A SNP marker affecting porcine inosine content and its application

Abstract

This invention relates to the fields of molecular markers and animal genetic breeding technology, and particularly to a SNP marker that affects porcine inosine content and its application. Based on purebred American Landrace, purebred American Large White, and purebred American Duroc pigs, this invention studies and identifies 10 SNP molecular markers closely related to porcine inosine content. By optimizing the dominant alleles of these SNPs, the frequency of dominant alleles can be increased generation by generation, reducing inosine content, accelerating the progress of pig genetic improvement, and thus effectively improving the economic benefits of pig breeding.

Description

Technical Field

[0001] This invention relates to the fields of molecular markers and animal genetic breeding technology, and in particular to an SNP marker that affects porcine inosine content and its application. Background Technology

[0002] Inosine, composed of hypoxanthine and ribose, is a breakdown product of IMP (inosine monophosphate). Its umami flavor is significantly weaker than that of IMP and it has a slightly bitter taste. Furthermore, inosine is an intermediate in purine metabolism; its further metabolism produces uric acid. Long-term consumption of meat high in inosine may increase the risk of hyperuricemia or gout in certain populations. From a breeding perspective, inosine itself is not a functional substance for flavor enhancement, but rather an irreversible end product of IMP degradation. Therefore, a key breeding strategy for optimizing pork flavor needs to actively inhibit inosine accumulation.

[0003] Genome-wide association analysis (GWAS), as an analytical tool in molecular genetics research, can detect single nucleotide polymorphisms (SNPs) significantly associated with inosine content and convert them into molecular markers for marker-assisted breeding, thereby achieving precise localization and improvement of the inosine content trait. Compared with traditional breeding methods, marker-assisted breeding has the following advantages: ① It can improve the accuracy of breeding, enabling targeted regulation of inosine metabolic pathways at the molecular level, overcoming the limitations of traditional phenotypic selection; ② It can significantly shorten the breeding cycle and accelerate the genetic progress of superior populations; ③ It can effectively improve the flavor and quality of pork and reduce the health risks caused by excessively high inosine content; ④ It can provide high-value-added products for the livestock industry, enhancing market competitiveness and economic benefits.

[0004] Therefore, based on the molecular marker-assisted breeding strategy, exploring and identifying key molecular markers affecting inosine content and applying them to the improvement of breeding populations can efficiently and directionally improve the inosine content of pigs at the molecular level. This not only helps to improve the market competitiveness of pork products, but also meets consumers' dual demand for healthy and delicious meat products, which has profound significance for the sustainable development of the pig farming industry. Summary of the Invention

[0005] In order to overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP marker that affects porcine inosine content.

[0006] Another object of the present invention is to provide the application of the above-mentioned SNP marker.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] A SNP marker that affects porcine inosine content, comprising at least one of the following SNP markers:

[0009] (I) The SNP site corresponds to the G>A mutation at position 62924697 on chromosome 2 in International Pig Genome Version 11.1;

[0010] (II) The SNP site corresponds to the G>C mutation at position 18241434 on chromosome 11 in International Pig Genome Version 11.1;

[0011] (III) The SNP site corresponds to the A>G mutation at position 4304074 on chromosome 11 in International Pig Genome Version 11.1;

[0012] (IV) The SNP site corresponds to the T>A mutation at position 6430126 on chromosome 1 in International Pig Genome Version 11.1;

[0013] (V) The SNP site corresponds to the A>G mutation at position 132607570 on chromosome 9 in the international pig genome version 11.1;

[0014] (VI) The SNP site corresponds to the AAT>A mutation at position 15358300 on chromosome 11 in the International Pig Genome Version 11.1;

[0015] (VII) The SNP site corresponds to the C>T mutation at position 62822435 on chromosome 2 in International Pig Genome Version 11.1;

[0016] (VIII) The SNP site corresponds to the T>C mutation at position 1350502 on chromosome 9 in International Pig Genome Version 11.1;

[0017] (IX) The SNP site corresponds to the T>C mutation at position 43946013 on chromosome 17 in International Pig Genome Version 11.1;

[0018] (X) The SNP site corresponds to the A>G mutation at position 110068550 on chromosome 9 in the International Pig Genome Version 11.1.

[0019] For (I), the SNP-labeled nucleic acid sequence is shown in SEQ ID NO:1, where M in the sequence is G or A, and its SNP site is a single base mutation of G298-A298 at position 298 of the sequence marked in SEQ ID NO:1.

