Anti-fibrosis saRNA-EEF1A1 vaccine as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an anti-fibrosis saRNA-EEF1A1 vaccine as well as a preparation method and application thereof. In order to provide more vaccines for preventing and treating fibrosis diseases, the invention provides an anti-fibrosis saRNA-EEF1A1 based on a target spot EEF1A1, and the saRNA-EEF1A1 is prepared into a vaccine. Experiments prove that the self-replicating saRNA-EEF1A1 and the vaccine thereof prepared by the invention can be used for preventing and treating mouse pulmonary fibrosis caused by bleomycin, which is specifically embodied in that pathological changes of mouse lungs are improved, collagen deposition of the lungs is reduced, and various indexes of pulmonary fibrosis are reduced. The saRNA-EEF1A1 vaccine provided by the invention provides a new strategy for fibrosis treatment and drug research and development, and is expected to become a candidate vaccine for fibrosis treatment in the future.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an anti-fibrosis saRNA-EEF1A1 vaccine and a preparation method and application thereof. Background Art

[0002] Fibrotic interstitial lung disease (f-ILD) is a group of chronic lung diseases characterized by interstitial inflammation and fibrosis, ultimately leading to structural destruction of lung tissue and respiratory failure. Its core pathological changes include alveolar wall thickening, fibroblast proliferation, and excessive deposition of extracellular matrix (ECM), resulting in irreversible pulmonary fibrosis. Among these, idiopathic pulmonary fibrosis (IPF) is the most common f-ILD and carries the worst prognosis. In fibrosis, inflammation shapes the interactions and phenotypes of cells within the fibrotic niche. However, the extent to which these cellular crosstalk is organ-, disease-, or species-specific remains unclear. Therefore, there is an urgent need to develop anti-fibrotic therapies that effectively target pro-fibrotic cells while sparing healthy tissue.

[0003] Studies have found that scar-associated macrophages (SAMs) accumulate in liver and lung fibrosis. SAMs, likely originating from monocytes, localize to scars, and induce myofibroblast activation in response to niche and inflammatory signals that influence their differentiation and function, exhibiting high pathological specificity. Targeting the key macrophage populations found in these fibrotic tissues may lead to the development of new therapeutic strategies for fibrosis. Eukaryotic translation elongation factor 1α1 (EEF1A1) is a highly conserved, multifunctional protein composed of approximately 450 amino acids and possessing multiple functional domains. In recent years, EEF1A1 has been shown to be a key regulatory node in the progression of fibrosis.

[0004] In the field of vaccine technology, self-amplifying RNA (saRNA) technology, as an iterative platform for mRNA vaccines, enables RNA to self-replicate in cells, achieving continuous expression of antigens for more than 28 days. Compared with traditional mRNA vaccines, saRNA has the advantages of lower dosage, stronger immunogenicity and longer duration.

[0005] Although existing technologies have reported the application of saRNA vaccines in infectious disease vaccines, there has been no EEF1A1 targeting solution for fibrotic diseases. Summary of the Invention

[0006] In order to provide more vaccines for the prevention and treatment of fibrotic diseases, the present invention provides an anti-fibrotic saRNA-EEF1A1 vaccine based on the pulmonary fibrosis target EEF1A1, and its preparation method and application.

[0007] To achieve the above application objectives, the technical solutions adopted in this application are as follows: In a first aspect, the present invention provides a saRNA transcribed from an alphavirus backbone vector, wherein the alphavirus backbone vector comprises a gene sequence of an immunogen, wherein the immunogen is EEF1A1, and the gene sequence of the immunogen is as shown in SEQ ID NO.1 or a gene sequence having at least 90% homology with SEQ ID NO.1 and the same or similar biological activity.

[0008] Furthermore, the alphavirus backbone vector includes a promoter, a 5'UTR, an alphavirus non-structural protein, a gene sequence of an immunogen, a 3'UTR and a PolyA tail.

[0009] Furthermore, the nucleotide sequence of the promoter is shown in SEQ ID NO.3.

