engineered guide RNA can comprise the S conformation of phosphorothioate or the R conformation of phosphorothioate.

[0159] Both non-bridging oxygens in a phosphorodithioate are replaced with sulfur. The phosphorus center in a phosphorodithioate can be achiral, preventing the formation of oligoribonucleotide diastereomers. In some embodiments, the modification to one or both non-bridging oxygens can also include replacement of the non-bridging oxygen with a group independently selected from S, Se, B, C, H, N, and OR (R can be, for example, alkyl or aryl).

[0160] In some cases, the phosphate linkage can also be modified by replacing the bridging oxygen (i.e., the oxygen linking the phosphate to the nucleoside) with nitrogen (bridging phosphoramidate), sulfur (bridging phosphorothioate), and carbon (bridging methylenephosphonate). The replacement can occur on either connecting oxygen or both connecting oxygens.

[0161] Replacement of phosphate moieties

[0162] In some embodiments, at least one phosphate group of an engineered guide RNA can be chemically modified. In some embodiments, a phosphate group can be replaced with a non-phosphorus-containing linker. In some embodiments, a phosphate moiety can be replaced with a dephospho linker. In some embodiments, a charged phosphate group can be replaced with a neutral group. In some cases, a phosphate group can be replaced with a methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, oxirane linker, sulfonate, sulfonamide, thiomethyl acetal, methyl acetal, oxime, methyleneimino, methylene methyl imino, methylene hydrazine, methylene dimethyl hydrazine, and methylene oxymethyl imino. In some embodiments, the nucleotide analogs described herein can also be modified at the phosphate group. Modified phosphate groups can include modifications at the linkage between two nucleotides with phosphorothioate, chiral phosphorothioate, dithiophosphate, phosphotriester, aminoalkyl phosphotriester, methyl and other alkyl phosphonates including 3’-alkylene phosphonate and chiral phosphonates, phosphinate, phosphoramidate (e.g., 3’-amino phosphoramidate and aminoalkyl phosphoramidate), thiocarbamino phosphoramidate, thiocarbonlyl phosphoramidate, thiocarbonyl alkyl phosphoramidate, and boranophosphate. In some cases, the phosphate or modified phosphate linkage between two nucleotides can be achieved by a 3’-5’ linkage or a 2’-5’ linkage, and the linkage includes an inverted polarity such as 3’-5’ to 5’-3’ or 2’-5’ to 5’-2’.

[0163] Substitution of phosphate groups

[0164] In some embodiments, the chemical modifications described herein can include modifications achieved by substitution of phosphate groups. In some embodiments, the engineered guide RNAs described herein can comprise at least one chemical modification including substitution or replacement of phosphate groups. An exemplary substitution of phosphate groups can include a non-phosphorus-containing linker. In some embodiments, the substitution or replacement of phosphate groups can include replacement of a charged phosphate group with a neutral moiety. Exemplary moieties that can replace a phosphate group can include methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, oxirane linker, sulfonate, sulfonamide, thiomethyl acetal, methyl acetal, oxime, methyleneimino, methylene methyl imino, methylene hydrazine, methylene dimethyl hydrazine, and methylene oxymethyl imino.

[0165] Modifications of ribophosphate backbone

[0166] In some embodiments, the chemical modifications described herein can include modification of the ribophosphate backbone of the engineered guide RNA. In some embodiments, the engineered guide RNA described herein can comprise at least one chemically modified ribophosphate backbone. Exemplary chemically modified ribophosphate backbones can include scaffolds that can mimic nucleic acids, in which the phosphate linkers and riboses can be replaced with nuclease resistant nucleoside or nucleotide surrogates. In some embodiments, the nucleobases can be tethered with alternative scaffolds. Examples can include morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0167] Modification of sugars

[0168] In some embodiments, the chemical modifications described herein can include modification of sugars. In some embodiments, the engineered guide RNA described herein can comprise at least one chemically modified sugar. Exemplary chemically modified sugars can include the 2’ hydroxyl (OH) group modified or replaced with a number of different “oxy” or “deoxy” substituents. In some embodiments, modification of the 2’ hydroxyl group can enhance the stability of the nucleic acid, as the hydroxyl group can no longer be able to deprotonate to form a 2’-olate ion. The 2’-olate can catalyze degradation through an intramolecular nucleophilic attack on the linker phosphorus atom. Examples of “oxy”-2’ hydroxyl modifications can include alkoxy or aryloxy (OR, where “R” can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), O(CH2CH2O) n CH2CH2OR, where R can be, for example, H or optionally substituted alkyl, and n can be an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20). In some embodiments, the “oxy”-2’ hydroxyl modification can include (LNA, where the 2’ hydroxyl group can be linked to the 4’ carbon of the same ribose, for example, by a Ci-6 alkylene or Cj-6 heteroalkylene bridge, where exemplary bridges can include methylene, propylene, ether, or amino bridges; O-amino (where the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH2) n- amino (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroaryl amino, or diheteroaryl amino, ethylenediamine, or polyamino). In some embodiments, the "oxy" -2' hydroxyl modification can include methoxyethyl (MOE), (OCH2CH2OCH3, for example, PEG derivatives). In some cases, the deoxy modification can include hydrogen (i.e., deoxyribose, for example, at the overhang portion of a partial dsRNA); halogen (e.g., bromo, chloro, fluoro, or iodo); amino (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroaryl amino, diheteroaryl amino, or amino acid); NH(CH2CH2NH) n CH2CH2-amino (wherein the amino group can be, for example, as described herein), NHC(O)R (wherein R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano; thiol; alkyl-thio-alkyl; thioalkoxy; and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, which can be optionally substituted with, for example, amino as described herein. In some cases, the sugar group can also include one or more carbons having the opposite stereochemical configuration as the corresponding carbon in ribose. Thus, the modified nucleic acid can include nucleotides containing, for example, arabinose as the sugar. The nucleotide "monomer" can have an alpha linkage at the Γ position of the sugar, for example, an alpha-nucleoside. The modified nucleic acid can also include "abasic" sugars, which lack a nucleobase at the C-. The abasic sugar can also be further modified on one or more constituent sugar atoms. The modified nucleic acid can also include one or more sugars that can be in the L form, for example, L-nucleosides. In some aspects, the engineered guide RNA described herein includes a sugar group ribose, which can be a 5-membered ring with an oxygen. Exemplary modified nucleosides and modified nucleotides can include replacing the oxygen in ribose (e.g., with sulfur (S), selenium (Se), or an alkylene group, such as methylene or ethylene); adding a double bond (e.g., to replace ribose with a cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6 or 7-membered ring with an additional carbon or heteroatom, for example, a dehydrated hexitol, altrose, mannose, cyclohexyl, cyclohexenyl, and morpholino, which also has a phosphoramidate backbone). In some embodiments, the modified nucleotide can include a polycyclic form (e.g., tricyclic; and "non-locked" forms, such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, wherein ribose can be replaced with a glycol unit attached to a phosphodiester bond), threose nucleic acids. In some embodiments, the modification to the sugar of the engineered guide RNA includes modifying the engineered guide RNA to include a locked nucleic acid (LNA), a non-locked nucleic acid (UNA), or a bridged nucleic acid (BNA).

[0169] Modifications of the ribose component

[0170] In some embodiments, the engineered guide RNA described herein can comprise at least one chemical modification of the ribose component. In some embodiments, the chemical modification of the ribose component can include 2’-O-methyl, 2’-O-methoxy-ethyl (2’-MOE), 2’-fluoro, 2’-aminoethyl, 2’-deoxy-2’-fluoro arabino nucleic acid, 2’-deoxy, 2’-O-methyl, 3’-thiophosphates, 3’-phosphonoacetate (PACE), or 3’-phosphono thioacetate (thioPACE). In some embodiments, the chemical modification of the ribose component includes a non-natural nucleic acid. In some cases, the non-natural nucleic acid includes a modification on the 5’ and 2’ positions of the sugar ring, such as a 5’-CH2-substituted 2’-O-protected nucleoside. In some cases, the non-natural nucleic acid includes amide-linked nucleoside dimers that can be prepared for incorporation into oligonucleotides. In some cases, the 3' linked nucleoside in the dimer (5' to 3') comprises 2'-OCH3 and 5'-(S)-CH3. The non-natural nucleic acid can include 2’-substituted 5’-CH2 (or O) modified nucleosides. The non-natural nucleic acid can include 5’-methylene phosphonate DNA and RNA monomers and dimers. The non-natural nucleic acid can include 2’-substituted 5’-phosphonate monomers and other modified 5’-phosphonate monomers. The non-natural nucleic acid can include 5’-modified methylene phosphonate monomers. The non-natural nucleic acid can include analogs of 5’ or 6’-phosphonate ribonucleosides comprising a hydroxyl group at the 5’ and / or 6’ position. The non-natural nucleic acid can include 5'-phosphonate deoxyribonucleoside monomers and dimers with a 5’-phosphate group. The non-natural nucleic acid can include nucleosides with a 6’-phosphonate group, wherein the 5’ or / and 6’-position can be unsubstituted or substituted with a thio-tert-butyl (SC(CH3)3) (and analogs thereof); methyleneamino (CH2NH2) (and analogs thereof) or cyano (CN) (and analogs thereof).

[0171] In some embodiments, the non-natural nucleic acid also includes modifications of the sugar moiety. In some cases, the nucleic acid can contain one or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides can confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological property. In certain embodiments, the nucleic acid can comprise a chemically modified furanose ring moiety. Examples of chemically modified furanose ring include, but are not limited to, addition of a substituent (including 5’ and / or 2’ substituents; bridging two ring atoms to form a bicyclic nucleic acid; replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R2) (R = H, C1-C6 alkyl, or protecting group); and combinations thereof. 12 alkyl or protecting group).

[0172] In some cases, the engineered guide RNAs described herein can comprise modified sugars or sugar analogs. Thus, in addition to ribose and deoxyribose, the sugar moiety can be a pentose, deoxypentose, hexose, deoxyhexose, glucose, arabinose, xylose, lyxose, or the sugar "analog" cyclopentyl. The sugar can be in the pyranosyl or furanosyl form. The sugar moiety can be a furanoside of ribose, deoxyribose, arabinose, or 2'-0-alkylribose, and the sugar can be attached to the corresponding heterocyclic base in the [alpha] or [beta] anomeric configuration. Sugar modifications include, but are not limited to, 2'-alkoxy-RNA analogs, 2'-amino-RNA analogs, 2'-fluoro-DNA, and 2'-alkoxy- or amino-RNA / DNA chimeras. For example, the sugar modification can include 2'-0-methyl-uridine or 2'-0-methyl-cytidine. Sugar modifications include 2'-0-alkyl substituted deoxyribose nucleosides and 2'-0- glycol-like ribonucleosides.