[0020] For (Ⅳ), the SNP-labeled nucleic acid sequence is shown in SEQ ID NO:2, where M in the sequence is T or A, and its SNP site is a single base mutation of T285-A285 at position 285 of the sequence labeled in SEQ ID NO:2.

[0021] In the specific implementation plan:

[0022] For (I)-(III), the pigs are of American Duroc breed or their synthetic line.

[0023] For (Ⅳ)-(Ⅵ), the pigs are of American Landrace breed or their synthetic line.

[0024] For (VII)-(VIII), the pigs are of American Large White breed or their synthetic line.

[0025] For (IX)-(X), the source of the pig is American Landrace, American Large White, American Duroc or their synthetic lines.

[0026] A primer combination for detecting the above-mentioned SNP markers, comprising at least one of primer pairs primer-F1 and primer-R1, and primer pairs primer-F2 and primer-R2, the nucleotide sequences of which are shown in SEQ ID NO:3-6.

[0027] A kit for detecting the above-mentioned SNP markers, comprising the above-mentioned primer combination.

[0028] The application of the SNP markers, primer combinations, or kits in identifying inosine content or meat quality-related traits in pigs or pork, screening pig breeds with low inosine content or excellent meat quality, or in the genetic breeding of inosine content or meat quality-related traits in pigs.

[0029] A method for genetic improvement of pigs, comprising the following steps:

[0030] Identify the aforementioned SNP markers of breeding pigs in the core breeding pig herd, and make corresponding selections based on the SNP markers:

[0031] For (I), select breeding pig individuals with the G / A genotype at position 62924697 on chromosome 2 of International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype to increase the frequency of allele A at this locus generation by generation;

[0032] For (II), select breeding pig individuals with the G / G or G / C genotype at position 18241434 on chromosome 11 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype, so as to increase the frequency of the G allele at this locus generation by generation.

[0033] For (III), select breeding pig individuals with the A / A or G / A genotype at position 4304074 on chromosome 11 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the G / G genotype, so as to increase the frequency of allele A at this locus generation by generation.

[0034] For (Ⅳ), select breeding pig individuals with the T / T or T / A genotype at position 6430126 on chromosome 1 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype, so as to increase the frequency of the T allele at this locus generation by generation.

[0035] For (V), select breeding pig individuals with the G / G or G / A genotype at position 132607570 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the A / A genotype, so as to increase the frequency of the G allele at this locus generation by generation.

[0036] For (VI), select breeding pig individuals with the A / A or A / AAT genotype at position 15358300 on chromosome 11 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the AAT / AAT genotype to increase the frequency of allele A at this locus generation by generation.

[0037] For (VII), select breeding pig individuals with the C / T genotype at position 62822435 on chromosome 2 of International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the T / T genotype, so as to increase the frequency of allele C at this locus generation by generation;

[0038] For (VIII), select breeding pig individuals with the C / T genotype at position 1350502 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype to increase the frequency of the allele T at this locus generation by generation;

[0039] For (IX), select breeding pig individuals with the C / T genotype at position 43946013 on chromosome 17 in International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pig individuals with the C / C genotype to increase the frequency of the allele T at this locus generation by generation;

[0040] For (X), select breeding pigs with the G / G or G / A genotype at position 110068550 on chromosome 9 of the International Pig Genome Version 11.1 from the core breeding pig population, and cull breeding pigs with the A / A genotype, in order to increase the frequency of the G allele at this locus generation by generation.

[0041] A method for identifying inosine content or meat quality-related traits in pigs or pork, comprising the following steps:

[0042] Identify the aforementioned SNP markers in pigs or pork, and determine the inosine content or meat quality-related traits in pigs or pork based on the SNP sites of the SNP markers, wherein:

[0043] For (I), the inosine content of pigs from low to high or the meat quality traits from good to bad are sorted by the genotype at position 62924697 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: G / A genotype, G / G genotype.

[0044] For (II), the inosine content of pigs from low to high or the meat quality traits from good to bad are sorted by the genotype at position 18241434 on chromosome 11 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / C genotype and C / C genotype.

[0045] For (III), the inosine content of pigs from low to high or the meat quality traits from good to bad are sorted by the genotype at position 4304074 on chromosome 11 of the International Pig Genome Version 11.1, in the following order: A / A genotype, G / A genotype and G / G genotype.