[0010] Furthermore, the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.4.

[0011] Furthermore, the nucleotide sequence of the alphavirus non-structural protein is shown in SEQ ID NO.5.

[0012] Furthermore, the nucleotide sequence of the 3'UTR is shown in SEQ ID NO.6.

[0013] Furthermore, the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.7.

[0014] Furthermore, the nucleotide sequence of the alphavirus backbone vector is shown in SEQ ID NO.8.

[0015] In a second aspect, the present invention provides a saRNA vaccine for preventing and / or treating fibrosis, comprising the above-mentioned saRNA and a vector for delivering the saRNA.

[0016] Furthermore, the delivery vehicle is selected from at least one of lipid nanoparticles (LNP), polymer nanoparticles or liposome complexes.

[0017] Preferably, the LNP components include: cationic lipid SM-102, auxiliary lipid DSPC, cholesterol and PEG lipid DMG-PEG 2000 .

[0018] Preferably, the polymer nanoparticles are selected from at least one of the following: polyethyleneimine (PEI), polyamidoamine (PAMAM), polylysine (PLL), and polypropyleneimine (PPI).

[0019] Preferably, the liposome complex is selected from at least one of the following: (2,3-dioleyloxypropyl)trimethylammonium chloride (DOTAP), N-[1-(2,3-dioleoyl chloride)propyl]-N,N,N-trimethylammonium chloride (DOTMA), cationic cholesterol (DC-Chol), and dimethyl-2,3-dioleyloxypropyl-2-(2-sperminecarboxamido)ethylammonium trifluoroacetate (DOSPA).

[0020] In a third aspect, the present invention provides a combination drug comprising the above-mentioned saRNA or saRNA vaccine, administered separately or simultaneously, and other drugs for preventing and / or treating fibrotic diseases.

[0021] In a fourth aspect, the present invention provides the use of the above-mentioned saRNA, saRNA vaccine or combination drug in the preparation of a drug for treating and / or preventing fibrotic diseases.

[0022] Furthermore, the drug is a pharmaceutical preparation that is administered by injection, oral administration, nasal mucosa, lungs, rectum, oral mucosa or skin.

[0023] Preferably, the drug is an injectable preparation, and the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection.

[0024] Furthermore, the fibrotic disease is selected from at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, renal fibrosis, cardiac fibrosis, endometrial fibrosis, eye fibrosis, splenic fibroproliferative disease, myelofibrosis or skin fibrosis.

[0025] Preferably, the pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis or other pulmonary fibrosis.

[0026] Preferably, the pulmonary fibrosis is caused by drugs, and the drugs are at least one of bleomycin, amiodarone or methotrexate.

[0027] In a fifth aspect, the present invention provides a method for preparing the above-mentioned saRNA, comprising the following steps: (1) Enzymatically digest the plasmid containing the DNA sequence shown in SEQ ID NO. 8 to obtain a linearized template, which was then purified; (2) The purified linearized template is transcribed in vitro and purified to obtain purified RNA; (3) Capping and purifying the purified RNA obtained in step (2) to obtain saRNA.

[0028] Beneficial Effects: This invention utilizes EEF1A1, a novel fibrosis target, to prepare an anti-fibrosis saRNA vaccine. Animal experiments demonstrate that the saRNA-EEF1A1 vaccine, based on EEF1A1, can prevent and treat bleomycin-induced pulmonary fibrosis in mice. Specifically, this vaccine improves pathological changes in the lungs, reduces collagen deposition in the lungs, and decreases various indicators of pulmonary fibrosis. This saRNA-EEF1A1 vaccine provides new insights into the treatment and drug development of pulmonary fibrosis and is expected to become a candidate vaccine for future fibrosis treatments. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Figures show the results of treating pulmonary fibrosis in mice with the saRNA-EEF1A1 vaccine prepared in Experimental Example 1 of the present invention; a) Lung coefficients of mice in the blank group, model group, saRNA-Luciferase (irrelevant sequence group), and saRNA-EEF1A1 (treatment group) 28 days after bleomycin modeling; b) Hydroxyproline content in lung tissue of mice in the saRNA-EEF1A1-treated pulmonary fibrosis model; c) qPCR analysis of Col1a and Col3a mRNA expression levels in lung tissue of mice in the saRNA-EEF1A1-treated pulmonary fibrosis model; d) Masson staining of lung tissue pathological sections of mice in the saRNA-EEF1A1-treated pulmonary fibrosis model; e) Immunohistochemical staining of Col1a in lung tissue pathological sections of mice in the saRNA-EEF1A1-treated pulmonary fibrosis model. Data are expressed as mean ± SEM. DETAILED DESCRIPTION