[0173] In some cases, the modifications to the sugar moiety include natural modifications of ribose and deoxyribose as well as non-natural modifications. Sugar modifications include, but are not limited to, the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, wherein alkyl, alkenyl, and alkynyl can be substituted or unsubstituted C1to C 10 alkyl or C2to C 10 alkenyl and alkynyl. 2' sugar modifications also include, but are not limited to, -0[(CH2) n O] m CH3, -0(CH2) n OCH3, -0(CH2) n NH2, -0(CH2) n CH3, -0(CH2) n ONH2, and -0(CH2) n ON[(CH2)n CH3)]2, wherein n and m can be 1 to about 10. Other chemical modifications at the 2' position include, but are not limited to: C1to C 10Lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2 CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, group for improving the pharmacokinetic properties of oligonucleotides, or group for improving the pharmacodynamic properties of oligonucleotides, and other substituents with similar properties. Similar modifications can also be made at other positions of the sugar, specifically, at the 3' position of the sugar on the 3' terminal nucleotide or in the 2'-5' linked oligonucleotide and the 5' position of the 5' terminal nucleotide. Chemically modified sugars also include those containing modifications (such as CH2 and S) on the bridging epoxide. Nucleotide sugar analogs can also have sugar mimetics, such as replacing the pentofuranosyl sugar with a cyclobutyl moiety. Examples of nucleic acids having modified sugar moieties include, but are not limited to, nucleic acids comprising 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH3, and 2'-O(CH2)2OCH3 substituents. The substituent at the 2' position can also be selected from allyl, amino, azido, thio, O-allyl, O-(C1-C 1O alkyl), OCF3, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ) and O-CH2-C(=O)-N(R m )(R n ), where each R m and R n are independently H or substituted or unsubstituted C1-C 10 alkyl.

[0174] In certain embodiments, nucleic acids as described herein may include one or more bicyclic nucleic acids. In certain such embodiments, bicyclic nucleic acids include a bridge between 4' ribosyl ring atoms and 2' ribosyl ring atoms. In certain embodiments, nucleic acids provided herein may include one or more bicyclic nucleic acids, wherein the bridge includes a 4' to 2' bicyclic nucleic acid. Examples of such 4' to 2' bicyclic nucleic acids include, but are not limited to, one of the following formulae: 4'-(CH2)-O-2'(LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2'(ENA); 4'-CH(CH3)-O-2' and 4'-CH(CH2OCH3)-O-2' and analogs thereof; 4'-C(CH3)(CH3)-O-2' and analogs thereof.

[0175] Modification of nucleotide bases

[0176] In some embodiments, the chemical modifications described herein can include modifications of nucleotide bases (e.g., nucleobases). Exemplary nucleobases can include adenine (A), thymine (T), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or replaced in the engineered guide RNAs described herein. The nucleobases of the nucleotides can be independently selected from purines, pyrimidines, purine or pyrimidine analogs. In some embodiments, the nucleobases can be naturally occurring or synthetic base derivatives.

[0177] In some embodiments, the chemical modifications described herein can include modifications to uracils. In some embodiments, the engineered guide RNAs described herein can comprise at least one chemically modified uracil.Exemplary chemically modified uracils can include pseudouridine, pyridin-4-one ribonucleoside, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), 3-methyl-uridine, 5-methoxy-uridine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine, 5-methylaminomethyl-uridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uridine, 1 methyl-pseudouridine, 5-methyl-2-thio-uridine, 1-methyl-4-thio-pseudouridine, 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, a-thio-uridine, 2’-O-methyl-uridine, 5,2’-O-dimethyl-uridine, 2’-O-methyl-pseudouridine, 2-thio-2’-O-methyl-uridine, 5-methoxycarbonylmethyl-2’-O-methyl-uridine, 5-carbamoylmethyl-2’-O-methyl-uridine, 5-carboxymethylaminomethyl-2’-O-methyl-uridine, 3,2’-O-dimethyl-uridine, 5-(isopentenylaminomethyl)-2’-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2’-F-arabinouridine, 2’-F-uridine, 2’-OH-arabinouridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine, pyrazolo[3,4-d]pyrimidine, xanthine, and hypoxanthine.

[0178] In some embodiments, the chemical modifications described herein can include modifications to cytosines. In some embodiments, the engineered guide RNAs described herein can comprise at least one chemically modified cytosine. Exemplary chemically modified cytosines can include 5-aza-cytidine, 6-aza-cytidine, pseudisocytidine, 3-methyl-cytidine, N4-acetyl-cytidine, 5-formyl-cytidine, N4-methyl-cytidine, 5-methyl-cytidine, 5-halo-cytidine, 5-hydroxymethyl-cytidine, 1-methyl-pseudisocytidine, pyrrolo-cytidine, pyrrolo-pseudisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudisocytidine, 4-thio-1-methyl-pseudisocytidine, 4-thio-1-methyl-1-deaza-pseudisocytidine, 1-methyl-1-deaza-pseudisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudisocytidine, 4-methoxy-1-methyl-pseudisocytidine, lysidine, a-thio-cytidine, 2’-O-methyl-cytidine, 5,2’-O-dimethyl-cytidine, N4-acetyl-2’-O-methyl-cytidine, N4,2’-O-dimethyl-cytidine, 5-formyl-2’-O-methyl-cytidine, N4,N4,2’-O-trimethyl-cytidine, 1-thio-cytidine, 2’-F-arabinocytidine, 2’-F-cytidine, and 2’-OH-arabinocytidine.

[0179] In some embodiments, the chemical modifications described herein can include modifications to adenines. In some embodiments, the engineered guide RNAs described herein can comprise at least one chemically modified adenine. Exemplary chemically modified adenines can include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenosine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenosine, 2-methyl-adenine, N6-methyl-adenosine, 2-methylthio-N6-methyl-adenosine, N6-isopentenyl-adenosine, 2-methylthio-N6-isopentenyl-adenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinamido-carbonyl-adenosine, N6-threoninamido-carbonyl-adenosine, N6-methyl-N6-threoninamido-carbonyl-adenosine, 2-methylthio-N6-threoninamido-carbonyl-adenosine, N6,N6-dimethyl-adenosine, N6-hydroxy-norvalinamido-carbonyl-adenosine, 2-methylthio-N6-hydroxy-norvalinamido-carbonyl-adenosine, N6-acetyl-adenosine, 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, a-thio-adenosine, 2'-O-methyl-adenosine, N6,2'-O-dimethyl-adenosine, N6-methyl-2'-deoxyadenosine, N6,N6,2'-O-trimethyl-adenosine, 1,2'-O-dimethyl-adenosine, 2'-O-ribosyladenosine (phosphate) (Ar(p)), 2-amino-N6-methyl-purine, 1-thio-adenosine, 8-azido-adenosine, 2'-F-arabinosyl-adenosine, 2'-F-adenosine, 2'-OH-arabinosyl-adenosine, and N6-(19-amino-pentadeca-oxa)-adenosine.

[0180] In some embodiments, the chemical modifications described herein can include modifications to guanine. In some embodiments, the engineered guide RNAs described herein can comprise at least one chemically modified guanine. Exemplary chemically modified guanines can include inosine, 1 -methyl-inosine, wyosine, methylwyosine, 4-demethyl-wyosine, iso wyosine, wybutosine, peroxo wybutosine, hydroxywybutosine, undermodified hydroxywybutosine, 7-deaza-guanosine, queuosine, epiquenosine, galactosyl-queuosine, mannosyl-queuosine, 7-cyano-7-deaza-guanosine, 7-aminomethyl-7-deaza-guanosine, gualosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1 -methyl-guanosine, N2-methyl-guanosine, N2,N2-dimethyl-guanosine, N2,7-dimethyl-guanosine, N2,N2,7-dimethyl-guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1 -methylthio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, a-thio-guanosine, 2’-O-methyl-guanosine, N2-methyl-2’-O-methyl-guanosine, N2,N2-dimethyl-2’-O-methyl-guanosine, 1 -methyl-2’-O-methyl-guanosine, N2,7-dimethyl-2’-O-methyl-guanosine, 2’-O-methyl-inosine, 1,2’-O-dimethyl-inosine, 6-O-phenyl-2’-deoxyinosine, 2’-O-ribosylguanosine, 1 -thio-guanosine, 6-O-methylguanosine, O(6)-methyl-2’-deoxyguanosine, 2’-F-arabinoguanosine, and 2’-F-guanosine.