[0046] For (Ⅳ), the inosine content of pigs from low to high or the meat quality traits from good to bad are sorted by the genotype at position 6430126 on chromosome 1 of the International Pig Genome Version 11.1, in the following order: T / T genotype, T / A genotype and A / A genotype.

[0047] For (V), the inosine content of pigs from low to high or the meat quality traits from good to bad are ordered by the genotype at position 132607570 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype and A / A genotype.

[0048] For (VI), the inosine content of pigs from low to high or the meat quality traits from excellent to poor are ordered by the genotype at position 15358300 on chromosome 11 of the International Pig Genome Version 11.1, in the following order: A / A genotype, A / AAT genotype and AAT / AAT genotype.

[0049] For (VII), the inosine content of pigs from low to high or the meat quality traits from good to bad are ordered by the genotype at position 62822435 on chromosome 2 of the International Pig Genome Version 11.1, in the following order: C / T genotype, T / T genotype;

[0050] For (VIII), the inosine content of pigs from low to high or the meat quality traits from good to bad are ordered by the genotype at position 1350502 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: C / T genotype, C / C genotype.

[0051] For (IX), the inosine content of pigs from low to high or the meat quality traits from good to bad are ordered by the genotype at position 43946013 on chromosome 17 of the International Pig Genome Version 11.1, in the following order: C / T genotype, C / C genotype.

[0052] For (X), the inosine content of pigs from low to high or the meat quality traits from excellent to poor are ordered by the genotype at position 110068550 on chromosome 9 of the International Pig Genome Version 11.1, in the following order: G / G genotype, G / A genotype, and A / A genotype.

[0053] The application of the SNP markers, primer combinations, or kits described herein in the fields of gene editing or transgenics.

[0054] A method for establishing a new pig breed and / or new pig strain that reduces inosine content or improves pork quality, comprising the following steps:

[0055] The above-mentioned SNP markers in pigs were identified, and the following mutations were performed based on the SNP markers:

[0056] For (I), pigs with the SNP marker having the genotype G / G, the G / G genotype is mutated to the G / A genotype through site-directed mutagenesis;

[0057] For (II), pigs with the SNP marker having the genotype C / C or G / C, the C / C or G / C genotype is mutated to the G / G genotype through site-directed mutagenesis;

[0058] For (III), pigs with the SNP marker having the genotype G / G or G / A, the G / G or G / A genotype is mutated to the A / A genotype through site-directed mutagenesis;

[0059] For (Ⅳ), pigs with the SNP marker having the genotype A / A or T / A, the A / A or T / A genotype is mutated to the T / T genotype through site-directed mutagenesis;

[0060] For (V), pigs with the SNP marker having the genotype A / A or G / A, the A / A or G / A genotype is mutated to the G / G genotype through site-directed mutagenesis;

[0061] For (VI), pigs with the SNP marker having the genotype AAT / AAT or A / AAT are mutated to the A / A genotype through site-directed mutagenesis.

[0062] For (VII), the pigs with the SNP marker having the genotype T / T are mutated to the C / T genotype through site-directed mutagenesis;

[0063] For (VIII), pigs with the SNP marker having the genotype C / C are mutated to the C / T genotype through site-directed mutagenesis;

[0064] For (IX), pigs with the SNP marker having the genotype C / C are mutated to the C / T genotype through site-directed mutagenesis;

[0065] For (X), pigs with the SNP marker having the genotype A / A or G / A, the A / A or G / A genotype is mutated to the G / G genotype through site-directed mutagenesis.

[0066] The mutation is performed using transgenic methods or gene editing methods.

[0067] The preferred method for mutation is to use the CRISPR / Cas9 gene editing method.

[0068] The present invention has the following advantages and effects compared with the prior art:

[0069] (1) Based on purebred American Landrace pigs, purebred American Large White pigs and purebred American Duroc pigs, this invention studies and identifies 10 SNP molecular markers that are closely related to the content of inosine in pigs, which are located on chromosomes 1, 2, 9, 11 and 17 respectively. At least one of the SNP markers in this invention can be used to detect relevant indicators in pigs, or at least one of these SNP markers can be used for genetic improvement.

[0070] (2) Based on the SNP markers that affect the inosine content of pigs, this invention establishes a set of efficient and accurate molecular marker-assisted breeding technology, including primers and kits for detecting the SNP markers, methods for identifying the inosine content or meat quality-related traits of pigs or pork, and methods for genetic improvement of pigs. When applied to the genetic improvement of inosine content or meat quality-related traits of pigs, it can quickly and accurately select and breed inosine content or meat quality-related traits of pigs, thus accelerating the breeding process.

