Castration T4 virus-like particle subunit vaccine and preparation method thereof

Abstract

The invention relates to the technical field of biology, in particular to a castrated T4 virus-like particle subunit vaccine and a preparation method thereof. The invention provides a GnRH-I-T4 virus-like particle which is high in purity and good in specificity. The vaccine prepared from the GnRH-I-T4 virus-like particles is high in antigen purity, good in safety and good in castration effect.

Description

Castration-resistant T4 virus-like particle subunit vaccine and preparation method thereof

[0001] This application claims priority to the Chinese patent application filed with the China Patent Office on March 21, 2023, with application number 202310317333.6 and invention name “GnRH-VLP recombinant castration vaccine and its preparation method”, the entire contents of which are incorporated by reference into this application. Technical Field

[0002] The present invention relates to the field of biotechnology, in particular to a castrated T4 virus-like particle subunit vaccine and a preparation method thereof. Background Art

[0003] Castration is the indirect removal of an animal's reproductive system or the resulting loss of sexual function. This includes the removal of the testes in males and the ovaries in females, collectively known as gonadectomy. In addition to surgical removal of the gonads, local radiation exposure and chemical treatment can also be used for castration. Castration deprives vertebrates of their source of sex hormones, which can sometimes lead to the degeneration of genital appendages and secondary and tertiary sexual characteristics.

[0004] Gonadotropin-releasing hormone (GnRH) is an endogenous polypeptide hormone in animals. Physiological doses of GnRH-I can elevate gonadotropin concentrations (e.g., a mild increase in FSH and a significant increase in LH), promoting the synthesis and secretion of gonadal hormones (e.g., estradiol, progesterone, and testosterone), promoting follicular maturation and ovulation, testicular development and sperm maturation, and the development and maintenance of secondary sexual characteristics. Furthermore, GnRH-I can directly affect the gonads, regulating the synthesis and secretion of gonadal steroid hormones and promoting gamete formation.

[0005] Self-antigen proteins are often difficult to elicit antibody responses against. One approach to improving vaccination efficacy is to increase the reproducibility of the applied antigens. Unlike isolated proteins, viruses can induce rapid and potent immune responses, both with and without T cell help, without any adjuvants. Compared to a few proteins, they can trigger immune responses far more robust than their isolated components. With respect to B cell responses, it is well known that a key factor in viral immunogenicity is the reproducibility and order of surface epitopes. Many viruses exhibit quasi-crystalline surfaces with regularly arranged epitopes that efficiently crosslink epitope-specific immunoglobulins on B cells. This crosslinking of B cell surface immunoglobulins is a strong activation signal, directly inducing cell cycle progression and IgM antibody production. Furthermore, this triggered B cell activation can activate T helper cells, in turn inducing the conversion of IgM to IgG antibodies in B cells and the generation of long-lived B cell memory targets for any vaccination. Viral structure has even been implicated in the production of anti-antibodies in autoimmune diseases and is part of the natural response to pathogens. Therefore, antigens presented on highly organized viral surfaces can induce strong antibody responses against these antigens.

[0006] Virus-like particles (VLPs) are the major capsid proteins of RNA bacteriophages. They self-assemble from multiple monomers into a new class of highly immunogenic virus-like particles (VLPs). These VLPs do not contain the phage RNA genome and are therefore unable to replicate. However, studies have shown that various polypeptides can be fused to the N- or C-terminus of VLP proteins, and the resulting fusion proteins form VLPs when expressed in a host, typically and preferably in Escherichia coli. Furthermore, it has been found that if the polypeptide contains at least one antigen, and the antigen or at least one antigenic site of the antigen is displayed on the outer surface of the assembled VLP, the assembled VLP can effectively enhance the immunogenicity of the target antigen. In addition to the already reported VLPs AP205 and Qβ, there are also a variety of VLP platforms, such as CuMV and tobacco mosaic virus VLPs, all of which have the potential to be developed into castration vaccines.