[0181] In some cases, chemical modifications of the engineered guide RNA can include the introduction or substitution of nucleic acid analogs or non-natural nucleic acids into the engineered guide RNA. In some embodiments, the nucleic acid analogs can be any of the chemically modified nucleic acids described herein. Exemplary nucleic acid analogs can be found in PCT / US2021 / 034272, PCT / US2015 / 025175, PCT / US2014 / 050423, PCT / US2016 / 067353, PCT / US2018 / 041503, PCT / US18 / 041509, PCT / US2004 / 011786, or PCT / US2004 / 011833, all of which are expressly incorporated by reference in their entirety. In some cases, the chemically modified nucleotides described herein can include variants of guanosine, uridine, adenosine, thymidine, and cytosine, including any naturally occurring or non-naturally occurring guanosine, uridine, adenosine, thymidine, or cytosine that has been chemically altered, e.g., by acetylation, methylation, hydroxylation.Exemplary chemically modified nucleotides can include 1 -methyladenosine, 1 -methyl- guanosine, 1 -methyl-inosine, 2,2-dimethyl-guanosine, 2,6-diaminopurine, 2'-amino-2'- deoxyadenosine, 2'-amino-2'-deoxycytidine, 2'-amino-2'-deoxyguanosine, 2'-amino-2'- deoxyuridine, 2-amino-6-chloropurine riboside, 2-amino-purine-riboside, 2'-arabinoadenosine, 2'-arabinocytidine, 2'-arabinouridine, 2'-azido-2'-deoxyadenosine, 2'-azido-2'- deoxycytidine, 2'-azido-2'-deoxyguanosine, 2'-azido-2'-deoxyuridine, 2-chloroadenosine, 2'- fluoro-2'-deoxyadenosine, 2'-fluoro-2'-deoxycytidine, 2'-fluoro-2'-deoxyguanosine, 2'- fluoro-2'-deoxyuridine, 2'-fluorothymidine, 2-methyl-adenosine, 2-methyl-guanosine, 2- methyl-thio-N6-isopentenyl-adenosine, 2'-O-methyl-2-aminoadenosine, 2'-O-methyl-2'- deoxyadenosine, 2'-O-methyl-2'-deoxycytidine, 2'-O-methyl-2'-deoxyguanosine, 2,-O- methyl-2'-deoxyuridine, 2'-O-methyl-5-methyluridine, 2'-O-methylinosine, 2'-O- methylpseudouridine, 2-thiocytidine, 2-thio-cytidine, 3-methyl-cytidine, 4-acetyl-cytidine, 4- thiouridine, 5-(carboxyhydroxylmethyl)-uridine, 5,6-dihydrouridine, 5-aminoallylcytidine, 5- aminoallyl-deoxyuridine, 5-bromouridine, 5-carboxymethylaminomethyl-2-thio- uracil, 5-carboxymethylaminomethyl-uracil, 5-chloro-arabinocytidine, 5-fluoro-uridine, 5- iodouridine, 5-methoxycarbonylmethyl-uridine, 5-methoxy-uridine, 5-methyl-2-thio- uridine, 6-azacytidine, 6-azauridine, 6-chloro-7-deaza-guanosine, 6-chloropurine riboside, 6- mercapto-guanosine, 6-methyl-mercapto-purine-riboside, 7-deaza-2'-deoxy-guanosine, 7- deazadenosine, 7-methyl-guanosine, 8-azadenosine, 8-bromo-adenosine, 8-bromo- guanosine, 8-mercapto-guanosine, 8-oxoguanosine, benzimidazole-riboside, beta-D- mannosyl-ribose, dihydro-uridine, inosine, N1-methyladenosine, N6-([6-aminohexyl] carbamoylmethyl)-adenosine, N6-isopentenyl-adenosine, N6-methyl-adenosine, N7- methyl- xanthosine, N-methylcarbamoyl-5-uracil, puromycin, ribosylpuromycin, uracil-5- oxyacetic acid, uracil-5-oxyacetic acid methyl ester, wybutoxosine, xanthosine, and xylo- adenosine.In some embodiments, a chemically modified nucleic acid as described herein comprises at least one chemically modified nucleotide selected from 2-amino-6-chloropurine riboside-5'- triphosphate, 2-amino purine-riboside-5'-triphosphate, 2-amino adenosine-5'-triphosphate, 2'-amino-2'- deoxycytidine-triphosphate, 2-thio cytidine-5'-triphosphate, 2-thio uridine-5'-triphosphate, 2'-fluoro thymidine-5'-triphosphate, 2'-O-methyl- inosine-5'-triphosphate, 4-thio uridine-5'-triphosphate, 5-aminoallyl cytidine-5'-triphosphate, 5-aminoallyl uridine-5'-triphosphate, 5-bromocytidine-5'-triphosphate, 5-bromouridine-5'-triphosphate, 5-bromo-2'-deoxycytidine-5'-triphosphate, 5-bromo-2'-deoxyuridine-5'-triphosphate, 5-iodocytidine-5'-triphosphate, 5-iodo-2'-deoxycytidine-5'-triphosphate, 5-iodouridine-5'-triphosphate, 5-iodo-2'-deoxyuridine-5'-triphosphate, 5-methylcytidine-5'-triphosphate, 5-methyluridine-5'-triphosphate, 5-propynyl-2'-deoxycytidine-5'-triphosphate, 5-propynyl-2'-deoxyuridine-5'-triphosphate, 6-azacytidine-5'-triphosphate, 6-azauridine-5'-triphosphate, 6-chloropurine riboside-5'-triphosphate, 7-deazoadenosine-5'-triphosphate, 7-deazaguanosine-5'-triphosphate, 8-azoadenosine-5'-triphosphate, 8-azidoadenosine-5'-triphosphate, benzimidazole-riboside-5'-triphosphate, N1-methyladenosine-5'-triphosphate, N1-methylguanosine-5'-triphosphate, N6-methyladenosine-5'-triphosphate, 6-methylguanosine-5'-triphosphate, pseudouridine-5'-triphosphate, puromycin-5'-triphosphate, or xanthosine-5'-triphosphate. In some embodiments, a chemically modified nucleic acid as described herein can comprise at least one chemically modified nucleotide selected from pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thio uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, and 4-methoxy-2-thio-pseudouridine.In some embodiments, an artificial nucleic acid as described herein comprises at least one chemically modified nucleotide selected from the group consisting of 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5- hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1- methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza- pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy- pseudoisocytidine, and 4-methoxy-1-methyl-pseudoisocytidine. In some embodiments, a chemically modified nucleic acid as described herein comprises at least one chemically modified nucleotide selected from the group consisting of 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis- hydroxyisopentenyl)adenosine, N6-glycinamidoformyladenosine, N6-threonylaminomethyl adenosine, 2-methylthio-N6-threonylaminomethyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine. In other embodiments, a chemically modified nucleic acid as described herein can comprise at least one chemically modified nucleotide selected from the group consisting of inosine, 1-methyl-inosine, wyosine, wybutosine, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methyl-inosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine.In certain embodiments, a chemically modified nucleic acid as described herein can comprise at least one chemically modified nucleotide selected from the group consisting of 6-aza-cytidine, 2-thio-cytidine, a-thio-cytidine, pseudisocytidine, 5-aminoallyl-uridine, 5-iodo-uridine, N1-methyl-pseudouridine, 5,6-dihydrouridine, a-thio-uridine, 4-thio-uridine, 6-aza-uridine, 5-hydroxy-uridine, deoxy-thymidine, 5-methyl-uridine, pyrrolo-cytidine, inosine, a-thio-guanosine, 6-methyl-guanosine, 5-methyl-cytidine, 8-oxo-guanosine, 7-deaza-guanosine, N1-methyl-adenosine, 2-amino-6-chloro-purine, N6-methyl-2-amino-purine, pseudisocytidine, 6-chloro-purine, N6-methyl-adenosine, a-thio-adenosine, 8-azido-adenosine, 7-deaza-adenosine.

[0182] In some embodiments, the modified base of the unnatural nucleic acid includes, but can not be limited to, uracil-5-yl, hypoxanthin-9-yl (I), 2-aminoadenine-9-yl, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5- substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8- azoadeine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Certain unnatural nucleic acids, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil, 5-halocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, other alkynyl derivatives of pyrimidine nucleotides, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8- substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl, other 5- substituted uracils and cytosines, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2- amino-adenine, 8-azaguanine, 8-azoadeine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, tricyclic pyrimidine, phenoxazine cytidine ([5,4-b][l,4]benzoxazin-2(3H)-one), phenothiazine cytidine (lH-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), G-clamp nucleotides, and the like, are included.4] benzothiazin-2(3H)-one), G-clamp, phenoxazine cytidine (e.g., 9-(2- aminoethoxy)-H-pyrimido[5,4-b][l,4]benzoxazin-2(3H)-one), carbazole cytidine (2H- pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3',2':4,5]pyrrolo[2,3- d]pyrimidin-2-one), those in which the purine or pyrimidine base can be replaced by other heterocycles, 7-deaza-adenine, 7-deaza-guanosine, 2-aminopyridine, 2- pyridone, azacytosine, 5-bromocytosine, bromouracil, 5-chlorocytosine, chlorinated cytosine, cyclocytidine, cytosine arabinoside, 5-fluorocytosine, fluoropyrimidine, fluorouracil, 5,6-dihydrocytosine, 5-iodocytosine, hydroxylurea, iodouracil, 5-nitrocytosine, 5-bromouracil, 5-chlorouracil, 5-fluorouracil, and 5-iodouracil, 2-amino-adenine, 6-thio-guanine, 2-thio-thymine, 4-thio-thymine, 5-propynyl-uracil, 4-thio-uracil, N4-ethylcytosine, 7-deaza-guanine, 7-deaza-8-aza-guanine, 5-hydroxycytosine, 2'-deoxyuridine, or 2-amino-2'-deoxyadenosine.

[0183] In some cases, the at least one chemical modification can include a chemical modification to the 5’ or 3’ end of the engineered guide RNA, such as a 5’ cap or 3’ tail. In some embodiments, the engineered guide RNA can comprise a chemical modification comprising a 3’ nucleotide that can be stabilized to prevent degradation, for example, by incorporation of one or more modified nucleotides described herein. In this embodiment, uridines can be replaced with modified uridines, for example, 5-(2-amino)propyl uridine and 5-bromo uridine, or any modified uridine described herein; adenosines and guanosines can be replaced with modified adenosines and guanosines, for example, modified at the 8 position, for example, 8-bromo guanosine, or any modified adenosine or guanosine described herein. In some embodiments, deazanucleotides, for example, 7-deazadenosine, can be incorporated into the gRNA. In some embodiments, O- and N-alkylated nucleotides, for example, N6-methyladenosine, can be incorporated into the gRNA. In some embodiments, sugar-modified ribonucleotides can be incorporated, for example, wherein the 2’OH-group can be replaced with a group selected from the group consisting of H, -OR, -R (where R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), halogen, -SH, -SR (where R can be, for example, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), amino (wherein the amino group can be, for example, NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or an amino acid); or cyano (-CN). In some embodiments, the phosphate backbone can be modified as described herein, for example, using a phosphorothioate group. In some embodiments, the nucleotides in the overhang region of the gRNA can each independently be a modified or unmodified nucleotide, including but not limited to 2’-sugar modified, such as 2-F 2’-O-methyl thymidine (T), 2’-O-methoxyethyl-5-methyluridine (Teo), 2’-O-methoxyethyl-adenosine (Aeo), 2’-O-methoxyethyl-5-methylcytidine (m5Ceo), or any combination thereof.

[0184] Therapeutic targets and methods

[0185] The present disclosure provides compositions of engineered guide RNAs or engineered polynucleotides encoding guide RNAs and methods of use thereof, such as therapeutic methods. In some embodiments, the engineered polynucleotides of the present disclosure encode guide RNAs that target coding sequences (e.g., TIS) of RNAs.

[0186] The present disclosure provides engineered guide RNAs that promote SNCA RNA editing when in contact with the SNCA RNA to knock down or reduce expression of alpha-synuclein. Knockdown of alpha-synuclein by the engineered guide RNAs of the present disclosure results in at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% reduction of alpha-synuclein relative to the amount prior to contacting the engineered guide RNA with the SNCA RNA. In some embodiments, the target SNCA RNA comprises a sequence having at least 80% identity to SEQ ID NO: 300.

[0187] Alpha-synucleinopathies are characterized by alpha-synuclein dysfunction, overexpression, and / or aggregation and are associated with neurodegenerative disease by genetic and neuropathological evidence. The gene encoding alpha-synuclein is referred to as SNCA. In Parkinson’s disease (PD), SNCA gene repeats and variants that promote alpha-synuclein aggregation (e.g., A53T) lead to early-onset and severe forms of the disease. Accordingly, the engineered guide RNAs of the present disclosure can target SNCA for RNA editing to drive a reduction in alpha-synuclein synthesis and promote clearance of aggregates. In some embodiments, the present disclosure provides compositions of engineered guide RNAs that target SNCA and promote ADAR-mediated RNA editing of SNCA to reduce pathogenic levels of alpha-synuclein by targeting critical adenosines present in the translation initiation site (TIS) for deamination. In some embodiments, the engineered guide RNAs of the present disclosure target coding sequences in SNCA. For example, the coding sequence can be the translation initiation site (TIS) (AUG) of SNCA and the engineered guide RNA can promote ADAR-mediated RNA editing of AUG to GUG. Accordingly, the engineered guide RNAs of the present disclosure that target these sites in SNCA are capable of promoting editing to reduce expression of alpha-synuclein. In some embodiments, the TIS targeted by the engineered guide RNAs of the present disclosure is in codon 1 of SNCA. In some embodiments, the engineered guide RNAs of the present disclosure target any critical adenosine in the SNCA native TIS. For example, in some embodiments, the engineered guide RNA targets the AUG at position 265 in exon 2 of SNCA to promote ADAR-mediated editing to GUG to reduce expression of alpha-synuclein. Assays to determine successful RNA editing can include NGS, Sanger sequencing, qPCR, ddPCR, Western blotting, and alpha-synuclein specific sandwich ELISA. In some embodiments, any of the engineered guide RNAs disclosed herein are packaged in an AAV vector and delivered virally. In some embodiments, administration of the compositions provided herein is sufficient to reduce expression of alpha-synuclein in a subject relative to the amount of alpha-synuclein prior to administration, as determined according to an in vitro assay or an in vivo assay. In some embodiments, the in vitro assay comprises an immunosorbent assay or a sequencing assay. In some embodiments, the in vivo assay comprises obtaining a biological sample from the subject and performing an in vitro assay, e.g., an enzyme-linked immunosorbent assay (ELISA).

[0188] As disclosed herein, editing of a target sequence of a target SNCA RNA (e.g., SEQ ID NO: 300) by ADAR with an engineered guide RNA can be used to reduce expression of alpha-synuclein protein. The reduction of alpha-synuclein protein can be used to treat a disease or disorder associated with alpha-synuclein protein. In some embodiments, the disease or disorder is a synucleinopathy. Editing of a target SNCA RNA described herein, along with a reduction in alpha-synuclein protein levels, can be used to reduce or prevent aggregation of alpha-synuclein protein. Thus, one or more symptoms associated with alpha-synuclein protein aggregation (e.g., a synucleinopathy) can be treated by administering an engineered guide RNA described herein.