[0071] (3) This invention uses molecular breeding to solve the problem of high inosine content. By selecting the superior alleles of the above-mentioned SNPs, the frequency of superior alleles can be increased generation by generation, the inosine content can be reduced, the progress of pig genetic improvement can be accelerated, and the economic benefits of breeding pigs can be effectively improved. Attached Figure Description

[0072] Figure 1 This is a Manhattan plot of GWAS analysis of inosine content traits on different chromosomes in different experimental populations; where the X-axis represents the location of the molecular marker site on the chromosome, and the Y-axis represents the -log[missing value] of the molecular marker site. 10 (P-value).

[0073] Figure 2 This is a violin plot showing the corresponding inosine content in the population for each genotype at all loci, where the X-axis represents the genotype of the SNP molecular marker locus and the Y-axis represents the inosine content of the individual. Detailed Implementation

[0074] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0075] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. Unless otherwise stated, the reagents, methods, and equipment used in this invention are conventional reagents, methods, and equipment in this technical field.

[0076] In the examples, the standard used for HPLC detection was inosine (58-63-9), which was purchased from Shanghai Anpu Experimental Technology Co., Ltd.

[0077] Example 1

[0078] 1. Laboratory animals

[0079] The pig population used in this invention consists of: 173 purebred American Landrace pigs, 166 purebred American Large White pigs, and 158 purebred American Duroc pigs.

[0080] All pigs were sourced from Jiangxi Yudu Jiada Livestock Co., Ltd. All pigs were slaughtered and tested at Jiangxi Nanchang Guohong Food Co., Ltd. after reaching 200 days of age, in the slaughterhouse's cutting workshop. After slaughter and bleeding, the hair, internal organs, head, tail, and limbs (below the wrists and joints) were removed, and the skin was removed to obtain a carcass. Sampling was completed within 30 minutes of slaughter to minimize the impact of post-mortem metabolism on the content of nucleotides and their metabolites. The longissimus dorsi muscle (eye muscle) was precisely separated from the left side of the pig carcass between the 1st and 2nd lumbar vertebrae, and visible connective tissue and fascia were removed. Approximately 2.0g of muscle tissue was taken, rapidly transferred to a 2mL cryovial, cut into small pieces, and flash-frozen in liquid nitrogen (-196℃), then stored in an ultra-low temperature freezer at -80℃ until the experiment.

[0081] 2. HPLC quantitative determination of inosine content in pork

[0082] (1) Extraction of inosine: Accurately weigh 0.4g (accurate to 0.001g) of muscle sample from the shredded longissimus dorsi muscle sample and place it in a 15mL polypropylene acid-resistant centrifuge tube.

[0083] (2) Acid hydrolysis extraction: Add 6 mL of 6% (w / w) perchloric acid solution pre-cooled to 4℃, and then homogenize it for 45 s with a handheld high-speed homogenizer (run for 10 s / pause for 5 s, cycle 3 times), and use an ice bath intermittently to prevent overheating.

[0084] (3) Centrifugation purification: Transfer the homogenate to a constant temperature water bath shaker (4℃), shake at 200 rpm for 15 min to promote nucleotide release; centrifuge at 4℃ and 5000 rpm for 10 min, collect the supernatant into a new tube, repeat the centrifugation twice, and combine the supernatants from the two centrifugations.

[0085] (4) Precise pH control for acid-base neutralization: Place the combined supernatant from step (3) in an ice bath and use a micropipette to add 3 mol / L NaOH solution dropwise to adjust the pH to 6.5 ± 0.1 (using a pH meter for real-time monitoring). This can minimize interference with ATPase activity. Add ultrapure water to bring the volume to 10 mL, vortex to mix, and let stand for 10 min to promote ion balance.

[0086] (5) The content of inosine in the extract of the longissimus dorsi muscle of each individual pig was determined by high performance liquid chromatography (HPLC) (unit: mg / 100g). The HPLC analysis was performed on an ACQUITYUPLCH-ClassPLUS System (Waters). The chromatographic column was Waters BEHC18 1.7μm 2.1×100mm. The mobile phase was 0.05mol / L KH2PO4 buffer (pH 6.0)-methanol (95:5, v / v). The flow rate was 0.2mL / min (isocratic elution). The column temperature was 30℃. The detection wavelength was 254nm. The injection volume was 2μL. The external standard method was used for quantification. The standard curve should meet the requirement of R²≥0.999.