[0007] The T4 phage is a virulent bacteriophage of Escherichia coli, primarily composed of a head, a tail, and tail fibers. A VLP vaccine platform has been established based on its head structure. Foreign proteins can be displayed on the T4 phage capsid surface by fusing with two non-essential proteins, Hoc and Soc, within the head, to form virus-like particles. This in vitro assembly method allows for functional and conformational analysis of recombinant proteins prior to display, ensuring that the displayed antigenic protein retains its native structure and function, thereby inducing functional antibodies. T4 phage in vitro assembly technology has been applied to the development of vaccines for a variety of infectious diseases, such as infectious bursal disease virus, HIV, and foot-and-mouth disease (Cao et al. 2005; Ren et al. 2008; Tao et al. 2013a). However, there are no reports on how to construct a GnRH castration vaccine using T4 phage.

[0008] Summary of the Invention

[0009] In view of this, the technical problem to be solved by the present invention is to provide a castrated T4 virus-like particle subunit vaccine and a preparation method thereof, which is easy to obtain through bacterial culture, has a high expression yield, is convenient for industrial production, has strong immunogenicity and a fast immune response.

[0010] The present invention provides a GnRH-VLP recombinant protein, which comprises GnRH and T4 phage virus-like particle protein.

[0011] The GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0012] The T4 phage virus-like particle protein is the Soc protein of T4 phage, which has the amino acid sequence shown in SEQ ID NO: 5, or a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in SEQ ID NO: 5; or a sequence with more than 90% homology to the amino acid sequence shown in SEQ ID NO: 5.

[0013] In some embodiments, the C-terminus of GnRH in the GnRH-VLP recombinant protein provided by the present invention is connected in series with the N-terminus of the Soc protein of T4 phage.

[0014] The present invention also provides:

[0015] 1), a nucleic acid encoding the GnRH-VLP recombinant protein;

[0016] II), an expression unit containing a nucleic acid encoding GnRH-VLP;

[0017] III), a recombinant vector containing a nucleic acid encoding GnRH-VLP or an expression unit as described above;

[0018] IV), transforming or transfecting host cells with an expression vector for GnRH-VLP;

[0019] V) The culture product of the host cells as described above.

[0020] The nucleic acid can be DNA, RNA, cDNA or PNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The nucleic acid can include nucleotide sequences with different functions, such as coding regions and non-coding regions such as regulatory sequences (such as promoters or transcription terminators). The nucleic acid can be linear or circular in topology. The nucleic acid can be, for example, a part of a vector (such as an expression or cloning vector), or a fragment. The nucleic acid can be obtained directly from a natural source, or can be prepared with the assistance of recombination, enzymatic methods or chemical techniques. The RNA form is mRNA obtained by gene transcription, etc. The gene sequence can use a wild-type sequence or can be codon-optimized, which is not limited by the present invention. The nucleic acids of the present invention encode GnRH-I and Soc respectively. The nucleic acid encoding Soc is a nucleic acid encoding the full length or partial fragment of Soc.

[0021] The expression unit provided by the present invention is an expression unit comprising GnRH-I-Soc. The expression unit comprises the nucleic acid of the present invention in a single or multiple tandem form with a promoter and a terminator, which is not limited in the present invention.

[0022] Furthermore, the recombinant expression vector herein refers to a nucleic acid vector, a recombinant DNA molecule comprising a desired coding sequence and appropriate nucleic acid sequences or elements necessary for expression of the operably linked coding gene in a specific host organism. Nucleic acid sequences or elements necessary for expression in bacteria include promoters, ribosome binding sites, and possibly other sequences. The recombinant expression vector is selected based on the host organism. The expression vector described in the present invention can be circular or linear, and this is not a limitation of the present invention. For example, a prokaryotic host can be Escherichia coli, Bacillus, Streptomyces, or cyanobacteria; its backbone vector can be a pET series plasmid, a pGEX series plasmid, a pKBP series plasmid, or a pcDNA series plasmid. For example, the recombinant backbone vector is a pET series vector, and optionally, the backbone vector of the recombinant vector is pET-21(+), pET-24(+), pET-23(+), or pET-28a(+).