[0030] In order to make the technical problems, technical solutions and beneficial effects to be solved by this application more clear, the application is further described in detail below in conjunction with the embodiments. Unless otherwise defined, all scientific and technical terms used herein have the same meanings as understood by ordinary technicians in this field.

[0031] The term "self-amplifying RNA" (saRNA) refers to a class of engineered RNA molecules capable of autonomously replicating within host cells, significantly increasing the level and duration of target protein expression. Its core characteristic is that it incorporates the RNA replication machinery of viruses (such as alphaviruses) while retaining the ability to express therapeutic genes (such as vaccine antigens or therapeutic proteins). Compared to traditional mRNA, it offers the following advantages: 1. Low dose and high efficiency: 1 μg saRNA is equivalent to 10-100 μg traditional mRNA.

[0032] 2. Long-term expression: Protein expression can last for several weeks, suitable for the treatment of chronic diseases.

[0033] 3. Process compatibility: The preparation process is similar to that of traditional mRNA, which is in vitro transcription + delivery vector encapsulation.

[0034] EEF1A1 (Eukaryotic Translation Elongation Factor 1 Alpha 1) is a key factor in eukaryotic cells responsible for protein translation elongation. It belongs to the GTP-binding protein family. Its core function is to deliver aminoacyl-tRNA (aa-tRNA) to the ribosome A site, ensuring accurate translation of mRNA. EEF1A1 is a core molecule that maintains cellular protein synthesis, possessing both classical translational functions and non-classical regulatory roles. Its abnormal expression or mutation is closely associated with tumors, neurological diseases, and viral infections, making it a potential candidate for therapeutic target development.

[0035] The term "scar-associated macrophages (SAMs)" refers to a subpopulation of macrophages that are enriched in areas of tissue fibrosis or scarring. They participate in the progression of chronic fibrotic diseases by regulating inflammatory responses, extracellular matrix (ECM) deposition, and remodeling. Their core characteristic is a pro-fibrotic phenotype, which differs significantly from the function of macrophages in normal tissue repair or acute inflammation.

[0036] The applicant's previous research revealed that EEF1A1 (Uniprot: P10126) is highly expressed in the lung tissue of patients with pulmonary fibrosis and mice, co-localizing with SAM cells and regulating myofibroblast activation to promote fibrosis progression. This suggests that EEF1A1 may be a promising new antigen for the development of fibrosis vaccines. Therefore, in one embodiment of the present invention, EEF1A1 is a novel target for pulmonary fibrosis, and an anti-fibrotic saRNA vaccine using EEF1A1 as an immunogen is designed.

[0037] In some specific embodiments of the present invention, a saRNA is provided, which is transcribed from an alphavirus backbone vector, wherein the alphavirus backbone vector includes a promoter, a 5'UTR, an alphavirus non-structural protein, a gene sequence of an immunogen, a 3'UTR and a PolyA tail; the immunogen is EEF1A1, and the gene sequence of the immunogen is as shown in SEQ ID NO.1 or a gene sequence having at least 90% homology with SEQ ID NO.1 and the same or similar biological activity.

[0038] In some specific embodiments of the present invention, the nucleotide sequence of the promoter is shown as SEQ ID NO.3.