[0087] (6) Concentration data obtained from the HPLC system are converted from the original unit µg / mL to mg / 100g using the following formula:

[0088]

[0089] Where C represents the content of inosine in 100 grams of pork (mg / 100g), and C0 represents the concentration of inosine measured by HPLC (µg / mL).

[0090] This invention presents descriptive statistics on HPLC detection data of inosine in the longissimus dorsi muscle of three commercial pig breeds (Large White, Landrace, and Duroc). The sample size (N), mean, standard deviation (SD), minimum-maximum (Min-Max), and coefficient of variation (CV) were systematically calculated. The descriptive statistical results are shown in Table 1. Inosine content was significantly higher in Large White and Landrace pigs than in Duroc pigs. All three breeds exhibited high coefficients of variation (>44%), reflecting that inosine metabolism is easily affected by environmental or epigenetic factors.

[0091] Table 1. Descriptive statistics of inosine content in three varieties (unit: mg / 100g)

[0092]

[0093] Example 2

[0094] 1. Acquisition, quality control, and genotyping of whole-genome resequencing data in pigs.

[0095] (1) DNA extraction: Ear tissue samples were collected from each individual in the three experimental pig groups in Example 1, and genomic DNA was extracted from each individual using the standard phenol-chloroform method. The extracted genomic DNA was dissolved in TE buffer. The quality of the extracted genomic DNA was detected using a Nanodrop-ND1000 spectrophotometer. The quality standard was met when the A260 / 280 ratio was around 1.8-2.0 and the A260 / 230 ratio was around 1.7-1.9.

[0096] (2) DNA sequencing: The concentration of DNA samples that meet the standards is diluted to 50 ng / μL. The whole genome resequencing (paired-end 150 bp sequencing mode) is completed by the BGI T7 sequencing platform. The average sequencing depth of the sample reaches 30×, and the raw sequencing data in fastq format is obtained. Clean reads are obtained through fastp (v0.23.0) quality control for subsequent analysis.

[0097] (3) Sequence alignment: The raw sequencing data obtained in step (2) were aligned with the Sscrofa 11.1 (NCBI Suscrofa version 11.1) reference genome using BWA (v0.7.17) to obtain a sam format file.

[0098] (4) Variation detection: Use samtools (v1.10) to sort and convert the sam format file in step (3) into a bam format file, and then use Sambamba (v0.8.2) to remove PCR repeat sequences in the bam format file. Finally, use Graphtyper (v2.7.7) to perform genetic variation detection on all individual bam files to obtain population-level genotype data (vcf file).

[0099] (5) Variation Quality Control: The population-level genotype data obtained in step (4) was quality controlled using samtools. High-quality genotype sites were retained if they met the condition "FILTER="PASS"" and the variation detection quality value (GQ) > 20. Plink (v1.9) was further used to perform quality control on the population-level genotype data, excluding variant sites with a minor allele frequency (MAF) below 5% and samples with an individual genotype call rate below 80%. Finally, beagle (r1399) was used to autofill the genotypes to obtain high-quality genotype data.

[0100] After processing using the methods described above, 1,928,103, 1,964,653, and 1,513,322 mutation sites (including SNPs and Indels) were obtained in Dabai, Changbai, and Duroc, respectively.

[0101] 2. Genome-wide association study (GWAS) analysis and meta-analysis

[0102] (1) Genome-wide association analysis was performed on the phenotypic data after confounding correction using the Genome-wide Efficient Mixed Model Association algorithm (GEMMA v0.98.1). Specifically:

[0103] ① We used the lm() function in R language to process the phenotypes. We put gender and batch into the function to perform a simple linear regression, and the corrected residuals were used as the phenotypes for the final association analysis.