[0023] The recombinant vector provided herein is constructed by cloning the aforementioned nucleic acid fragment encoding the fusion protein into the prokaryotic expression vector pET28a via homologous recombination. In some embodiments, the insertion site is between the NdeI site and the XhoI site. The present invention provides a recombinant vector for GnRH-I-Soc.

[0024] The host described in the present invention includes bacteria, fungi, viruses or animals. The bacteria include Gram-positive bacteria and Gram-negative bacteria; the Gram-positive bacteria include but are not limited to Escherichia coli. The fungi include molds, yeasts, and mushrooms; the yeasts include Saccharomyces cerevisiae, Saccharomyces cerevisiae, Pichia pastoris, and Candida. The viruses include but are not limited to adenoviruses, adeno-associated viruses, lentiviruses, and prions. The animals include humans, mice, rabbits, pigs, zebrafish, and the like. The expression of the nucleic acid encoding the recombinant protein in the host can be either integrated or episomal, and the present invention does not limit this. In the embodiment of the present invention, GnRH-I-Soc is expressed using Escherichia coli as the host. The Escherichia coli is Escherichia coli T7 shuffle.

[0025] Furthermore, the present invention also provides a culture product of the host cell.

[0026] The method for preparing the GnRH-I-Soc recombinant protein of the present invention comprises: culturing the host cell as described above to obtain a culture product containing the recombinant protein;

[0027] As described above, the method for preparing the fusion protein includes:

[0028] (1) Synthesize GnRH-I-Soc according to the GnRH-I-Soc gene sequence;

[0029] (2) expressing the GnRH-I-Soc sequence in Escherichia coli to obtain the fusion protein GnRH-I-Soc;

[0030] (3) The fusion protein was displayed on the surface of T4 phage by in vitro fusion to obtain GnRH-I-Soc VLP.

[0031] Furthermore, the fusion protein, the nucleic acid, the expression unit, the recombinant vector, the host cell, the culture product or the composition of the present invention is used in the preparation of a subunit vaccine.

[0032] The present invention also provides a vaccine containing GnRH-VLP. Specifically, the present invention provides a castration-enhanced T4 virus-like particle subunit vaccine, which includes the recombinant protein described above and a T4 phage displaying the recombinant protein. The vaccine is a castration vaccine for animals. The animal is male or female, and includes birds and / or mammals. For example, mice, rats, cats, dogs, horses, or animals of the same family and genus as the above animals. Preferably, the animal is a feline, canine, or rodent, such as a mouse.

[0033] The vaccine also includes an adjuvant. The adjuvant includes an aluminum salt adjuvant, a protein adjuvant, a nucleic acid adjuvant, a lipid-containing adjuvant, a mixed adjuvant or an aggregate structure adjuvant. In some embodiments of the present invention, the adjuvant is an aluminum hydroxide adjuvant. In the GnRH-VLP vaccine of the present invention, the adjuvant is not limited. In some embodiments, the GnRH-VLP vaccine is prepared using an aluminum adjuvant. The concentration of GnRH-VLP in the vaccine is 800, 400, 200, or 100 μg / mL, preferably, the concentration is 400 μg / mL.

[0034] Furthermore, the method for preparing the subunit vaccine comprises mixing the recombinant protein with an adjuvant; or mixing the composition with a buffer solution. Preferably, the volume ratio of the mixture is 1:1.

