Molecular markers for identifying Dalbergia odorifera and their applications

By using high-throughput sequencing technology to screen out DNA fragments unique to Dalbergia odorifera as molecular markers, and combining them with Geneious software for comparison, the problems of low detection throughput, high cost and difficulty in identification of Dalbergia odorifera in existing technologies have been solved, achieving efficient and accurate identification results.

CN120818630BActive Publication Date: 2026-03-06RES INST OF TROPICAL FORESTRY CHINESE ACAD OF FORESTRY +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-03
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

Existing methods for identifying Dalbergia odorifera suffer from problems such as low throughput, high cost, susceptibility to false positives or false negatives, difficulty in large-scale testing, and poor performance in mixed sample testing, especially in the seedling stage where it is difficult to distinguish from other species of the same genus.

Method used

High-throughput sequencing technology was used to screen out two DNA fragments unique to Dalbergia odorifera as molecular markers. Accurate identification was achieved by comparing sequencing reads. A reliable identification method was designed, and Geneious software was used to compare and determine whether the sample was Dalbergia odorifera.

Benefits of technology

It achieves high-throughput, low-cost, and accurate identification of Dalbergia odorifera, can process a large number of samples, avoids the difficulties of primer design, and is suitable for the detection of mixed samples and low-content samples, thus improving identification efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120818630B_ABST
    Figure CN120818630B_ABST
Patent Text Reader

Abstract

This invention discloses a molecular marker for identifying Dalbergia odorifera, which consists of two unique DNA sequences. The invention also provides a method for identifying Dalbergia odorifera using this molecular marker. The specific steps are as follows: total DNA is extracted from the sample to be tested, followed by high-throughput sequencing. The obtained sequencing reads are compared with the molecular marker. If the sequencing reads can completely cover the molecular marker, the species to which the sample belongs can be determined to be Dalbergia odorifera.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and more specifically, relates to a molecular marker related to Dalbergia odorifera and the application of this molecular marker. Background Technology

[0002] Dalbergia odorifera, commonly known as Hainan rosewood, is extremely similar to its genus counterpart, Dalbergia tonkinensis, in morphological characteristics such as flowers, fruits, and leaves. Some scholars have even proposed merging these two species. Furthermore, their wood color, structure, density, and internal composition are also highly similar, making accurate differentiation using traditional wood identification techniques extremely difficult. Moreover, Dalbergia odorifera presents challenges in distinguishing itself from other species in the same genus during its seedling stage.

[0003] Currently, the main methods used to identify Dalbergia odorifera include PCR electrophoresis and first-generation sequencing. PCR electrophoresis amplifies specific DNA fragments and then uses electrophoresis to separate them, thus identifying the species. However, this technique has several limitations. For example, it requires very precise primer design; improper primer design can easily lead to false positives or false negatives. Furthermore, PCR electrophoresis has a low throughput, allowing only a limited number of samples to be tested per experiment, making it unsuitable for large-scale sample testing. First-generation sequencing primarily targets specific gene regions for sequencing analysis. While it can provide more accurate identification information to some extent, it also faces the problems of low throughput and high cost. The first-generation sequencing process is relatively cumbersome, requiring significant investment of manpower, resources, and time, and its effectiveness is poor for mixed or low-content samples, easily leading to missed detections.

[0004] With the continuous development of science and technology, high-throughput sequencing technology has gradually emerged. High-throughput sequencing has significant advantages such as high detection throughput, fast sequencing speed, and relatively low cost. It can sequence a large number of DNA fragments at once, greatly improving detection efficiency and processing hundreds or thousands of samples simultaneously, fully meeting the needs of large-scale sample testing. In addition, high-throughput sequencing has low requirements for the initial sample volume; even trace amounts of DNA can be effectively sequenced, which is of great significance for testing rare species or in scenarios with limited sample sizes.