[0104] ② The analysis uses a univariate linear mixed model (ULMM) for statistical inference, and its mathematical expression is constructed as follows:

[0105]

[0106] Where y represents the n-dimensional vector of the phenotype to be analyzed (quantitative trait or binary vector), which in this study is the inosine content; W represents a matrix consisting of a column of "1"s (n×c-dimensional); α is the vector of the effect and intercept of the corresponding covariate (c-dimensional); x represents the vector of the genotype at the detection locus (n-dimensional); β represents the vector of the magnitude of the effect at the detection locus; u indicates that the genotype follows a mean of 0 and a covariance-variance matrix of λτ. -1 The random effects vector (n-dimensional) of a K-multivariate normal distribution. This indicates that the system follows a pattern with a mean of 0 and a covariance-variance matrix of τ. -1 The residual vector of In (n-dimensional). In two n-variable normal distributions, n represents the number of phenotypes, τ -1 Let represent the variance of the residuals, and λ represent the ratio of the variance of the random effects to the variance of the residuals; K represents the n×n kinship matrix, and In represents the n×n identity matrix; MVNn represents the n-dimensional multivariate normal distribution. To correct for multiple hypothesis testing, a genome-wide significance threshold of 0.05 / N (Bonferroni correction) is set, where N is the number of valid SNPs / Indels.

[0107] (2) Using the results of the above GWAS analysis, a meta-analysis of inosine content in the three groups was performed in METAL software. The meta-analysis was based on the standard error weighting method (SCHEME STDERR).

[0108] This invention is based on GWAS analysis ( Figure 1 A total of 10 representative SNP loci were obtained (including those obtained from meta-analysis), and their basic genetic parameters are shown in Table 2. The names of the representative SNP loci were obtained from the sus_scrofa.vcf.gz file downloaded from the NCBI database using bcftools software. If the website did not have the SNP name information for that locus, the SNP name was represented in the form of "chromosome_location". Other important genetic parameters for each representative locus were provided by GWAS analysis using GEMMA software, including the chromosome and location of the locus, alleles, effect size, and p-value (Wald test).

[0109] Table 2. Basic genetic parameters of 10 representative SNP loci

[0110]

[0111] Note: The meta-analysis integrates genome-wide association study data from three pig breeds: Duroc, Landrace, and Large White.

[0112] 3. Analysis of phenotypic differences in inosine content among different genotypes

[0113] Genotypes at displayed molecular marker sites in each of the 497 pigs from three populations were extracted from sequencing files using Plink (v1.9). After counting the number of individuals with each genotype, the genotypes of these individuals were correlated with their corresponding inosine levels. Then, the `summarise` function from the `dplyr` package in R was used to statistically analyze the differences in phenotypic distribution among different genotypes. The results are shown in Table 3. Figure 2 As shown in the figure. The p-value is obtained from the variance test.

[0114] Table 3. Effects of each molecular marker site on inosine content (unit: mg / 100g)

[0115]

[0116] 4. Heritability analysis

[0117] Heritability is one of the most important fundamental genetic parameters in quantitative genetics, and it can be divided into broad-sense heritability, narrow-sense heritability, and realized heritability. In the breeding process, heritability generally refers to narrow-sense heritability (h0). 2), which refers to the proportion of the variance in quantitative trait breeding values ​​to the variance in phenotypic values, is the additive effect portion after eliminating dominant and epistatic effects, and is stably inherited during generational transmission. This invention estimates single-marker heritability based on the effect value (β) and its standard error (SE) of each locus in the GWAS results file, and takes their mean as the approximate narrow-sense heritability at the whole-genome level. The specific calculation formula is as follows:

[0118]

[0119] Where β is the regression coefficient of a single SNP site, and SE is its corresponding standard error.

[0120] Table 4 shows the results of the heritability estimation analysis of inosine content in the three populations. The heritability distribution of inosine content in the three populations ranges from 0.328 to 0.362.

[0121] Table 4. Heritability estimation of inosine content in the three populations (h 2 )

[0122]

[0123] Example 3

[0124] This embodiment provides a method and process for detecting SNP markers in Example 2, specifically taking SNP markers rs3475047949 and rs789800321 as examples, whose corresponding breeds are Duroc and Landrace pigs, respectively. The specific method is as follows:

[0125] 1. Primer design

[0126] (1) The target fragment containing a SNP site that is significantly correlated with the inosine content of Duroc pigs is a 548 bp nucleotide sequence from chromosome 2 (SEQ ID NO:1). The upstream and downstream primers for sequence amplification are primer-F1 and primer-R1, and their nucleic acid sequences are as follows:

[0127] Upstream primer primer-F1: 5'-TGTCTGTGAGTCTGTTTCTGTTTTG-3' (SEQ ID NO:3);

[0128] Downstream primer-R1: 5'-AGTGCTGAGAGTTTAGCCCTC-3' (SEQ ID NO:4).