[0035] Immunizing animals with the vaccine of the present invention can achieve the effect of castration. Therefore, the present invention also provides the use of the above-mentioned vaccine in animal castration. Correspondingly, the present invention also provides a method for castrating animals, comprising administering the vaccine as described above. In the present invention, the castration includes increasing the level of GnRH antibodies, reducing the level of testosterone, reducing the volume and / or weight of the testicles, and preventing the animal from becoming pregnant. In the present invention, the method of administration includes injection. The dosage administered is 50 μg for mice and 200 μg for dogs or cats. 10 to 100 days after immunization, the testosterone level and testicular weight decrease.

[0036] In some tests, testosterone levels are reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, and more specifically 50% to 60%, 60% to 70%, 70% to 80%, or 80% to 90%. In a specific embodiment, testosterone levels are reduced to 3.85% of the original level.

[0037] In some tests, the weight of the mouse testicles was reduced to 50% to 90% of the original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the weight of the mouse testicles was reduced to 19.79% of the original level.

[0038] In some tests, the cat's testicular volume was reduced to 50% to 90% of its original level, specifically 50% to 70%, 60% to 80%, 70% to 90%, more specifically 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%. In a specific embodiment, the cat's testicular volume was reduced to 89.74% of its original level.

[0039] The beneficial effects of the present invention are as follows:

[0040] First, bacteriophage VLPs can mimic pathogenic viruses well to stimulate the immune system;

[0041] Second, antigens can be displayed at high density on T4 phage, overcoming the weak immunogenicity of the peptide itself, thereby effectively activating B cells and stimulating the body to produce higher levels of antibodies;

[0042] Third, T4 phage-based VLP vaccines can effectively enter the lymphatic system and be transported to lymph nodes, thereby inducing adaptive immune responses;

[0043] Fourth, T4 phage is easy to culture and purify, can be produced on a large scale, cost-effectively, and does not pose a safety risk. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for the embodiments or the description of the prior art. Obviously, the drawings described below are only exemplary. For those skilled in the art, other implementation drawings can be derived from the provided drawings without inventive effort:

[0045] FIG1 is a schematic diagram of a recombinant plasmid after the GnRH-I gene provided in an embodiment of the present invention is connected to the pETM41 plasmid;

[0046] FIG2 is a schematic diagram of SDS-PAGE of the GnRH-I-Soc protein provided in an embodiment of the present invention;

[0047] FIG3 shows the serum antibody titer of mice immunized with GnRH-I-T4 virus-like particles provided in an embodiment of the present invention;

[0048] Figure 4 shows the average testicular weight of mice;

[0049] Figure 5 Changes in testicular volume in male cats. DETAILED DESCRIPTION

[0050] To make the above-mentioned objects, features, and advantages of the present invention more readily apparent, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. The following description sets forth numerous specific details to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art may make similar modifications without departing from the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention pertains. The terms used herein in the specification of the present invention are for the purpose of describing specific embodiments only and are not intended to limit the present invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0052] The molecular biology experimental methods used in the examples of this invention, such as enzyme digestion and homologous recombination ligation, can be found in the second edition of Molecular Cloning. The basic materials for preparing the GnRH-I-T4 virus-like particles of this invention include: the nucleotide sequence of the T4 phage Soc protein, the nucleotide sequence of GnRH-I, the pET28a plasmid, the T7 shuffle Escherichia coli strain, the Tiangen Plasmid Miniprep Kit, LB medium, IPTG, kanamycin, a nickel column, and imidazole. The nucleotide sequence was sent to BGI for synthesis of the recombinant plasmid.

[0053] The method for preparing GnRH-I-T4 virus-like particles provided by the present invention comprises the following steps:

[0054] (1) The GnRH-I-Soc gene nucleotide sequence was sent to BGI to synthesize the GnRH-I-Soc-pET28a recombinant plasmid. The correctly sequenced recombinant plasmid was transformed into Escherichia coli T7 shuffle, and the GnRH-I-Soc protein was expressed and purified;

[0055] (2) The GnRH-I-Soc protein in the culture step (1) was mixed with Soc - T4 phage, and obtain GnRH-I-T4 virus-like particles.