[0005] Given the numerous shortcomings of existing methods for identifying Dalbergia odorifera, this invention aims to solve the technical challenge of accurately, efficiently, and cost-effectively identifying this species. By screening for unique molecular markers from the Dalbergia odorifera genome and using high-throughput sequencing technology to compare sequencing reads with these markers, this method achieves accurate identification where only Dalbergia odorifera can be successfully identified, while other Dalbergia species cannot. The successful development of this technology will provide a novel and reliable method for identifying Dalbergia odorifera, effectively resolving the problem of confusion between Dalbergia odorifera and other similar species in the market, protecting consumers' legitimate rights and interests, maintaining the normal order of the rosewood market, and also having significant practical implications for the protection of this rare species. Summary of the Invention

[0006] To overcome the difficulties in existing Dalbergia odorifera identification techniques, this invention employs next-generation sequencing to obtain two specific DNA fragments of Dalbergia odorifera. Analysis revealed that these two DNA fragments do not exhibit high homology with any currently known genome, making them highly suitable as reference sequences for identifying Dalbergia odorifera. Based on this, this invention also utilizes sequencing data to design a reliable method for identifying Dalbergia odorifera. The technical solution adopted in this invention is as follows:

[0007] On the one hand, the present invention provides a molecular marker for identifying or assisting in the identification of Dalbergia odorifera, the nucleic acid sequence of which is shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0008] On the other hand, another object of the present invention is to provide the application of the above-mentioned molecular markers in the identification or auxiliary identification process of Dalbergia odorifera.

[0009] On the other hand, the present invention provides a method for identifying or assisting in the identification of Dalbergia odorifera, characterized in that the method includes the following steps: 1) collecting tissue to be tested as a sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) assembling the sequencing data and comparing the assembled contigs with the aforementioned molecular markers; 5) determining whether the sample to be tested is Dalbergia odorifera based on the comparison results; if the assembled contigs contain a contig consistent with the sequence of the molecular markers, then the species of the sample to be tested is determined to be Dalbergia odorifera.

[0010] On the other hand, the present invention provides a method for identifying or assisting in the identification of Dalbergia odorifera, characterized in that the method includes the following steps: 1) collecting tissue to be tested as a sample to be tested; 2) extracting total DNA from the sample to be tested; 3) performing second-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads; 4) using Geneious software, according to the default parameters of the software, comparing the above sequencing reads with the DNA molecular markers described in this application; 5) determining whether the sample to be tested contains Dalbergia odorifera based on the coverage of the sequencing reads on the DNA molecular markers; if the sequencing reads can completely cover the molecular markers and can generate a consistent sequence that is completely consistent with the DNA molecular markers, then it is determined that the species of the sample to be tested contains Dalbergia odorifera.

[0011] In one embodiment, step 4) involves mixing and grouping sequencing reads from multiple samples.

[0012] In one embodiment, if the sequencing reads of multiple samples are mixed and grouped in step 4) above, the method further includes step 6): further dividing the samples containing Dalbergia odorifera into two groups, mixing the sequencing reads of the two groups of samples respectively, and repeating the operation of step 5) above until a sample containing only Dalbergia odorifera is identified.

[0013] In one embodiment, the high-throughput sequencing described in step 2) is second-generation sequencing or third-generation sequencing.

[0014] In one embodiment, step 3) uses any one of the following software versions: Geneious, Bowtie, Tophat, or HISAT to perform read comparison.

[0015] In one embodiment, SEQ ID NO:1 or SEQ ID NO:2 can be used alone for the identification of Dalbergia odorifera.

[0016] In one embodiment, SEQ ID NO:1 and SEQ ID NO:2 can be used together for the identification of Dalbergia odorifera.