[0039] In some specific embodiments of the present invention, the nucleotide sequence of the 5'UTR is shown as SEQ ID NO.4.

[0040] In some specific embodiments of the present invention, the nucleotide sequence of the alphavirus non-structural protein is shown as SEQ ID NO.5.

[0041] In some specific embodiments of the present invention, the nucleotide sequence of the 3'UTR is shown as SEQ ID NO.6.

[0042] In some specific embodiments of the present invention, the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.7.

[0043] In some specific embodiments of the present invention, the nucleotide sequence of the alphavirus backbone vector is shown as SEQ ID NO.8.

[0044] In another embodiment of the present invention, a saRNA vaccine for the prevention and / or treatment of fibrosis is provided, which contains the above-mentioned saRNA and a vector for delivering saRNA.

[0045] In order to ensure that the synthesized saRNA can efficiently enter cells and express antigens, in some embodiments of the present invention, the delivery vehicle is selected from at least one of LNP, polymer nanoparticles or liposome complexes.

[0046] In some preferred embodiments of the present invention, the LNP components include: cationic lipid SM-102, auxiliary lipid DSPC, cholesterol and PEG lipid DMG-PEG 2000 .

[0047] In some preferred embodiments of the present invention, the polymer nanoparticles are selected from at least one of the following: PEI, PAMAM, PLL, and PPI.

[0048] In some preferred embodiments of the present invention, the liposome complex is selected from at least one of the following: DOTAP, DOTMA, DC-Chol, and DOSPA.

[0049] In order to better treat and prevent fibrotic diseases, in some embodiments of the present invention, the above-mentioned saRNA or saRNA vaccine is administered separately or simultaneously with other drugs for preventing and / or treating fibrotic diseases to achieve better effects.

[0050] In order to verify the therapeutic and / or preventive effect of the saRNA or saRNA vaccine prepared by the present invention on fibrotic diseases, in some embodiments of the present invention, the saRNA or saRNA vaccine is prepared into a pharmaceutical preparation for administration by injection, oral administration, nasal mucosa, lung, rectum, oral mucosa or skin.

[0051] In some preferred embodiments of the present invention, the drug is an injectable preparation, and the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection.

[0052] The present invention constructs a fibrotic disease model to verify the therapeutic and / or preventive effect of the prepared saRNA or saRNA vaccine on fibrotic diseases. The fibrotic disease is selected from at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, renal fibrosis, cardiac fibrosis, endometrial fibrosis, ocular fibrosis, splenic fibrosis, myelofibrosis, or skin fibrosis.

[0053] In some preferred embodiments of the present invention, the pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis or other pulmonary fibrosis.

[0054] In some preferred embodiments of the present invention, the pulmonary fibrosis is caused by a drug, and the drug is at least one of bleomycin, amiodarone or methotrexate.

[0055] Specific examples will be listed below to explain the scheme of the present invention. Those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not specified in the examples, they are carried out according to the techniques or conditions described in the literature in this area or according to the product specifications. Where the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0056] The kit for measuring tissue hydroxyproline content was purchased from Nanjing Jiancheng Bioengineering Institute. Male C57BL / 6 mice (8–10 weeks old) were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. All animal experiments were performed in accordance with the guidelines evaluated and approved by the Ethics Committee of Sichuan University.

[0057] Example 1: Preparation of saRNA-EEF1A1 vaccine In this example, a gene fragment of the target gene EEF1A1 (SEQ ID NO. 1) was first cloned into an alphavirus backbone plasmid to produce a saRNA-EEF1A1 recombinant plasmid. The constructed recombinant plasmid structure included: T7 promoter (SEQ ID NO. 3), 5'UTR (SEQ ID NO. 4), alphavirus nonstructural protein (SEQ ID NO. 5), immunogen EEF1A1 gene (SEQ ID NO. 1), 3'UTR (SEQ ID NO. 6), and PolyA tail (SEQ ID NO. 7). Finally, gene synthesis was performed and the recombinant plasmid was cloned into the pUC57-kan vector.