[0056] The sequences involved in the present invention include:

[0057] The amino acid sequence of GnRH-I is: QHWSYGLRPG (SEQ ID NO: 1)

[0058] or EHWSYGLRPG (SEQ ID NO: 2)

[0059] The nucleic acid sequence encoding GnRH-1 is:

[0060] CAACACTGGAGCTACGGTTTGAGACCCGGT(SEQ ID NO.3)

[0061] or GAACACTGGAGCTACGGTTTGAGACCCGGT (SEQ ID NO. 4)

[0062] The amino acid sequence of the T4 phage Soc protein is:

[0063] The nucleic acid sequence encoding the T4 phage Soc protein is:

[0064] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0065] Example 1

[0066] Provided is a method for preparing a GnRH-I-Soc recombinant protein for preparing GnRH-I-T4 virus-like particles, comprising the following steps:

[0067] (1) Construction of recombinant plasmid: The GnRH-I gene (SEQ ID NO.3 and SEQ ID NO.4) and the Soc gene (non-essential external protein of the phage T4 capsid) were directly synthesized by BGI into the NdeI and XhoI restriction sites of the pET28a vector to obtain the recombinant plasmid GnRH-I. Q -Soc-pET28a and GnRH-I E -Soc-pET28a (Figure 1);

[0068] (2) Transform the recombinant plasmid into the expression strain: Q -Soc-pET28a and GnRH-I E -Soc-pET28a recombinant plasmid was transformed into Escherichia coli T7 shuffle expression strain to obtain GnRH-I Q -Soc-pET28a-T7 shuffle and GnRH-I E -Soc-pET28a-T7 shuffle recombinant expression strain;

[0069] (3) Bacterial culture and purification of GnRH-I-Soc recombinant protein: culture the GnRH-I Q -Soc-pET28a-T7 shuffle and GnRH-I E -Soc-pET28a-T7 shuffle recombinant expression strain, IPTG-induced expression of GnRH-I Q-Soc and GnRH-I Q -Soc recombinant protein.

[0070] The specific steps for expressing and purifying the GnRH-I-Soc recombinant protein are as follows:

[0071] (c1) Preparation of GnRH-I-Soc-pET28a recombinant plasmid

[0072] Use a pipette to inoculate 5 μl of the glycerol stock containing the plasmid into 5 mL of LB medium (containing 50 μg / mL kanamycin). Incubate at 37°C with shaking for 14-16 hours. After incubation, remove 1 mL of the culture medium for sequencing. Use a plasmid extraction kit to extract the plasmid from the remaining culture medium, and measure the nucleic acid concentration using a protein nucleic acid detector.

[0073] (c2) GnRH-I-Soc recombinant protein expression

[0074] Transform the T7 shuffle expression strain, shake the bacteria, concentrate by centrifugation, spread on kanamycin-resistant plates, culture at 37°C overnight, scrape the colonies, inoculate 10 mL of LB medium containing kanamycin, and shake at 37°C at 180 rpm until the bacterial solution OD 600 = about 0.8. Transfer it to 500 mL of LB medium containing ampicillin and shake at 37°C 180 rpm until the bacterial solution OD 600 = approximately 0.8. Add IPTG inducer to a final concentration of 0.8 mM and express overnight at 30°C. On the third day, harvest the cells by centrifugation at 4500 rpm for 15 minutes. Ultrasonicate the cells and collect the supernatant at 9500 rpm for 20 minutes at 4°C.

[0075] (c3) Purification of GnRH-I-Soc recombinant protein

[0076] The supernatant was centrifuged and purified by passing it through a nickel column. The column was equilibrated with PBS for 5 column volumes. Sample was loaded, washed with PBS for 5 column volumes, then washed with PBS containing 25 mM imidazole for 2 column volumes, and then washed again with PBS containing 25 mM imidazole for 5 column volumes. Elution was then performed with PBS containing 50, 100, 250, and 500 mM imidazole for 5 column volumes, and the flow-through was collected.