[0017] This invention offers the following advantages: First, it is the first to obtain and disclose two unique fragments from the Dalbergia odorifera genome. Analysis and verification have shown that these two fragments do not exhibit high homology with any other existing genomes, making them highly suitable as reference sequences for identifying Dalbergia odorifera. Second, this invention enables the identification of mixed samples. For example, tissue samples can be directly collected and total DNA extracted. High-throughput sequencing is used to obtain the sample's DNA information, which is then compared with the reference sequence to determine whether the sample contains Dalbergia odorifera. Third, the direct use of high-throughput sequencing technology enables high-throughput detection without the need for primer design, avoiding potential difficulties in primer design, simplifying the operation, and providing high detection sensitivity. Fourth, this invention also provides two specific molecular markers that can be used individually or in combination. Combined use further improves the accuracy of Dalbergia odorifera identification. Attached Figure Description

[0018] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0019] Figure 1 The comparison results of the molecular marker SEQ ID NO.1 of Dalbergia odorifera in the NCBI nr / nt database.

[0020] Figure 2 The comparison results of the molecular marker SEQ ID NO.2 of Dalbergia odorifera in the NCBI nr / nt database.

[0021] Figure 3 The results are the alignment of sequencing reads containing sample 1 in Table 1 with the molecular marker SEQ ID NO.1 of Dalbergia odorifera.

[0022] Figure 4 The results are the alignment of sequencing reads containing sample No. 2 in Table 1 with the molecular marker SEQ ID NO. 1 of Dalbergia odorifera.

[0023] Figure 5 The results are the alignment of sequencing reads containing sample No. 3 in Table 1 with the molecular marker SEQ ID NO. 1 of Dalbergia odorifera.

[0024] Figure 6 The results are the alignment of sequencing reads containing sample 1 in Table 1 with the molecular marker SEQ ID NO. 2 of Dalbergia odorifera.

[0025] Figure 7 The results are the alignment of sequencing reads containing sample No. 2 in Table 1 with the molecular marker SEQ ID NO. 2 of Dalbergia odorifera.

[0026] Figure 8 The results are the alignment of sequencing reads containing sample No. 3 in Table 1 with the molecular marker SEQ ID NO. 2 of Dalbergia odorifera.

[0027] Figure 9 The results are obtained by comparing the sequencing reads of samples that do not contain Dalbergia odorifera with the molecular marker SEQ ID NO.1 of Dalbergia odorifera.

[0028] Figure 10 The results are obtained by comparing the sequencing reads of samples that do not contain Dalbergia odorifera with the molecular marker SEQ ID NO.2 of Dalbergia odorifera. Detailed Implementation

[0029] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be noted that the embodiments described in this specification are only for explaining the invention and are not intended to limit the invention. Parameters, proportions, etc., in the embodiments can be adjusted according to actual circumstances without substantially affecting the final result.

[0030] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0031] Example 1: Molecular markers of Dalbergia odorifera