[0189] As disclosed herein, administering an engineered guide RNA described herein that targets a SNCA RNA to a subject can be used to treat a disease or disorder associated with alpha-synuclein protein, including treating one or more symptoms associated with the disease or disorder. In some embodiments, the disease or disorder is associated with alpha-synuclein protein aggregation in the brain of the subject. In some embodiments, the disease or disorder is at least one selected from the group consisting of a neurodegenerative disease, Parkinson’s disease, tremor, muscle rigidity, muscle rigidity, bradykinesia, Lewy body dementia (DLB), multiple system atrophy (MSA), pure autonomic failure (PAF), and REM sleep behavior disorder (RBD). In some embodiments, the disease or disorder can be Parkinson’s disease. In some embodiments, one or more symptoms of Parkinson’s disease can be treated by administering an engineered guide RNA that targets a SNCA RNA as described herein. For example, administering an engineered guide RNA can be sufficient to reduce resting tremor, muscle rigidity, difficulty standing, difficulty walking, difficulty with physical movement, involuntary movements, muscle rigidity, coordination problems, rhythmic muscle contractions, slow physical movement, bradykinesia, slow moving gait, or any combination thereof. In some embodiments, treatment of Parkinson’s disease includes improvement in cognitive function. For example, a subject administered an engineered guide RNA targeting SNCA of the present disclosure can show an increase in cognitive ability or motor skill testing relative to performance prior to administration. In some embodiments, the subject can show improvement in a Unified Parkinson’s Disease Rating Scale (UPDRS) test, such as an MDS-UPDRS test. In some embodiments, the subject can be evaluated by imaging techniques, such as MRI or CAT scans, to monitor progression of the disease or disorder. For example, MRI imaging can be used to visualize neurons of the subject during treatment to monitor progress of the treatment. In some embodiments, the degeneration of neuronal cells in the substantia nigra can be monitored throughout the treatment.

[0190] As disclosed herein, administration of the engineered guide RNAs of the present disclosure can be used to reduce alpha-synuclein levels by knockdown to treat a disease or disorder associated with alpha-synuclein. Although a reduction is obtained by administration, residual alpha-synuclein can still be present after administration. In some cases, the presence of reduced alpha-synuclein levels treats the disease or disorder without reducing the alpha-synuclein levels to zero. This level can be determined in an in vitro assay using a sample obtained from the subject. In some cases, the level can be determined in vivo using, for example, imaging techniques such as MRI described above. The treatment can result in an improvement in certain biomarkers of the subject. For example, the treatment can result in a reduction of SNCA in CSF, a reduction of SNCA in blood, a reduction of neurofilament A levels in CSF, or any combination thereof.

[0191] In some embodiments, the engineered guide RNAs of the present disclosure promote ADAR-mediated RNA editing of 1% to 100% of target adenosines. The engineered guide RNAs of the present disclosure can promote editing of 40% to 90% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 5% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 10% of target adenosines. 15% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 20% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 25% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 30% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 35% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 40% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 45% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 50% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 55% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 60% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 65% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 70% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 75% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 80% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 85% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 90% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of at least 95% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of 100% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of 5% to 20% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of 20% to 40% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of 40% to 60% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of 60% to 80% of target adenosines. In some embodiments, the engineered guide RNAs of the present disclosure can promote editing of 80% to 100% of target adenosines.In some embodiments, the engineered guide RNA of the present disclosure can facilitate 60% to 80% of target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate 70% to 90% of target adenosine editing.

[0192] In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 70% or more target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate at least 80% or more target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate up to 90% or more target adenosine editing. Optionally, in addition, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 30% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 25% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 20% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 15% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 10% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 9% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 8% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 7% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 6% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 5% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 4% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 3% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 2% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 1% off-target adenosine editing. In some embodiments, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining 0% off-target adenosine editing.In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 30% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 29% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 28% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 27% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 26% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 25% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 24% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 23% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 22% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 21% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 20% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 19% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 18% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 17% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 16% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 15% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 14% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 13% off-target adenosine editing.In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 12% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 11% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 10% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 9% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 8% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 7% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 6% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 5% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 4% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 3% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 2% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining less than 1% off-target adenosine editing. In some embodiments, the engineered guide RNA of the present disclosure can facilitate at least 70% target adenosine editing while maintaining 0% off-target adenosine editing.

[0193] In some embodiments, the engineered guide RNA of the present disclosure facilitates ADAR-mediated RNA editing of SNCA, which results in knockdown at the protein level. Knockdown at the protein level is quantified as a reduction in alpha-synuclein expression. The engineered guide RNA of the present disclosure can facilitate 1% to 100% knockdown of alpha-synuclein. The engineered guide RNA of the present disclosure can facilitate 1% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, 90% to 100%, 20% to 40%, 30% to 50%, 40% to 60%, 50% to 70%, 60% to 80%, 20% to 50%, 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% knockdown of alpha-synuclein. In some embodiments, the engineered guide RNA of the present disclosure facilitates 30% to 60% knockdown of alpha-synuclein. Knockdown of alpha-synuclein can be measured by an assay that compares a sample or subject treated with the engineered guide RNA to a control sample or subject that was not treated with the engineered guide RNA.

[0194] The engineered guide RNA of the present disclosure can be used in a method of treating a condition in a subject in need thereof. The condition can be any state associated with a disease, disorder, genotype, phenotype, or side effect. In some embodiments, treating a condition can include preventing the condition, slowing the development of the condition, reversing, or alleviating symptoms of the condition. The method of treating a condition can include delivering an engineered polynucleotide encoding the engineered guide RNA to a cell of a subject in need thereof, and expressing the engineered guide RNA in the cell. In some embodiments, the engineered guide RNA of the present disclosure can be used to treat a genetic condition (e.g., a synucleinopathy such as Parkinson’s disease). In some embodiments, the engineered guide RNA of the present disclosure can be used to treat a disorder associated with one or more mutations.

[0195] Pharmaceutical compositions

[0196] The compositions described herein (e.g., compositions comprising an engineered guide RNA or an engineered polynucleotide) can be formulated with a pharmaceutically acceptable carrier for administration to a subject (e.g., a human or a non-human animal). Pharmaceutically acceptable carriers can include, but are not limited to, phosphate buffered saline, water, emulsions (such as an oil / water emulsion or a water / oil emulsion), glycols, liquid polyethylene glycols, aprotic solvents (such as dimethylsulfoxide, N-methylpyrrolidinone, or mixtures thereof), and various types of wetting agents, solubilizing agents, antioxidants, fillers, protein carriers such as albumin, any and all solvents, dispersion media, coatings, sodium lauryl sulfate, isotonic and absorption delaying agents, disintegration agents (e.g., potato starch or sodium starch glycolate), and the like. The compositions can also contain stabilizers and preservatives. Other examples of carriers, stabilizers, and adjuvants consistent with the compositions of the present disclosure can be found in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, Mack Publ. Co., Easton, Pa. (2005), which is incorporated by reference herein in its entirety.

[0197] In some examples, the pharmaceutical composition can be formulated in unit dose or multiple dose form. In some examples, the unit dose form can be a physically discrete unit suitable for administration to a human or non-human subject (e.g., an animal). In some examples, the unit dose form can be packaged individually. In some examples, each unit dose contains a predetermined quantity of active ingredient sufficient to produce the desired therapeutic effect in association with a pharmaceutical carrier, diluent, excipient, or any combination thereof. In some examples, the unit dose form comprises an ampoule, syringe, or individually packaged tablet and capsule, or any combination thereof. In some cases, the unit dose form can be contained in a disposable syringe. In some cases, the unit dose form can be administered in fractions or multiples thereof. In some examples, the multiple dose form comprises multiple identical unit dose forms packaged in a single container, which can be administered in separate unit dose forms. In some examples, the multiple dose form comprises a vial, a bottle of tablets or capsules, or a pint or gallon container. In some cases, the multiple dose form comprises the same pharmaceutically active agent. In some cases, the multiple dose form comprises different pharmaceutically active agents.

[0198] In some examples, the pharmaceutical composition comprises a pharmaceutically acceptable excipient. In some examples, the excipient comprises a buffer, a cryopreservation agent, a preservative, a stabilizer, a binding agent, a compaction agent, a lubricant, a chelating agent, a dispersion enhancer, a disintegrant, a flavoring agent, a sweetener, or a coloring agent, or any combination thereof.

[0199] In some examples, the excipient includes a buffering agent. In some examples, the buffering agent includes sodium citrate, magnesium carbonate, magnesium bicarbonate, calcium carbonate, calcium bicarbonate, or any combination thereof. In some examples, the buffering agent includes sodium bicarbonate, potassium bicarbonate, magnesium hydroxide, magnesium lactate, magnesium gluconate, aluminum hydroxide, sodium citrate, sodium tartrate, sodium acetate, sodium carbonate, sodium polyphosphate, potassium polyphosphate, sodium pyrophosphate, potassium pyrophosphate, disodium hydrogen phosphate, dipotassium hydrogen phosphate, trisodium phosphate, tripotassium phosphate, potassium metaphosphate, magnesium oxide, magnesium hydroxide, magnesium carbonate, magnesium silicate, calcium acetate, calcium glycerophosphate, calcium chloride, or calcium hydroxide and other calcium salts, or any combination thereof.

[0200] In some examples, the excipient includes a cryopreservation agent. In some examples, the cryopreservation agent includes DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the cryopreservation agent includes sucrose, trehalose, starch, a salt of any of these, a derivative of any of these, or any combination thereof. In some examples, the excipient includes a pH agent (to minimize oxidation or degradation of the composition components), a stabilizer (to prevent modification or degradation of the composition components), a buffering agent (to enhance temperature stability), a solubilizer (to increase protein solubility), or any combination thereof. In some examples, the excipient includes a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, the excipient includes sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HC1, disodium edetate, lecithin, glycerol, xanthan gum rubber, soy isoflavones, polysorbate 80, ethanol, water, teprenone, or any combination thereof. In some examples, the excipient can be an excipient described in the Handbook of Pharmaceutical Excipients, American Pharmaceutical Association (1986).

[0201] In some examples, the excipient includes a preservative. In some examples, the preservative includes an antioxidant, such as alpha-tocopherol and ascorbate; an antimicrobial, such as parabens, chlorobutanol, and phenol; or any combination thereof. In some examples, the antioxidant includes EDTA, citric acid, ascorbic acid, butylated hydroxytoluene (BHT), butylated hydroxyanisole (BHA), sodium sulfite, p-aminobenzoic acid, glutathione, propyl gallate, cysteine, methionine, ethanol, or N-acetyl cysteine, or any combination thereof. In some examples, the preservative includes validamycin A, TL-3, sodium orthovanadate, sodium fluoride, N-a-tosyl-Phe- chloromethyl ketone, N-a-tosyl-Lys-chloromethyl ketone, aprotinin, phenylmethylsulfonyl fluoride, diisopropylfluorophosphate, a kinase inhibitor, a phosphatase inhibitor, a caspase inhibitor, a granzyme inhibitor, a cell adhesion inhibitor, a cell division inhibitor, a cell cycle inhibitor, a lipid signaling inhibitor, a protease inhibitor, a reducing agent, an alkylating agent, an antimicrobial, an oxidase inhibitor, or other inhibitor, or any combination thereof.