[0129] (2) The target fragment containing SNP sites that are significantly correlated with the inosine content of American Landrace pigs is a 565bp nucleotide sequence from chromosome 1 (SEQ ID NO:2). The upstream and downstream primers for sequence amplification are primer-F2 and primer-R2, and their nucleic acid sequences are as follows:

[0130] Upstream primer primer-F2: 5'-TCCTGCCGGTATTTGACGAG-3' (SEQ ID NO:5);

[0131] Downstream primer-R2: 5'-CTCTGCTCTGAAGACAGCGG-3' (SEQ ID NO:6).

[0132] 2. PCR amplification

[0133] Add 1 μL of the DNA template to be tested, 3.4 μL of double-distilled water, 5 μL of 2×Taq PCR StarMixwith Loading Dye, and 0.3 μL each of forward and reverse primers to a 10 μL reaction system. The PCR reaction conditions are as follows: 94℃ pre-denaturation for 5 min, followed by 94℃ denaturation for 30 s, 55-65℃ annealing for 30 s, and 72℃ extension for 45 s, for 35 cycles, and a final extension at 72℃ for 5 min.

[0134] 3. DNA sequencing

[0135] DNA sequence sequencing and identification: Performed at BGI Genomics Co., Ltd. in Shenzhen, the gene fragments were sequenced using both forward and reverse reactions. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites.

[0136] SEQ ID NO:1 (chr2: 62924399-62924947):

[0137] TGTCTGTGAGTCTGTTTCTGTTTTGTAGATAGGTTCATTTGTGCCATATTTTAGATTCCACATATAAGTGATAATCATATGGCATTTGACTTTCTCTTTCTGACTTACTTCACTTAGCATGAAAATCTCTAGTTGCATCCATGTTGCT GAAAATGGCATTATTCCTTTCTTTTTATGGCTGAGTAATATCCCATTGTGTATGTGTACCACATCTTCTTAATCCACCCATCTGTCAATAGACATTTAGATTATTTAAAAGTCCTGTCTACTGTGAATAGTGCTGCAATGAACATAGGA M(G / A) TGCATGTATCTTTTTGAATGAAAGTTTTGTCCAGATATATGTCCTGGAGTGGGATTGCTGGATCATTTGGTAATTCTGTATTTTGTTTCCTGAGGTACCTCCATACTGTTTCTCTAGTGGTTGTATCAATTTACATTCCTACAAACAGTGTAGGAGTGTTACCTTTTTCCACACCCTTTCCAGCATTCCATTTGTATTAATCATTCTCCATTAACTCTTTTTACTTCCAGAGGGCTAAACTCTCAGCACT

[0138] SEQ ID NO:2(chr1:6429841-6430406):

[0139] TCCTGCCGGTATTTGACGAGACCTCAAAAAGGCATCAGGCATCAGTACATTGACTTTATTTATTTTTTTGGTCACACCCATGGCATGTGGAAGTTCCCCAGCCCAGGGATCAAACCCATGCCCCAGCAGCAACCTGAGCCACAGTGGCGACAACACCAGCTCCTTAACCTGCTGTGCCACCAGGGAACTCCTTGATTTTATTTTCAAGTAGAGTTCTTTTGGAACTGTTCTGGGCAGTGTGTTACGGAGAGTTCTGAGTAGCTTTTTTTTTTTTTTTTTTTTTT M(T / A) AATCGTGATTCACGCACCCATCCAGCCTACACTTCCCCTGCTCCTTCCCCTCCTTGGCACTTTGGGACTGACCCATTTTCACCACCTCTCCACCTGTGCGGCTGTCAGCCTTCCTTCCATCAGGCTCTTCTCCATGGGGTGGGGGGGGAAGCAAGGAAGCAAAACAAACAGCTTTGCATAAAACCTGTTATCCTTGAAAATCAAAGGCATTCGACTAACTCAAAGAGTTCCATGGCAGATTAGTGCCAACTGCCCGCACGCCGCTGTCTTCAGAGCAGAG

[0140] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The primer binding position is indicated by bolding at the beginning and end of the sequence.