[0032] This invention uses sequencing assembly and comparative analysis to determine the standard molecular marker detection sequence for the identification of Dalbergia odorifera, and the specific sequence is as follows: SEQ ID NO.1:5’-CTGGTGCGAGGAAGAAAGGGGAACCGGCGCGGTGGTTTGGGTGTCGGCGGCGGAGGTCTGGGTCGCGCGGAGAGAGGAGGTGATGGTGGTGGTTGACTTCTCACGGTTACGCGACTGCGAGGTGGGGTGGAGGTCAAGGCGGTTGTGATTGGCGGCGGATGAGTGTTTTCAGGTGGGGGTAGTGTAGTGGCGCGACTTGGCTATGGATGGCTGGAGTGGCGCGTTGCTGTTGAGGTTCCTGGCTGTAGCCGGCGGCGATTGGCGGTCCGATTCGCGATGGGTCACGGCTGGCTGCTAGCGCTGCTCCAAGCACGGCTCCGCAGTGGTTTTCGGAGGGGAAAGCTGCGGATTTGTAAACAGCGAAGAGGGGCATGGACCTGGACAGCAGAAAGGGAGGCTGAGCTTGTGGCGGTGCGGCTGTGGGGGGTGTGGATCGCAAGCACAGGGGCGGCGCGATTGGGGGCTGGTCACGAGGTGGATGTCCGCGGTGGTTTGAAGGAGCACGGGCGCACGAAGGGGAGTCCAGGGGCGGAGGTCTGGTGCTTTGAGGTTGCTGCTTCCTTTTTTATTTTTGTCTTTAAATTCTGGTTGGTTATAAGGTTTTGGTTGTGGCTTCCATTCATGCTCTATTTGAAATTGTTCATGGGTTTGAGAGTACTGAGTGGTTGATATTGATTGTATTTTTCCAGGTGATGATGGTGTGCTGATTGTGGTTTGAATGGTGATTCTAATGGTTGGTGATGGGATGGTGATGGAGGAAGTTCTTGGTTAGTTTAGGATGATGGTGGAGGAGAATGATTTTGGTGGTGATGATGAGTTGAACCCAGAACTCCCTGGGCCGTGAAGATGGTTTTTTTGAACCCAGAACCCCCCTTCTCTGTGATGGTTCCTTTCTCTATTTGTATTGCCTTTGATCTTTGTAATTTGCATTTGTTCCCATGCTGTCTGCAACC -3’(SEQ ID NO:1);SEQ ID NO.2:5'-GTTCGAGCACCAGAACCACTTGCCCAGCTGTCGCGTTGAAGCTCCAGCGAACCAGCCAGTGCTGATCTCCAGTCGTGCGCATCTCTGCACAGCAGCAGCTCCACCTCACCGGAAAACCAGTCTCTATGCCCCACGAAAACAGCAGCAACAGTTCCACTAAGCATCGCTGCTAAAACTGGATCTGAAAAATCCAAGTTTGGAGCTCAACCAAGCC ATGTAAATTGTTCAGCCACACAGCACTTTGCTCACGCCCTCATCACAGAGACCAACATCCTCAAATCACCGCCCAAATCACTGCCTGGTTCTTCCCTTTTGTGCGTGTACCATTCCTCCTTATAGCCACTGTGAAATCAACCTTACCATTTGCTGGAAAGCATCGCCAGGAACATAGCAATCTCCAGCCACGGTTCTTTCCTTTTCCTTCTTCTCCGT -3'(SEQ ID NO:2);.

[0033] The molecular markers described in this invention were submitted to the NCBI database for online BLAST alignment. The nr / nt database was selected, without species restrictions, and the "More dissimilar sequences" parameter was chosen. (See Figure 1). Figure 2 As shown, the alignment results indicate that the molecular marker described in this invention does not currently have homologous sequences in the NCBI nr / nt database.

[0034] Example 2: Identification Method of Dalbergia odorifera

[0035] 1) Collect the tissue to be tested as the test sample;

[0036] 2) Extract total DNA from the sample to be tested; 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads (sequencing depth > 30×);

[0037] 4) Assemble the sequencing data and align the assembled contigs with the aforementioned molecular markers;

[0038] 5) Determine whether the sample to be tested is Dalbergia odorifera based on the comparison results; if the assembled contigs contain a contig that is consistent with the molecular marker sequence, then the species of the sample to be tested is Dalbergia odorifera; otherwise, the species of the sample to be tested is not Dalbergia odorifera.

[0039] The test results are shown in the table below:

[0040] Table 1 Sample test results

[0041]

[0042] As can be seen from the data in Table 1 above, the molecular marker sequence mentioned in this application was present in samples numbered 1 to 3, while the molecular marker sequence was not detected in samples of other Dalbergia species. This indicates that the method provided by this invention can accurately identify Dalbergia odorifera.