[0202] In some examples, the excipient includes a binder. In some examples, the binder includes starch, pregelatinized starch, gelatin, polyvinylpyrrolidone, cellulose, methylcellulose, sodium carboxymethylcellulose, ethylcellulose, polyacrylamide, polyvinyloxoazolidone, polyvinyl alcohol, C12-C18 fatty alcohol, polyethylene glycol, a polyol, a saccharide, an oligosaccharide, or any combination thereof.

[0203] In some examples, the binder can be starch, such as potato starch, corn starch, or wheat starch; a sugar, such as sucrose, glucose, dextrose, lactose, or maltodextrin; a natural and / or synthetic gum; gelatin; a cellulose derivative, such as microcrystalline cellulose, hydroxypropyl cellulose, hydroxyethyl cellulose, hydroxypropyl methyl cellulose, carboxymethyl cellulose, methyl cellulose, or ethyl cellulose; polyvinylpyrrolidone (povidone); polyethylene glycol (PEG); a wax; calcium carbonate; calcium phosphate; an alcohol, such as sorbitol, xylitol, mannitol, or water, or any combination thereof.

[0204] In some examples, the excipient includes a lubricant. In some examples, the lubricant includes magnesium stearate, calcium stearate, zinc stearate, hydrogenated vegetable oil, hydrogenated vegetable oil hydrogenated cottonseed oil, polyoxyethylene monostearate, talc, polyethylene glycol, sodium benzoate, sodium lauryl sulfate, magnesium lauryl sulfate, or light mineral oil, or any combination thereof. In some examples, the lubricant includes metal stearates (such as magnesium stearate, calcium stearate, aluminum stearate), fatty acid esters (such as sodium stearyl fumarate), fatty acids (such as stearic acid), fatty alcohols, glyceryl behenate, mineral oil, paraffin, hydrogenated vegetable oil, leucine, polyethylene glycol (PEG), metal lauryl sulfates (such as sodium lauryl sulfate, magnesium lauryl sulfate), sodium chloride, sodium benzoate, sodium acetate, or talc, or combinations thereof.

[0205] In some examples, the excipient includes a dispersion enhancer. In some examples, the dispersion enhancer includes starch, alginic acid, polyvinylpyrrolidone, guar gum, kaolin, bentonite, purified wood cellulose, sodium starch glycolate, isomorphous silicates, or microcrystalline cellulose, or any combination thereof as a high HLB emulsifier surfactant.

[0206] In some examples, the excipient includes a disintegrant. In some examples, the disintegrant includes a non-effervescent disintegrant. In some examples, the non-effervescent disintegrant includes starch, such as corn starch, potato starch, pregelatinized and modified starches thereof; a sweetener; a clay, such as bentonite, microcrystalline cellulose, alginates, sodium starch glycolate; or a gum, such as agar, guar gum, locust bean gum, gum karaya, pectin, and tragacanth gum; or any combination thereof. In some examples, the disintegrant includes an effervescent disintegrant. In some examples, suitable effervescent disintegrants include combinations of bicarbonates with citric acid, and combinations of sodium bicarbonate with tartaric acid.

[0207] In some examples, the excipient includes a sweetener, a flavoring agent, or both. In some examples, the sweetener includes dextrose (corn syrup), dextrose, invert sugar, fructose, and mixtures thereof (when not used as a carrier); saccharin and its various salts, such as the sodium salt; dipeptide sweeteners, such as aspartame; dihydrochalcone compounds, glycyrrhizin; Stevia Rebaudiana (Stevioside); chloro derivatives of sucrose, such as sucralose; and sugar alcohols, such as sorbitol, mannitol, sugar alcohols, and the like, or any combination thereof. In some cases, the flavoring agent incorporated into the composition includes synthetic flavor oils and flavoring aromatics; natural oils; extracts from plants, leaves, flowers, and fruits; or any combination thereof. In some examples, the flavoring agent includes cinnamon oil; oil of wintergreen; oil of peppermint; clover oil; hay oil; anise oil; eucalyptus; vanilla; citrus oils, such as lemon, orange, grape, and grapefruit; and fruit essences, including apple, peach, pear, strawberry, raspberry, cherry, plum, pineapple, and apricot, or any combination thereof.

[0208] In some examples, the excipient includes a pH agent (e.g., to minimize oxidation or degradation of the composition components), a stabilizer (e.g., to prevent modification or degradation of the composition components), a buffer (e.g., to enhance temperature stability), a solubilizer (e.g., to increase protein solubility), or any combination thereof. In some examples, the excipient includes a surfactant, a sugar, an amino acid, an antioxidant, a salt, a non-ionic surfactant, a solubilizer, a triglyceride, an alcohol, or any combination thereof. In some examples, the excipient includes sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, sucrose, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, trehalose, arginine, sodium acetate, acetate, HC1, disodium edetate, lecithin, glycerol, xanthan gum rubber, soy isoflavones, polysorbate 80, ethanol, water, teprenone, or any combination thereof. In some examples, the excipient includes a cryopreservation agent. In some examples, the excipient includes DMSO, glycerol, polyvinylpyrrolidone (PVP), or any combination thereof. In some examples, the excipient includes sucrose, trehalose, starch, a salt of any of these, a derivative of any of these, or any combination thereof.

[0209] In some examples, the pharmaceutical composition includes a diluent. In some examples, the diluent includes water, glycerol, methanol, ethanol, or other similar biocompatible diluents, or any combination thereof. In some examples, the diluent includes aqueous acids, such as acetic acid, citric acid, maleic acid, hydrochloric acid, phosphoric acid, nitric acid, sulfuric acid, or any combination thereof. In some examples, the diluent includes alkali metal carbonates, such as calcium carbonate; alkali metal phosphates, such as calcium phosphate; alkali metal sulfates, such as calcium sulfate; cellulose derivatives, such as cellulose, microcrystalline cellulose, cellulose acetate; magnesium oxide, dextrin, fructose, dextrose, glyceryl palmitate, lactitol, choline, lactose, maltose, mannitol, dimethicone, sorbitol, starch, pregelatinized starch, talc, xylitol, and / or dehydrates, hydrates, and / or pharmaceutically acceptable derivatives thereof, or combinations thereof.

[0210] In some examples, the pharmaceutical composition includes a carrier. In some examples, the carrier includes a liquid or solid filler, a solvent, or an encapsulating material. In some examples, the carrier includes additive proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides; derivatized sugars, such as sugar alcohols, aldonic acids, esterified sugars, and the like; and polysaccharides or sugar polymers), used alone or in combination.

[0211] Delivery

[0212] An engineered guide RNA of the disclosure (such as an engineered guide RNA comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784) or an engineered polynucleotide of the disclosure (e.g., an engineered polynucleotide of the disclosure encoding an engineered guide RNA, such as an engineered polynucleotide comprising a polynucleotide sequence of any one of SEQ ID NOs: 286-292, 325-332, 358-379, 441-776, or 785-792) can be delivered by a delivery vehicle. In some embodiments, the delivery vehicle is a vector. The vector can facilitate delivery of the engineered guide RNA into a cell for genetic modification of the cell. In some examples, the vector comprises DNA, such as double-stranded or single-stranded DNA. In some examples, the delivery vector can be a eukaryotic vector, a prokaryotic vector (e.g., a bacterial vector or a plasmid), a viral vector, or any combination thereof. In some embodiments, the vector is an expression cassette. In some embodiments, the viral vector comprises a viral capsid, inverted terminal repeat sequences, and the engineered polynucleotide can be used to deliver the engineered guide RNA to a cell.

[0213] In some embodiments, the viral vector can be a retroviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, an alphaviral vector, a lentiviral vector (e.g., human or porcine), a herpes viral vector, an Epstein-Barr virus vector, an SV40 viral vector, a poxviral vector, or a combination thereof. In some embodiments, the viral vector can be a recombinant vector, a hybrid vector, a chimeric vector, a self-complementary vector, a single-stranded vector, or any combination thereof.

[0214] In some embodiments, the viral vector can be an adeno-associated virus (AAV). In some embodiments, the AAV can be any AAV known in the art. In some embodiments, the viral vector can be a specific serotype. In some embodiments, the viral vector can be an AAV1 serotype, an AAV2 serotype, an AAV3 serotype, an AAV4 serotype, an AAV5 serotype, an AAV6 serotype, an AAV7 serotype, an AAV8 serotype, an AAV9 serotype, an AAV10 serotype, an AAV11 serotype, an AAV 12 serotype, an AAV13 serotype, an AAV14 serotype, an AAV15 serotype, an AAV16 serotype, an AAV.rh8 serotype, an AAV.rh10 serotype, an AAV.rh20 serotype, an AAV.rh39 serotype, an AAV.Rh74 serotype, an AAV.RHM4-1 serotype, an AAV.hu37 serotype, an AAV.Anc80 serotype, an AAV.Anc80L65 serotype, an AAV.7m8 serotype, an AAV.PHP.B serotype, an AAV2.5 serotype, an AAV2tYF serotype, an AAV3B serotype, an AAV.LK03 serotype, an AAV.HSC1 serotype, an AAV.HSC2 serotype, an AAV.HSC3 serotype, an AAV.HSC4 serotype, an AAV.HSC5 serotype, an AAV.HSC6 serotype, an AAV.HSC7 serotype, an AAV.HSC8 serotype, an AAV.HSC9 serotype, an AAV.HSC10 serotype, an AAV.HSC11 serotype, an AAV.HSC12 serotype, an AAV.HSC13 serotype, an AAV.HSC14 serotype, an AAV.HSC15 serotype, an AAV.HSC16 serotype, and an AAVhu68 serotype, a derivative of any of these serotypes, or any combination thereof.

[0215] In some embodiments, the AAV vector can be a recombinant vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, a single-stranded AAV, or any combination thereof.

[0216] In some embodiments, the AAV vector can be a recombinant AAV (rAAV) vector. Methods of producing recombinant AAV vectors can be known in the art, and in some cases generally involve introducing into a producer cell line: (1) DNA necessary for AAV replication and AAV capsid synthesis, (b) one or more helper constructs comprising viral functions missing in the AAV vector, (c) a helper virus, and (d) a plasmid construct containing the AAV vector genome, e.g., ITRs, promoters, and engineered guide RNA sequences, etc. In some examples, the viral vectors described herein can be engineered by synthesis or other suitable means, with reference to published sequences, such as those available in the literature. For example, the genome and protein sequences of various serotypes of AAV, as well as sequences for natural terminal repeat sequences (TRs), Rep proteins, and capsid subunits are known in the art and can be found in the literature or in public databases, such as GenBank or PDB.

[0217] In some examples, the method of producing the delivery vectors herein comprises packaging the engineered polynucleotide of the disclosure (e.g., an engineered polynucleotide encoding an engineered guide RNA) in an AAV vector. In some examples, the method of producing the delivery vectors described herein comprises (a) introducing into a cell: (i) a polynucleotide comprising a promoter and an engineered guide RNA disclosed herein; and (ii) a viral genome comprising a replication (Rep) gene and a capsid (Cap) gene encoding a wild-type AAV capsid protein or a modified form thereof; (b) expressing the wild-type AAV capsid protein or the modified form thereof in the cell; (c) assembling an AAV particle; and (d) packaging the engineered guide RNA disclosed herein in the AAV particle, thereby producing an AAV delivery vector. In some examples, the recombinant vector comprises one or more inverted terminal repeat sequences, and the inverted terminal repeat sequences comprise a 5’ inverted terminal repeat sequence, a 3’ inverted terminal repeat sequence, and a mutated inverted terminal repeat sequence. In some examples, the mutated terminal repeat sequence lacks a terminal resolution site, thereby enabling formation of a self-complementary AAV.