[0058] The constructed plasmid was mixed with 50 μL of E. coli competent cells DH5α and placed on ice for 30 min. Heat shock was performed at 42°C for 90 s, and the mixture was immediately returned to ice. After a 2-min ice bath, the mixture was incubated at 37°C for 1 hour.

[0059] Add 400 μL of LB medium and culture at 30°C in a shaking incubator for 45 to 60 min.

[0060] Take 50-100 μL of bacterial solution and spread it on LB solid medium containing 100 μg / mL kanamycin antibiotic, and culture it upside down at 37℃ overnight.

[0061] The obtained monoclonal colony plate was sequenced to verify its correctness, and the monoclonal colony with correct sequencing was picked and cultured in a shaking incubator at 30°C overnight.

[0062] Plasmids were extracted using an endotoxin-free plasmid extraction kit (purchased from Tiangen Biochemical Technology Co., Ltd.). The extracted plasmid was digested with restriction enzymes to form a linearized plasmid for use as a transcription template. The specific enzymatic digestion process for in vitro transcription and saRNA production is as follows: (1) Plasmid linearization: According to the instructions, use MluI restriction endonuclease to cut the linearized vector containing the DNA sequence shown in SEQ ID NO. 8, and verify the enzyme cutting effect by agarose gel electrophoresis.

[0063] (2) Purification of linearized plasmid: Purify the linearized plasmid according to the instructions of the DNA recovery kit (purchased from Chengdu Haoruilai Biotechnology Co., Ltd., HRL-ds0002). Add 3-5 times the volume of DNA recovery reagent Buffer A to the enzyme digestion system, centrifuge through the column, wash twice with DNA recovery reagent Buffer B, dry, add 50 uL of water to elute the linearized plasmid, and measure the concentration.

[0064] (3) In vitro transcription: In vitro transcription was performed according to the instructions of the RNA in vitro transcription kit (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HRL-sr0004). DNase I was used to remove the transcription template by incubation at 37°C for 15 min. RNA was recovered according to the RNA purification kit (precipitation method) (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HR-mr130). 1 volume of water and 1.5 volumes of RNA purification buffer A were added and the mixture was placed at -20°C for 30 min. The mixture was centrifuged at 12000 rpm and 4°C for 15 min. RNA purification buffer B was added and the mixture was centrifuged at 12000 rpm and 4°C for 5 min. This was repeated twice. After drying, RNase-free water was added to dissolve the RNA and the RNA concentration was determined.

[0065] (4) RNA capping: Heat denature the RNA at 65°C for 5 min and place on ice for 5 min. Perform RNA capping according to the instructions of the RNA capping kit (Chengdu Haoruilai Biotechnology Co., Ltd., HR-sr0001) and purify the RNA using the RNA purification kit. Add 1.5 times the volume of RNA purification buffer A and place at -20°C for 30 min. Centrifuge at 12,000 rpm at 4°C for 15 min. Add RNA purification buffer B and centrifuge at 12,000 rpm at 4°C for 5 min. Repeat twice. After drying, add RNase-free water to dissolve the RNA and determine the RNA concentration.

[0066] The RNA obtained by transcription and purification is encapsulated in LNP: (1) The LNP of the present invention is prepared as follows: the four components of lipids are dissolved in ethanol, and the liposome nanoparticles are prepared according to the formula of the prior art, using cationic lipid SM-102, auxiliary lipid DSPC, cholesterol, PEG lipid DMG-PEG 2000 The mixture was mixed at a molar ratio of 50:10:38.5:1.5 to obtain a lipid mixture LNP.

[0067] (2) The RNA was resuspended in RNA encapsulation buffer (HR-mr115, Chengdu Haoruilai Biotechnology Co., Ltd.) and encapsulated into RNA-LNP using microfluidic technology. Specifically, the prepared LNP was used as the organic phase and the buffer containing the synthesized RNA was used as the aqueous phase. The organic phase and the aqueous phase were mixed at a total flow rate of 12 mL / min on a microfluidic device at a ratio of 1:3 to obtain RNA-LNP, which was then purified and concentrated by ultrafiltration or purified by dialysis.