[0043] Example 3: Method Two for Identifying Dalbergia odorifera

[0044] 1) Collect tissue to be tested as the test sample; 2) Extract total DNA from the test sample; 3) Perform next-generation high-throughput sequencing on the total DNA of the above samples to obtain sequencing reads (sequencing depth > 30×); 4) Use Geneious software, according to the default parameters of the software, to compare the above sequencing reads with the DNA molecular markers described in this application; 5) Determine whether the test sample contains Dalbergia odorifera based on the coverage of the sequencing reads on the DNA molecular markers; if the sequencing reads can completely cover the molecular markers and can generate sequences that are completely consistent with the DNA molecular markers, then it is determined that the species of the test sample contains Dalbergia odorifera; 6) If the sequencing reads of multiple samples were mixed and grouped in step 4) above, then the method further includes step 6): further divide the samples containing Dalbergia odorifera into two groups, mix the sequencing reads of the two groups of samples respectively, and repeat the operation of step 5) above until a sample containing only Dalbergia odorifera is identified.

[0045] The detection results are shown in Figures 3-8. The samples corresponding to Figures 3-8 are all samples containing Dalbergia odorifera. It can be observed from the figures that the sequencing reads completely cover the reference sequences (i.e., the molecular markers SEQ ID NO. 1 and SEQ ID NO. 2 described in this application), and generate identical sequences completely consistent with the molecular marker sequences. For samples numbered 4-33 in Table 1, the sequencing reads could not be effectively compared with SEQ ID NO. 1-SEQ ID NO. 2. Figures 9-10 (Red represents A bases, green represents T bases, blue represents C bases, and yellow represents G bases), which further demonstrates that the method provided by this invention can accurately identify Dalbergia odorifera.

[0046] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to the above embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A molecular marker for identifying or assisting in identifying Dalbergia odorifera T. Chen, characterized in that, The molecular marker is SEQ ID NO. 1 and SEQ ID NO.

2.

2. A method for identifying or aiding in the identification of Dalbergia odorifera T. Chen, characterized in that, The method comprises the following steps: 1) selecting the tissue to be detected as a sample to be detected; 2) extracting total DNA from the sample to be detected; 3) performing high-throughput sequencing on the total DNA extracted to obtain sequencing reads; 4) performing assembly processing on the sequencing data, and aligning the contigs formed by assembly with the molecular marker of claim 1; 5) judging whether the sample to be detected is Dalbergia odorifera based on the alignment result; if the contigs obtained by assembly contain contigs completely consistent with the molecular marker sequences SEQ ID NO. 1 and SEQ ID NO. 2, it is determined that the species of the sample to be detected is Dalbergia odorifera.

3. The method for identifying or aiding in identifying Dalbergia odorifera as claimed in claim 2, wherein, The high-throughput sequencing mentioned in step 3) is second-generation sequencing or third-generation sequencing.

4. A method for identifying or aiding in the identification of Dalbergia odorifera T. Chen, characterized in that, The method comprises the following steps: 1) collecting the tissue to be detected as a sample to be detected; 2) extracting total DNA from the sample to be detected; 3) performing second-generation high-throughput sequencing on the total DNA of the sample, respectively, to obtain sequencing reads; 4) aligning the obtained sequencing reads with the molecular marker SEQ ID NO. 1 and SEQ ID NO. 2 of claim 1; 5) judging whether Dalbergia odorifera is contained in the sample to be detected according to the coverage of the sequencing reads on the molecular marker; if the sequencing reads can completely cover the molecular marker and generate a consistent sequence completely consistent with the molecular marker, it is determined that the species of the sample to be detected contains Dalbergia odorifera.

5. The method for identifying or aiding in identifying Dalbergia odorifera as claimed in claim 4, wherein, In step 4), any version of software in Geneious, Minimap, Bowtie, Tophat or HISAT is used for reads alignment.

6. The use of the molecular marker of claim 1 in identifying or assisting in identifying Dalbergia odorifera.

Citation Information

Patent Citations

  • Molecular identification method for dalbergia odorifera chen in rosewood, and primer and probe of molecular identification method

    CN105087798A

  • Molecular identification method and identification primer for Dalbergia odorifera T. Chen and Dalbergia rimosa Roxb.

    CN105695610A