[0218] In some examples, a hybrid AAV vector can be produced by transcapsidation, e.g., packaging inverted terminal repeat sequences (ITRs) from a first serotype into a capsid of a second serotype, where the first and second serotypes can not be identical. In some examples, a Rep gene and ITRs from a first AAV serotype (e.g., AAV2) can be used in a capsid from a second AAV serotype (e.g., AAV5 or AAV9), where the first and second AAV serotypes can not be identical. As a non-limiting example, a hybrid AAV serotype comprising AAV2 ITRs and AAV9 capsid proteins can be denoted AAV2 / 9. In some examples, a hybrid AAV delivery vector comprises an AAV2 / 1, AAV2 / 2, AAV 2 / 4, AAV2 / 5, AAV2 / 6, AAV2 / 8, or AAV2 / 9 vector.

[0219] In some examples, an AAV vector can be a chimeric AAV vector. In some examples, a chimeric AAV vector comprises exogenous amino acids or amino acid substitutions, or capsid proteins from two or more serotypes. In some examples, a chimeric AAV vector can be genetically engineered to increase transduction efficiency, selectivity, or a combination thereof.

[0220] In some examples, an AAV vector comprises a self-complementary AAV genome. Self-complementary AAV genomes can be generally known in the art and contain two strands of DNA that can anneal together to form a double-stranded DNA.

[0221] In some examples, a delivery vector can be a retroviral vector. In some examples, a retroviral vector can be a Moloney Murine Leukemia Virus vector, a spleen necrosis virus vector, or a vector derived from Rous Sarcoma Virus, Harvey Sarcoma Virus, Avian Leukosis Virus, Human Immunodeficiency Virus, Myeloproliferative Sarcoma Virus, or Mammary Tumor Virus, or a combination thereof. In some examples, a retroviral vector can be transfected such that a substantial portion of the sequence encoding the structural genes of the virus (e.g., gag, pol, and env) can be deleted and replaced by a gene of interest.

[0222] In some examples, the delivery vehicle can be a non-viral vector. In some examples, the delivery vehicle can be a plasmid. In some embodiments, the plasmid comprises DNA. In some examples, the plasmid comprises circular double stranded DNA. In some examples, the plasmid can be linear. In some examples, the plasmid comprises one or more genes of interest and one or more regulatory elements. In some examples, the plasmid comprises a bacterial backbone containing an origin of replication and an antibiotic resistance gene or other selectable marker for plasmid amplification in bacteria. In some examples, the plasmid can be a minicircle plasmid. In some examples, the plasmid comprises one or more genes that provide a selectable marker to induce target cell retention of the plasmid. In some examples, the plasmid can be formulated for delivery by injection with a syringe carrying a needle. In some examples, the plasmid can be formulated for delivery by electroporation. In some examples, the plasmid can be engineered by synthesis or other suitable methods known in the art. For example, in some examples, genetic elements can be assembled by restriction digestion of desired genetic sequences from donor plasmids or organisms to create DNA ends, which can then be readily ligated to another genetic sequence.

[0223] In some embodiments, the vector containing the engineered guide RNA or engineered polynucleotide is a non-viral vector system. In some embodiments, the non-viral vector system comprises a cationic lipid or a polymer. For example, the non-viral vector system can be a liposome or a polymeric nanoparticle. In some embodiments, the engineered polynucleotide or the non-viral vector comprising the engineered polynucleotide is delivered to the cell by hydrodynamic injection or ultrasound.

[0224] Administration

[0225] Administration can refer to methods that can be used to deliver a composition described herein (e.g., comprising an engineered guide RNA or an engineered polynucleotide encoding the same) to a desired site of biological action. For example, an engineered guide RNA, such as an engineered guide RNA comprising a polynucleotide sequence of any one of SEQ ID NOs: 2-285, 293-299, 333-357, 375-376, 380-381, 390-440, or 777-784, can be comprised in a DNA construct, a viral vector, or both, and administered by intravenous administration. Administration to an area in need of treatment or therapy disclosed herein can be achieved, for example, but not by way of limitation, by oral administration, topical administration, intravenous administration, inhalation administration, or any combination thereof. In some embodiments, delivery can include inhalation, auricular, buccal, conjunctival, dental, intra-cervical, intranasal, intratracheal, intestinal, epidural, extra-amniotic, extracorporeal, hemodialysis, infiltration, interstitial, intra-abdominal, intra-amniotic, intra-arterial, intra-articular, intra-biliary, intrabronchial, intracapsular, intracardiac, intracartilaginous, intracaudal, intracavernous, intracavitary, intracerebroventricular, intracistermal, intracorneal, intracoronary, intracoronary, intracavernous, intradermal, intradiscal, intraductal, intradural, intradermal, intragastric, intragastric, intravaginal, intrahippocampal, intrailleal, intralesional, intraluminal, intralymphatic, intramedullary, intramembranous, intramuscular, intraocular, intraovarian, intrapericardial, intraperitoneal, intrapleural, intraprostatic, intrapulmonary, intrasinus, intraspinal, intrasynovial, intratendinous, intratesticular, intrathoracic, intracanalicular, intratumoral, intratympanic, intrauterine, intravascular, intravenous, intravenous bolus, intravenous drip, intravesical, intravitreal, iontophoresis, irrigation, laryngeal, nasal, nasogastric, ocular, oral, oropharyngeal, parenteral, transdermal, peri-articular, epidural, peri-neural, periosteal, rectal, retrobulbar, subarachnoid, subconjunctival, subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transplacental, transtracheal, transtympanic, ureteral, urethral, vaginal, infraorbital, intracerebral, intrathecal, intraventricular, stereotactic, or any combination thereof. Delivery can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular, or infusion), oral administration, inhalation administration, duodenal administration, rectal administration, or a combination thereof. Delivery can include direct application to affected tissues or areas of the body. In some cases, topical administration can include applying a lotion, solution, emulsion, cream, balm, oil, paste, stick, aerosol, foam, jelly, foam, mask, pad, powder, solid, tincture, butter, patch, gel, spray, drop, liquid preparation, ointment to the external surface of a surface, such as the skin. Delivery can include a parenchymal injection, an intrathecal injection, an intracerebroventricular injection, or an intracisternal injection. The compositions provided herein can be administered by any method.The method of administration can be by intra-arterial injection, intracisternal injection, intramuscular injection, intraparenchymal injection, intraperitoneal injection, intraspinal injection, intrathecal injection, intravenous injection, intraventricular injection, stereotactic injection, subcutaneous injection, epidural injection, or any combination thereof. Delivery can include parenteral administration (including intravenous, subcutaneous, intrathecal, intraperitoneal, intramuscular, intravascular, or infusion administration). In some embodiments, delivery can include nanoparticles, liposomes, exosomes, extracellular vesicles, implants, or combinations thereof. In some cases, delivery can be by a device. In some cases, delivery can be administered by a pump, infusion pump, or combinations thereof. In some embodiments, delivery can be by enema, eye drop, nasal spray, or any combination thereof. In some cases, the subject can administer the composition without supervision. In some cases, the subject can administer the composition under the supervision of a medical professional (e.g., a doctor, a nurse, a physician’s assistant, a caregiver, a hospice worker, etc.). In some embodiments, the medical professional can administer the composition.

[0226] In some examples, the pharmaceutical compositions disclosed herein can be administered at a dosage level sufficient to deliver about 0.0001 mg / kg to about 100 mg / kg, about 0.001 mg / kg to about 0.05 mg / kg, about 0.005 mg / kg to about 0.05 mg / kg, about 0.001 mg / kg to about 0.005 mg / kg, about 0.05 mg / kg to about 0.5 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 40 mg / kg, about 0.5 mg / kg to about 30 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 10 mg / kg, or about 1 mg / kg to about 25 mg / kg of the subject’s body weight once or multiple times per day to achieve the desired therapeutic, diagnostic, or prophylactic effect.

[0227] The appropriate dosage and treatment regimen for the treatment methods described herein vary according to the particular disease being treated, the gRNA and / or ADAR (or vector encoding the gRNA and / or ADAR) being delivered, and the specific condition of the subject. In some examples, administration can continue for a period of time until a desired effect is achieved (e.g., a reduction in symptoms can be achieved). In some examples, administration can be 1, 2, 3, 4, 5, 6, or 7 times per week. In some examples, administration or application of the compositions disclosed herein can be for a treatment duration of at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years, or more. In some examples, administration can be for a period of 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, or 10 weeks. In some examples, administration can be for a period of 2 months, 3 months, 4 months, 5 months, 6 months, or more. In some examples, administration can be repeated throughout the life of the subject, such as once a month or once a year throughout the life of the subject. In some examples, administration can be repeated throughout most of the life of the subject, such as once a month or once a year, for at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years, or more. In some examples, treatment can be resumed after a period of remission.

[0228] In some cases, administration can be oral ingestion. In some cases, administration can be a capsule or a tablet. Oral ingestion delivery can include tea, elixir, food, drink, beverage, syrup, liquid, gel, capsule, tablet, oil, tincture, or any combination thereof. In some embodiments, the food can be a medical food. In some cases, the capsule can comprise hydroxymethylcellulose. In some embodiments, the capsule can comprise gelatin, hydroxypropyl methylcellulose, pullulan, or any combination thereof. In some cases, the capsule can comprise a coating, such as an enteric coating. In some embodiments, the capsule can comprise a vegan or vegetarian product, such as a hypromellose capsule. In some embodiments, delivery can include inhalation by an inhaler, diffuser, atomizer, vaporizer, or a combination thereof.

[0229] In some embodiments, the compositions disclosed herein can be a method comprising administering a composition disclosed herein to a subject (e.g., a human) in need thereof. In some cases, the method can treat (including prevent) a disease in the subject.

[0230] Definitions

[0231] Unless otherwise defined, all technical terms, symbols, and other scientific or technical terms or terminology used in this document shall have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs. In some instances, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to mean that the terms are in any way

[0232] Throughout this application, various embodiments are presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as limiting the scope of the disclosure to a range. Therefore, the description of a range should be considered to have specifically disclosed all possible subranges as well as individual numerical values within that range. For example, a description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

[0233] As used herein, the term "about" in connection with a number can mean plus or minus 10% of the number.

[0234] As disclosed herein, a base pairing (bp) region refers to a region in a guide-target RNA scaffold where bases in the guide RNA (e.g., bases in the targeting sequence of the guide RNA) pair with relative bases in the target polynucleotide. The base pairing region can extend from one end or the proximal end of one end of the guide-target RNA scaffold to the proximal end of the other end of the guide-target RNA scaffold. The base pairing region can extend between two structural features. The base pairing region can extend from one end or the proximal end of one end of the guide-target RNA scaffold to the proximal end of the structural feature. The base pairing region can extend from the structural feature to the other end of the guide-target RNA scaffold. In some embodiments, the base pairing region has 1 to 50, 1 to 75, 1 to 100, 1 to 125, 1 to 150, 1 to 175, 1 to 200, 1 to 225, 1 to 250, 1 to 275, 1 to 300, 50 to 75, 50 to 100, 50 to 125, 50 to 150, 50 to 175, 50 to 200, 50 to 225, 5, 50 to 250, 50 to 275, 50 to 300, 60 to 75, 60 to 100, 60 to 125, 60 to 150, 60 to 175, 60 to 200, 60 to 225, 60 to 250, 60 to 275, 60 to 300, 70 to 100, 70 to 125, 70 to 150, 70 to 175, 70 to 200 , 70 to 225, 70 to 250, 70 to 275, 70 to 300, 80 to 100, 80 to 125, 80 to 150, 80 to 175, 80 to 200, 80 to 225, 80 to 250, 80 to 275, 80 to 300, 90 to 125, 90 to 150, 90 to 175, 90 to 200, 90 to 22 5, 90 to 250, 90 to 275, 90 to 300, 100 to 125, 100 to 150, 100 to 175, 100 to 200, 100 to 225, 100 to 250, 100 to 275, 100 to 300, 150 to 200, 150 to 225, 150 to 250, 150 to 275, or 150 to 300 base pairs. In some embodiments, the base pairing region has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 10564, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282,283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 base pairs.