[0068] Ultrafiltration purification and concentration: The obtained RNA-LNP was centrifuged three times using LNP-mRNA storage solution Buffer A (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HR-mr110-1) according to the instructions; LNP-mRNA storage solution Buffer B (Chengdu Hao Rui Lai Biotechnology Co., Ltd., HR-mr110-2) was centrifuged three times according to the instructions. Finally, the LNP-mRNA was pipetted into RNase-free EP tubes and stored at -80°C. The obtained RNA-LNP encapsulation efficiency was 92%, and the RNA content was 0.1 μg / μL.

[0069] Dialysis method: After dialyzing the RNA-LNP with PBS, the LNP-mRNA storage solution Buffer B was centrifuged three times according to the instructions. Finally, the LNP-mRNA was pipetted into RNase-free EP tubes and stored at -80°C. The obtained RNA-LNP encapsulation efficiency was 92%, and the RNA content was 0.1 μg / μL.

[0070] Comparative Example 1: Preparation of saRNA-Luciferase Vaccine The preparation of the saRNA-Luciferase vaccine in this comparative example was the same as in Example 1, except that the target gene EEF1A1 sequence was replaced with the Luciferase sequence (SEQ ID NO. 2). Hereinafter referred to as the irrelevant sequence group.

[0071] Experimental Example 1: Efficacy of saRNA-EEF1A1 vaccine in treating pulmonary fibrosis in mice In order to study the ability of the saRNA-EEF1A1 vaccine prepared in Example 1 to treat pulmonary fibrosis in mice, the mice were injected intramuscularly with the saRNA-EEF1A1 vaccine (effective dose 1 μg / mouse) dissolved in sterile PBS on days 0, 7, and 14, and each mouse was given a sublingual instillation of 3 mg / kg bleomycin on day 1 to establish an in vivo mouse pulmonary fibrosis model. The weight changes of the mice were recorded during the modeling period. After 28 days of modeling, the mice were sacrificed, their weights were calculated, and lung tissues were isolated and used to evaluate the pathological indicators related to pulmonary fibrosis. Figure 1 As shown in a, saRNA-EEF1A1 vaccine immunization can effectively reduce the increase in lung coefficient (lung weight / body weight) of mice caused by bleomycin. Hydroxyproline is one of the main components of collagen tissue and a collagen-specific amino acid. It is one of the important evaluation indicators of pulmonary fibrosis. Therefore, we used a hydroxyproline detection kit to analyze the hydroxyproline content in the lung tissue of each group of mice, as shown in Figure 3. Figure 1 As shown in b, the hydroxyproline content in the lung tissue of the treated mice was significantly lower than that in the model group and the irrelevant sequence group. Figure 1 As shown in c, the qPCR results also showed the decrease of Col1a and Col3a in the lung tissue of the treated mice at the mRNA level. Figure 1 As shown in Figure d, the collagen deposition in the lung tissue of the treatment group was also significantly improved. Figure 1 Immunohistochemistry results showed that the Col1a-positive fraction in lung tissues of the saRNA-EEF1A1-treated group was significantly lower than that in the model group and the unrelated sequence group. In summary, EEF1A1 is a potential therapeutic target for pulmonary fibrosis that has been discovered for the first time. Its saRNA vaccine can effectively alleviate bleomycin-induced pulmonary fibrosis in mice and is a potential candidate vaccine for the treatment of pulmonary fibrosis.