[0077] Aspirate 10 μL of each collected solution, add 10 μL of 2× protein electrophoresis loading buffer, and heat at 100°C for 4 minutes. Then, perform protein electrophoresis and stain to determine the concentration of the target band. Ultrafiltration of the target protein using a 30 kDa ultrafiltration tube is performed, followed by replacement with PBS. As shown in Figure 2, a target protein band is visible at approximately 11 kDa.

[0078] Example 2

[0079] Provided is a method for preparing GnRH-I-T4 virus-like particles, comprising the following steps:

[0080] (a) Take approximately 5×10 10 Soc - T4 phage particles were centrifuged at 20,000 g for 1 h at 4°C, washed twice with 1 mL of PBS, and centrifuged again;

[0081] (b) GnRH-I-Soc protein and Soc - T4 phage was mixed at a molar ratio of 5:1, made up to 200 μL with PBS, and incubated at 4°C for 1 h;

[0082] (c) Proteins not bound to the phages were removed by centrifugation at 20,000 g for 40 min. The T4 phages displaying the GnRH-I-Soc protein on their surfaces were washed twice with 1 mL of PBS and the GnRH-I-T4 phages were collected by centrifugation and used to prepare virus-like particle subunit vaccines.

[0083] Comparative Example

[0084] At the same time, GnRH-I-AP205 virus-like particles were prepared according to the same system as the GnRH-I-AP205 virus-like particle preparation method mentioned in patent CN112500456B for subsequent immune control experiments.

[0085] Example 3 GnRH-I-T4 virus-like particle subunit vaccine immunization method

[0086] GnRH-I prepared in Example 2 Q -T4 and GnRH-I E -T4 virus-like particles virus-like particles and aluminum hydroxide adjuvant were mixed in a volume ratio of 1:1 for immunization. On day 0, day 14, and day 28, 50 μg GnRH-I Q -T4 and GnRH-I E Eight-week-old male C57BL / 6 mice were immunized with the T4 virus-like particle vaccine (five mice per group). At the same time, the GnRH-I-AP205 virus-like particle and aluminum hydroxide adjuvant immunization groups, GnRH-I Q -T4 without adjuvant group, GnRH-I E The mice were divided into a T4-unadjuvanted group, an adjuvant-PBS-negative group, a T4-only experimental group, and a GnRH-I-only experimental group. Anti-GnRH-I recombinant protein antibody titers and testosterone levels were measured in these mice. On day 70 after immunization, the mice were sacrificed and testicular weights were measured.

[0087] Example 4 Determination of mouse anti-GnRH-I antibody titer

[0088] At various time points during the experiment, serum was collected from immunized and control mice. Anti-GnRH-I IgG antibody titers were determined by ELISA as follows. 96-well plates were coated with 2 μg / ml GnRH-I overnight at 4°C, with 100 μl per well added. The next day, the plates were washed five times with 1:1000 PBST and blocked with 300 μl of 2% BSA at 37°C for 2 h. The plates were then washed five times with 1:1000 PBST. Mouse serum was serially diluted with 2% BSA at a starting concentration of 1:500, followed by two-fold dilutions to 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, and 1:256000. 100 μl per well was added from the highest to the lowest dilutions, and the plates were incubated at room temperature with shaking for 45 min. Wash the plate five times with 1:1000 PBST. Use HRP-labeled goat anti-mouse polyclonal antibody as a secondary antibody at a dilution of 1:5000 in 2% skim milk powder, with 100 μl per well, and incubate at room temperature with shaking for 45 minutes. TMB color development takes 5–10 minutes, followed by addition of 2 M sulfuric acid to terminate the reaction, and the absorbance is read at 450 nm. Optical density (OD) at 450 nm is measured using an ELISA reader (BioRad Benchmark), and the maximum OD is calculated using these data. 450 Serum dilution.