[0235] As disclosed herein, a "bulge" refers to a structure that forms substantially only upon formation of a guide-target RNA scaffold, in which consecutive nucleotides in the engineered guide RNA or target RNA are not complementary to their positional counterparts on the opposite strand. A bulge can independently have from 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold, and from 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or a bulge can independently have from 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold, and from 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold. However, a bulge as used herein does not refer to a structure in which a single participating nucleotide of the engineered guide RNA and a single participating nucleotide of the target RNA are not base-paired, which is referred to herein as a "mismatch." Furthermore, when the number of participating nucleotides on the guide RNA side or the target RNA side exceeds 4, the resulting structure is no longer considered a bulge, but is considered an "internal loop." A "symmetric bulge" refers to a bulge in which the same number of nucleotides are present on each side of the bulge. An "asymmetric bulge" refers to a bulge in which a different number of nucleotides are present on each side of the bulge.

[0236] The terms“complementary” or“complementarity” refer to the capacity of a nucleic acid to form one or more bonds with a corresponding nucleic acid sequence by, for example, hydrogen bonding (e.g., traditional Watson-Crick), covalent bonding, or other similar processes. In Watson-Crick base pairing, a double hydrogen bond forms between the nucleobases T and A, while a triple hydrogen bond forms between the nucleobases C and G. For example, the sequence A-G-T can be complementary to the sequence T-C-A. The percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 is 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). “Perfectly complementary” can refer to all contiguous residues of a nucleic acid sequence will form hydrogen bonds with the same number of contiguous residues in a second nucleic acid sequence. “Substantially complementary” as used herein can refer to a degree of complementarity of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 10, 15, 20, 25, 30, 35, 40, 45, 50, or more nucleotides, or can refer to two nucleic acids that hybridize under stringent conditions (i.e., stringent hybridization conditions). A nucleic acid can include non-specific sequences. As used herein, the term“non-specific sequence” or“non-specific” can refer to a nucleic acid sequence that contains a series of residues that can not be designed to be complementary to any other nucleic acid sequence or can be only partially complementary.

[0237] The terms“determine,”“measure,”“evaluate,”“assess,”“determine,” and“analyze” can be used interchangeably herein to refer to a form of measurement. These terms include determining whether an element is present (e.g., detecting). These terms can include quantitative, qualitative, or both quantitative and qualitative determinations. Assessing can be relative or absolute. Detecting the presence of something can include determining the amount of something present in addition to determining whether something is present or not present depending on the context.

[0238] The term“encode” as used herein refers to the ability of a polynucleotide to provide a sequence of information or instructions sufficient to produce a corresponding gene expression product. In one non-limiting example, an mRNA can encode a polypeptide during translation, while a DNA can encode an mRNA molecule during transcription.

[0239] As used herein, the term“engineered guide RNA” can be used interchangeably with“guide RNA” and refers to a designed polynucleotide that is at least partially complementary to a target RNA. The engineered guide RNAs of the present disclosure can be used to facilitate modification of a target RNA. The modification of the target RNA includes altering RNA splicing, reducing or enhancing protein translation, target RNA knockdown, target RNA degradation, and / or ADAR-mediated target RNA editing. In some cases, the guide RNA facilitates ADAR-mediated RNA editing with the goal of knocking down a target mRNA, reducing or inhibiting downstream protein translation, enhancing downstream protein translation, correcting a mutation (including correcting any G-to-A mutation, e.g., missense or nonsense mutation), introducing a mutation (e.g., introducing an A-to-I (read as G by cellular machinery) substitution), or altering the function of any adenosine containing regulatory motif (e.g., polyadenylation signal, miRNA binding site, etc.). In some cases, a guide RNA can affect functional outcomes (e.g., target RNA modulation, downstream protein translation) through a combination of mechanisms, e.g., ADAR-mediated RNA editing and binding and / or degradation of the target RNA. In some cases, a guide RNA can facilitate the introduction of a mutation at a site targeted by an enzyme to alter the affinity of such enzyme to target and cleave such site. The guide RNAs of the present disclosure can comprise one or more structural features. Upon hybridization of the engineered potential guide RNA to the target RNA, the structural feature can form from the potential structure in the potential (unbound) guide RNA. A“potential structure” refers to a structural feature that forms or substantially forms only upon hybridization of the guide RNA to the target RNA. For example, upon hybridization of the guide RNA to the target RNA, a potential structural featu...

Claims

1. A composition comprising an engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA has complementarity with a target sequence of a target SNCA RNA and comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs: 2-285, SEQ ID NOs: 293-299, SEQ ID NOs: 333-357, SEQ ID NOs: 375-376, SEQ ID NOs: 380-381, SEQ ID NOs: 390-440, or SEQ ID NOs: 777-784, wherein the engineered guide RNA is complementary to the target sequence of the target SNCA RNA. wherein upon hybridization of the engineered guide RNA to the target sequence of the target SNCARNA, a guide-target RNA scaffold is formed having one or more structural features that were not present within the engineered guide RNA prior to the hybridization, and the one or more structural features are selected from the group consisting of: a protrusion, an internal loop, and a hairpin; wherein upon hybridization of the engineered guide RNA to the target sequence of the target SNCARNA, a guide-target RNA scaffold is formed having one or more structural features that were not present within the engineered guide RNA prior to the hybridization, and the one or more structural features are selected from the group consisting of: a protrusion, an internal loop, and a hairpin; and wherein formation of the guide-target RNA scaffold causes knockdown of alpha-synuclein encoded by the target SNCARNA.

2. The composition of claim 1, wherein the engineered guide RNA comprises a polynucleotide sequence having at least about 80%, 85%, 90%, 92%, 95%, 97%, or 99% sequence identity to any one of SEQ ID NOs: 293-299 or SEQ ID NOs: 333-340.

3. The composition of claim 2, wherein the engineered guide RNA comprises the polynucleotide sequence of any one of SEQ ID NOs: 293-299 or SEQ ID NOs: 333-340.

4. The composition of claim 1, wherein the target sequence of the target SNCARNA comprises a translation start site.

5. The composition of claim 4, wherein the translation start site is the SNCA codon 1 translation start site of exon 2.

6. The composition of claim 5, wherein the translation start site is the SNCA codon 1 translation start site of exon 2 corresponding to position 226 of SNCA transcript variant 1 of accession number NM_000345.

4.

7. The composition of claim 1, wherein the one or more structural features comprise at least a first 6 / 6 symmetric internal ring and at least a second 6 / 6 symmetric ring.

8. The composition of claim 7, wherein the first 6 / 6 symmetric internal loop is at a position selected from the group consisting of: 33, 32, 30, 28, and 26 relative to the target adenosine at position 0.

9. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 33 relative to the target adenosine at position 0.

10. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof.

11. The composition of claim 10, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

337.

12. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof.

13. The composition of claim 12, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO: 338 or SEQ ID NO:

339.

14. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a U / G wobble base at position -23 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a G / U wobble base at position 2 relative to position 0, a U / G wobble base at position 5 relative to position 0, a 2 / 2 symmetric bulge at position 33 relative to position 0, a G / G mismatch at position 36 relative to position 0, a G / G mismatch at position 38 relative to position 0, and any combination thereof.

15. The composition of claim 14, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

340.

16. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

17. The composition of claim 16, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO: 298 or SEQ ID NO:

299.

18. The composition of claim 9, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetrical internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetrical bulge at position 5 relative to position 0, and any combination thereof.

19. The composition of claim 18, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

299.

20. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 32 relative to the target adenosine at position 0.

21. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: the second 6 / 6 symmetrical internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetrical bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

22. The composition of claim 21, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

333.

23. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

24. The composition of claim 23, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

334.

25. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

26. The composition of claim 25, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

335.

27. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a G / U wobble base at position -40 relative to position 0, a U / G wobble base at position -36 relative to position 0, a G / U wobble base at position -33 relative to position 0, a G / U wobble base at position -30 relative to position 0, a U / G wobble base at position -25 relative to position 0, a G / U wobble base at position -21 relative to position 0, a U / G wobble base at position -18 relative to position 0, a G / U wobble base at position -13 relative to position 0, the second 6 / 6 symmetric internal loop at position -6 relative to position 0, a G / U wobble base at position -3 relative to position 0, an A / C mismatch at position 0, a 3 / 3 symmetric bulge at position 13 relative to position 0, a 0 / 1 asymmetric bulge at position 31 relative to position 0, a 5 / 4 asymmetric internal loop at position 33 relative to position 0, a C / A mismatch at position 55 relative to position 0, and any combination thereof.

28. The composition of claim 27, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

336.

29. The composition of claim 20, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: the second 6 / 6 symmetric internal loop at position -6 relative to position 0, an A / C mismatch at position 0, and any combination thereof.

30. The composition of claim 29, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

295.

31. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 30 relative to the target adenosine at position 0.

32. The composition of claim 31 , wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetrical internal loop at position -18 relative to position 0, a 3 / 3 symmetrical protrusion at position -6 relative to position 0, an A / C mismatch at position 0, a G / G mismatch at position 6 relative to position 0, a U / C mismatch at position 10 relative to position 0, and any combination thereof.

33. The composition of claim 32, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

297.

34. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 28 relative to the target adenosine at position 0.

35. The composition of claim 34, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetric internal loop at position -8 relative to position 0, an A / C mismatch at position 0, a G / U wobble base pair at position 2 relative to position 0, and any combination thereof.

36. The composition of claim 35, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

293.

37. The composition of claim 34, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of: a second 6 / 6 symmetrical internal loop at position -10 relative to position 0, a 0 / 1 asymmetric protrusion at position -6 relative to position 0, an A / C mismatch at position 0, an A / A mismatch at position 4 relative to position 0, and any combination thereof.

38. The composition of claim 37, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

294.

39. The composition of claim 8, wherein the first 6 / 6 symmetric internal loop is at position 26 relative to the target adenosine at position 0.

40. The composition of claim 39, wherein the one or more structural features further comprise at least one structural feature selected from the group consisting of a second 6 / 6 symmetrical internal loop at position -6 relative to position 0, an A / C mismatch at position 0, a 2 / 2 symmetrical bulge at position 5 relative to position 0, and any combination thereof.

41. The composition of claim 40, wherein the engineered guide RNA has at least about 80%, 85%, 90%, 92%, 95%, 97% or 99% sequence identity to SEQ ID NO:

296.

42. The composition of claim 1, wherein the one or more structural features include the protrusion, and wherein the protrusion is a symmetrical protrusion.

43. The composition of claim 1, wherein the one or more structural features include the protrusion, and wherein the protrusion is an asymmetric protrusion.

44. The composition of claim 1, wherein the one or more structural features include the interior ring, and wherein the interior ring is a symmetrical interior ring.