[0072] The following is the nucleotide sequence involved in the present invention EEF1A1 gene sequence (SEQ ID NO. 1): Luciferase gene (SEQ ID NO. 2): T7 promoter (SEQ ID NO: 3): TAATACGACTCACTATAG; 5'UTR (SEQ ID NO: 4) ATGGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAA; Alphavirus nonstructural protein (SEQ ID NO.5) 3'UTR (SEQ ID NO: 6): AAAATTTTTATTTTATTTTTTCTTTTCTTTTCCGAATCGGATTTTGTTTTTAATATTTC; PolyA tail (SEQ ID NO: 7): AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA; Full sequence of saRNA-EEF1A1 plasmid vector (SEQ ID NO: 8):

Claims

1. A saRNA, characterized in that: Transcribed from an alphavirus backbone vector, the alphavirus backbone vector includes the gene sequence of the immunogen EEF1A1; the gene sequence of the immunogen is as shown in SEQ ID NO.1 or a gene sequence that has at least 90% homology with SEQ ID NO.1 and has the same or similar biological activity.

2. The saRNA according to claim 1, wherein: The alphavirus backbone vector includes a promoter, a 5'UTR, an alphavirus non-structural protein, a gene sequence of an immunogen, a 3'UTR and a PolyA tail; the nucleotide sequence of the promoter is shown in SEQ ID NO.3; the nucleotide sequence of the 5'UTR is shown in SEQ ID NO.4; the nucleotide sequence of the alphavirus non-structural protein is shown in SEQ ID NO.5; the nucleotide sequence of the 3'UTR is shown in SEQ ID NO.6; and the nucleotide sequence of the PolyA tail is shown in SEQ ID NO.

7.

3. The saRNA according to claim 1 or 2, wherein: The nucleotide sequence of the alphavirus backbone vector is shown in SEQ ID NO.

8.

4. A saRNA vaccine for preventing and / or treating fibrosis, characterized in that: A vector comprising the saRNA according to any one of claims 1 to 3 and a saRNA delivery vector.

5. The vaccine according to claim 4, characterized in that: The delivery vehicle is selected from at least one of LNP, polymer nanoparticles or liposome complexes; preferably, the LNP components include: cationic lipid SM-102, auxiliary lipid DSPC, cholesterol and PEG lipid DMG-PEG 2000 ; The polymer nanoparticles are selected from at least one of the following: PEI, PAMAM, PLL, PPI; the liposome complex is selected from at least one of the following: DOTAP, DOTMA, DC-Chol, DOSPA.

6. A combination drug, characterized in that: Contains the saRNA according to any one of claims 1 to 3 or the saRNA vaccine according to any one of claims 4 to 5, administered separately or simultaneously, and other drugs for preventing and / or treating fibrotic diseases.

7. Use of the saRNA according to any one of claims 1 to 3, the saRNA vaccine according to any one of claims 4 to 5, or the combination drug according to claim 6 in the preparation of a drug for treating and / or preventing fibrotic diseases.

8. The use according to claim 7, characterized in that: The drug is a pharmaceutical preparation administered by injection, oral administration, nasal mucosa, lungs, rectum, oral mucosa or skin; preferably, the drug is an injection preparation, and the injection route is at least one of intramuscular injection, intravenous injection, subcutaneous injection, intradermal injection, intramyocardial injection or intraperitoneal injection.

9. The use according to claim 7 or 8, characterized in that: The fibrotic disease is selected from at least one of pulmonary fibrosis, liver fibrosis, pancreatic fibrosis, renal fibrosis, cardiac fibrosis, endometrial fibrosis, ocular fibrosis, splenic fibroproliferative disease, myelofibrosis or skin fibrosis; preferably, the pulmonary fibrosis includes at least one of idiopathic pulmonary fibrosis, secondary pulmonary fibrosis, hereditary pulmonary fibrosis or other pulmonary fibrosis.

10. The method for preparing saRNA according to any one of claims 1 to 3, wherein: The following steps are involved: (1) Enzymatically digest the plasmid containing the DNA sequence shown in SEQ ID NO. 8 to obtain a linearized template, which was then purified; (2) The purified linearized template is transcribed in vitro and purified to obtain purified RNA; (3) Capping and purifying the purified RNA obtained in step (2) to obtain saRNA.

Images