[0141] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Use of a SNP locus affecting pig inosine content in the identification of pigs or pork inosine content or in the genetic breeding of pig inosine content, characterized in that The SNP site comprises at least one of the following SNP sites: (I) the SNP site corresponds to the G>C mutation at position 18241434 on chromosome 11 in the International Pig Genome 11.1 version; (II) the SNP site corresponds to the A>G mutation at position 4304074 on chromosome 11 in the International Pig Genome 11.1 version; (III) the SNP site corresponds to the T>A mutation at position 6430126 on chromosome 1 in the International Pig Genome 11.1 version; (IV) the SNP site corresponds to the AAT>A mutation at position 15358300 on chromosome 11 in the International Pig Genome 11.1 version; (V) the SNP site corresponds to the T>C mutation at position 1350502 on chromosome 9 in the International Pig Genome 11.1 version; For (I) and (II), the pig is a US Duroc pig; For (III) and (IV), the pig is a US Landrace pig; For (V), the pig is a US Large White pig.

2. The use according to claim 1, characterized in that: For (III), the SNP site is M in the nucleotide sequence shown as SEQ ID NO: 2, and the base is T or A.

3. Use of a primer combination for detecting a SNP site affecting pig inosine content in identifying pig or pork inosine content or pig inosine content genetic breeding, characterized in that The primer combination comprises primer pair primer-F2 and primer-R2, and the nucleotide sequences thereof are shown as SEQ ID NO: 5-6; The SNP site is the SNP site (III) described in claim 1; and the pig is a US Landrace pig.

4. Use of a kit for detecting a SNP site affecting pig inosine content in identifying pig or pork inosine content or genetic breeding of pig inosine content, characterized in that The kit comprises the primer combination described in claim 3; The SNP site is the SNP site (III) described in claim 1; and the pig is a US Landrace pig.

5. A method of genetic improvement of swine, characterized in that Comprising the following steps: Determine the genotype of the SNP site as described in claim 1 or 2 for the breeding pigs in the breeding pig core group, and make a corresponding selection according to the genotype of the SNP site: For (I), select the breeding pig individuals with G / G or G / C genotype at position 18241434 on chromosome 11 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminate the breeding pig individuals with C / C genotype to increase the frequency of allele G at this site generation by generation; For (II), select the breeding pig individuals with A / A or G / A genotype at position 4304074 on chromosome 11 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminate the breeding pig individuals with G / G genotype to increase the frequency of allele A at this site generation by generation; For (III), select the breeding pig individuals with T / T genotype at position 6430126 on chromosome 1 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminate the breeding pig individuals with A / A or T / A genotype to increase the frequency of allele T at this site generation by generation; For (IV), select the breeding pig individuals with A / A genotype at position 15358300 on chromosome 11 in the International Pig Genome 11.1 version from the breeding pig core group, and eliminate the breeding pig individuals with AAT / AAT or A / AAT genotype to increase the frequency of allele A at this site generation by generation; For (V), selecting the boar individual with C / T genotype at position 1350502 on chromosome 9 of the international pig genome version 11.1 from the boar core group, and eliminating the boar individual with C / C genotype to increase the frequency of allele T at this site generation by generation; For (I) and (II), the pig is a Duroc pig of American line; For (III) and (IV), the pig is a Landrace pig of American line; For (V), the pig is a Large White pig of American line.

6. A method of identifying pigs or pork for myo-inositol content, characterized by Comprising the following steps: determining the genotype of the SNP site of the pig or pork as claimed in claim 1 or 2, and determining the inosine content of the pig according to the genotype of the SNP site, wherein: For (I), the inosine content of the pig is ranked from low to high according to the genotype at position 18241434 on chromosome 11 of the international pig genome version 11.1, in the order of G / G genotype, G / C genotype and C / C genotype; For (II), the inosine content of the pig is ranked from low to high according to the genotype at position 4304074 on chromosome 11 of the international pig genome version 11.1, in the order of A / A genotype, G / A genotype and G / G genotype; For (III), the inosine content of the pig is ranked from low to high according to the genotype at position 6430126 on chromosome 1 of the international pig genome version 11.1, in the order of T / T genotype, T / A genotype and A / A genotype; For (IV), the inosine content of the pig is ranked from low to high according to the genotype at position 15358300 on chromosome 11 of the international pig genome version 11.1, in the order of A / A genotype, A / AAT genotype and AAT / AAT genotype; For (V), the inosine content of the pig is ranked from low to high according to the genotype at position 1350502 on chromosome 9 of the international pig genome version 11.1, in the order of C / T genotype, C / C genotype; For (I) and (II), the pig is a Duroc pig of American line; For (III) and (IV), the pig is a Landrace pig of American line; For (V), the pig is a Large White pig of American line.

Images