45. The composition of claim 1, wherein the one or more structural features include the internal ring, and wherein the internal ring is an asymmetric internal ring.

46. ​​The composition of claim 1, wherein the guide-target RNA scaffold comprises a wobble base pair.

47. The composition of claim 1, wherein the one or more structural features comprise the hairpin, and wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin.

48. The composition of any one of claims 1 to 47, wherein upon hybridization of the engineered guide RNA to the target sequence of the target SNCARNA, the engineered guide RNA promotes RNA editing of one or more adenosines in the target sequence of the target SNCARNA by an RNA editing entity.

49. The composition of claim 48, wherein the RNA editing entity comprises ADAR1, ADAR2, ADAR3, or any combination thereof.

50. The composition of any one of claims 1 to 49, wherein the composition comprises the engineered polynucleotide encoding the engineered guide RNA.

51. The composition of claim 50, wherein the engineered polynucleotide is contained in or on a vector.

52. The composition of claim 51, wherein the vector is a viral vector, and wherein the engineered polynucleotide is encapsulated in the viral vector.

53. The composition of claim 51, wherein the viral vector is an adeno-associated virus (AAV) vector, or a derivative thereof.

54. The composition of claim 53, wherein the viral vector is an adeno-associated virus (AAV), and wherein the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant of any of these.

55. The composition of any one of claims 53 to 54, wherein the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof.

56. The composition of claim 1, wherein the target sequence of the target SNCARNA has a polynucleotide sequence that is at least 80% identical to SEQ ID NO:

300.

57. The composition of any one of claims 42 to 56, wherein the engineered guide RNA comprises the sequence of any one of SEQ ID NOs: 2-285, SEQ ID NOs: 293-299, SEQ ID NOs: 333-357, SEQ ID NOs: 375-376, SEQ ID NOs: 380-381, SEQ ID NOs: 390-440, or SEQ ID NOs: 777-784.

58. A composition comprising an engineered guide RNA or a polynucleotide encoding the engineered guide RNA, wherein the engineered guide RNA has a length of 85 to 100 nucleotides and hybridizes to at least 80 bases of a target RNA sequence, and the target RNA sequence has at least 80%, at least 85%, at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to GCCAUUCGACGACAGUGUGGUGUAAAGGAAUU CAUUAGCCAUGGAUGUAUUCAUGAAAGGACUUUCAAAGGCC AAGGAGGGAGUUGUGGCUGCUGCUGAG (SEQ ID NO: 300).

59. The composition of claim 58, wherein upon hybridization of the engineered guide RNA to the at least 80 bases of the target RNA sequence, the engineered guide RNA promotes RNA editing of one or more adenosines in the at least 80 bases of the target RNA sequence by an RNA editing entity.

60. The composition of claim 59, wherein the engineered guide RNA, upon hybridization to the at least 80 bases of the target RNA sequence, forms a guide-target RNA scaffold comprising one or more structural features.

61. The composition of claim 60, wherein the one or more structural features comprise protrusions, wherein the protrusions are symmetrical protrusions.

62. The composition of claim 60, wherein the one or more structural features comprise protrusions, wherein the protrusions are asymmetric protrusions.

63. The composition of claim 60, wherein the one or more structural features comprise an internal ring, wherein the internal ring is a symmetrical internal ring.

64. The composition of claim 60, wherein the one or more structural features comprise an internal ring, wherein the internal ring is an asymmetric internal ring.

65. The composition of claim 60, wherein the one or more structural features comprise a wobble base pair.

66. The composition of claim 60, wherein the one or more structural features comprise a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin.

67. The composition of any one of claims 59 to 66, wherein the RNA editing entity comprises ADAR1, ADAR2, ADAR3, or any combination thereof.

68. The composition of claim 58, wherein the composition comprises an engineered polynucleotide encoding the engineered guide RNA.

69. The composition of claim 68, wherein the engineered polynucleotide encoding the engineered guide RNA is contained in or on a vector.

70. The composition of claim 68, wherein the vector is a viral vector, and wherein the engineered polynucleotide encoding the engineered guide RNA is encapsulated in the viral vector.

71. The composition of claim 70, wherein the viral vector is an adeno-associated virus (AAV) vector or a derivative thereof.

72. The composition of claim 71, wherein the AAV vector is an AAV1 vector, an AAV2 vector, an AAV3 vector, an AAV4 vector, an AAV5 vector, an AAV6 vector, an AAV7 vector, an AAV8 vector, an AAV9 vector, an AAV10 vector, an AAV11 vector, or a derivative, chimera, or variant thereof.

73. The composition of claim 71 or claim 72, wherein the AAV vector is a recombinant AAV (rAAV) vector, a hybrid AAV vector, a chimeric AAV vector, a self-complementary AAV (scAAV) vector, or any combination thereof.

74. A pharmaceutical composition comprising: a) a composition according to any one of claims 1 to 73; and b) Pharmaceutically acceptable: excipient, carrier or diluent.

75. A method of treating a disease or condition in a subject in need thereof, the method comprising: Administering to the subject a therapeutically effective amount of the composition of any one of claims 1 to 73, or the pharmaceutical composition of claim 74.

76. The method of claim 75, wherein the disease or condition comprises a synucleinopathy.

77. The method of claim 75, wherein the synucleinopathy comprises Parkinson's disease.

78. The method of any one of claims 75 to 77, wherein the subject is a human or non-human animal.

79. The method of any one of claims 75 to 78, wherein the pharmaceutical composition or the composition is in unit dosage form.

80. The method of any one of claims 75 to 79, wherein the administering is sufficient to treat one or more symptoms of the disease or disorder.

81. The method of claim 80, wherein the disease or disorder is a synucleinopathy.

82. The method of claim 80, wherein the one or more symptoms treated include muscle rigidity, bradykinesia, resting tremor, or any combination thereof.

83. The method of claims 75-82, wherein the administering is sufficient to reduce aggregation of alpha-synuclein relative to: (a) the aggregation level before said administration; (b) the cumulative aggregation level in the subject in the absence of said administration; or (c) Both.

84. A method of treating Parkinson's disease in a subject in need thereof, the method comprising: The subject is administered the composition of any one of claims 1 to 73 or the pharmaceutical composition of claim 74 in an amount sufficient to treat Parkinson's disease in the subject.

85. The method of claim 84, wherein the administering is sufficient to treat one or more symptoms of Parkinson's disease in the subject relative to a time prior to the administering.

86. The method of claim 84, wherein the one or more symptoms treated include rigidity, bradykinesia, resting tremor, or any combination thereof.

87. The method of any one of claims 84 to 86, wherein the subject exhibits an increased Unified Parkinson's Disease Rating Scale (UPDRS) score after the administration relative to the UPDRS score before the administration.

88. A method of reducing the expression of alpha-synuclein in a subject in need thereof, the method comprising administering to the subject a composition as described in any one of claims 1 to 73; wherein the administration is sufficient to reduce the expression of alpha-synuclein in the subject relative to the amount of alpha-synuclein before the administration as determined by an in vitro assay, thereby reducing the expression of the alpha-synuclein in the subject.

89. The method of claim 88, wherein the engineered guide RNA has sufficient complementarity to a target sequence of a target SNCARNA to allow the engineered guide RNA to hybridize to the target sequence of the target SNCARNA, wherein the target sequence comprises a translation start site in the target SNCARNA.

90. The method of claim 89, wherein the translation start site is the SNCA codon 1 translation start site of exon 2.

91. The method of claim 89, wherein the target SNCA RNA comprises a pre-mRNA transcript of SNCA.

92. The method of claim 91, wherein hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA causes an RNA editing entity present in the subject to edit one or more adenosines in the target sequence.

93. The method of claim 92, wherein at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% of the pre-mRNA transcripts of SNCA have editing of the one or more adenosines in the target sequence.

94. The method of claim 92, wherein the editing of the one or more adenosines in the target sequence of the target SNCARNA contributes to reduced expression of alpha-synuclein in the subject.

95. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 10% reduction relative to the amount of alpha-synuclein present prior to the administration.

96. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 20% reduction relative to the amount of alpha-synuclein present prior to the administration.

97. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 25% reduction relative to the amount of alpha-synuclein present prior to the administration.

98. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 30% reduction relative to the amount of alpha-synuclein present prior to the administration.

99. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 35% reduction relative to the amount of alpha-synuclein present prior to the administration.

100. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 30% reduction relative to the amount of alpha-synuclein present prior to the administration.

101. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 40% reduction relative to the amount of alpha-synuclein present prior to the administration.

102. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 45% reduction relative to the amount of alpha-synuclein present prior to the administration.

103. The method of claim 94, wherein the reduced expression of alpha-synuclein is at least a 50% reduction relative to the amount of alpha-synuclein present prior to the administration.

104. The method of claim 94, wherein the reduced expression of alpha-synuclein is about a 10% to up to a 20% reduction relative to the amount of alpha-synuclein present prior to the administration.

105. The method of claim 94, wherein the reduced expression of alpha-synuclein is about a 20% to up to about a 30% reduction relative to the amount of alpha-synuclein present prior to the administration.

106. The method of claim 94, wherein the reduced expression of alpha-synuclein is about a 30% to up to about a 40% reduction relative to the amount of alpha-synuclein present prior to the administration.

107. The method of claim 94, wherein the reduced expression of alpha-synuclein is about a 40% to up to about a 50% reduction relative to the amount of alpha-synuclein present prior to the administration.

108. The method of claim 94, wherein the reduced expression of alpha-synuclein is about a 50% to up to about a 60% reduction relative to the amount of alpha-synuclein present prior to the administration.

109. The method of claim 94, wherein the reduced expression of alpha-synuclein is about a 60% to up to about a 70% reduction relative to the amount of alpha-synuclein present prior to the administration.

110. The method of any one of claims 89 to 99, wherein the target sequence of the target SNCARNA comprises a sequence that is at least 80% identical to SEQ ID NO:

300.

111. The method of claim 91, wherein hybridization of the engineered guide RNA to the target sequence of the target SNCA RNA causes exon skipping in the pre-mRNA transcript of SNCA.

112. The method of claim 111, wherein the exon skipping produces an alternatively spliced ​​SNCA mRNA variant that does not include exon 2 of the wild-type SNCA mRNA transcript.

113. The method of claim 111 or claim 112, wherein the exon skipping causes a decrease in alpha-synuclein.

114. The method of claim 88, wherein the reduced expression of the alpha-synuclein protein in the subject comprises as determined according to an in vitro assay, relative to: (i) the level of α-synuclein in a biological sample obtained from the subject prior to the administration; or (ii) a reference α-synuclein level obtained from a subject with Parkinson's disease, the decrease in the α-synuclein level in the biological sample from said subject.

115. The method of claim 88, wherein the method further comprises determining, as determined by an in vitro assay, relative to: (i) the level of α-synuclein RNA transcript comprising exon 2 in a biological sample obtained from the subject prior to the administration; or (ii) a reference level of an α-synuclein RNA transcript comprising exon 2 obtained from a subject with Parkinson's disease, and reducing the level of an α-synuclein RNA transcript comprising exon 2 in the subject.

116. The method of any one of claims 88 to 115, wherein the method treats a disease or disorder in the subject.

117. The method of claim 116, wherein the disease or the disorder is at least one selected from the group consisting of a neurodegenerative disease, Parkinson's disease, tremor, muscle stiffness, muscle rigidity, bradykinesia, dementia with Lewy bodies (DLB), multiple system atrophy (MSA), pure autonomic failure (PAF), and REM sleep behavior disorder (RBD).

Images