[0089] FIG3 shows that, in the GnRH-I prepared in Example 2 Q -T4 and GnRH-I E In male mice immunized with -T4 virus-like particles without adjuvant, the average titer reached 16,000 on day 28, and remained at 32,000 after the third booster, and then dropped to 16,000 after 56 days. Q -T4 and GnRH-I E The average titer of the T4 virus-like particle adjuvant group reached 32,000 on day 28, and then remained at 128,000 after the third injection. Q and GnRH-I E The titer of the adjuvant-immunized group was only 8,000 at day 28, and no antibody titers were detected in the T4-mixed adjuvant and PBS-mixed adjuvant-immunized groups. Compared with the GnRH-I-T4 and GnRH-I + adjuvant groups, GnRH-I-T4 + adjuvant significantly increased GnRH-I antibody titers in mouse blood. Compared with the comparative example GnRH-I-AP205, the GnRH-I-T4 constructed in Example 2 stimulated an immune response more rapidly, making it more suitable for preparing a GnRH-I-T4 subunit vaccine.

[0090] Example 4 Determination of testosterone levels and testicular weight in mice

[0091] At various time points during the above experiments, serum was collected from immunized mice and control mice. Testosterone levels in mouse serum were determined using a testosterone-ELISA (IBL, Hamburg, Germany).

[0092] FIG. 4 shows the GnRH-I constructed using Example 2. Q -T4 and GnRH-I E In mice immunized with -T4 virus-like particles without aluminum hydroxide adjuvant, the average testosterone level was greatly suppressed (<2 ng / ml) on day 42 after immunization, and the level was still below 2 ng / ml on day 70. Q In mice immunized with GnRH-I supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to <2 ng / ml on the 28th day, and remained stable at around 0.223 ng / ml after 42 days, which was significantly lower than that of the control group GnRH-I at the same time. Q The average level of hormones in the central nervous system of mice immunized with aluminum hydroxide was about 24.4 times lower. E In mice immunized with GnRH-I supplemented with aluminum hydroxide adjuvant, the average testosterone level dropped to <2 ng / ml on the 28th day, and remained stable at around 0.22 ng / ml after 42 days, which was significantly lower than that of the control group GnRH-I at the same time. E The average level of hormones in the central nervous system of mice immunized with GnRH-I-AP205 virus-like particles + aluminum hydroxide adjuvant was about 25.1 times lower. However, the hormone levels in the central nervous system of mice immunized with GnRH-I-AP205 virus-like particles + aluminum hydroxide adjuvant were significantly lower than those in the GnRH-I-AP205 virus-like particles + aluminum hydroxide adjuvant group. E The average hormone level of the mice group immunized with aluminum hydroxide was about 21 times lower, which clearly proved that the GnRH-I-T4+adjuvant immunization group had a stronger inhibitory effect on mouse testosterone, among which GnRH-I E -T4+adjuvant had a more obvious inhibitory effect.

[0093] Mice were sacrificed on day 70, and the testicles were removed and weighed before being fixed in 4% formaldehyde.

[0094] Figure 5 shows that on day 70, GnRH-I Q and GnRH-I E The testicular weight of the immunized mice was not significantly reduced, while the testicular weight of the mice receiving the GnRH-I constructed in Example 2 was significantly reduced. Q The testicular weight of mice immunized with T4 virus-like particles and aluminum hydroxide adjuvant decreased by 80.21%, and those receiving GnRH-I EThe testicular weight of mice immunized with GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant decreased by 79.28%, while the testicular weight of mice immunized with GnRH-I-AP205 virus-like particles and aluminum hydroxide adjuvant decreased by 77.52%. This shows that the vaccine combined with GnRH-I-T4 and adjuvant has a more significant inhibitory effect on the testicles of mice, among which GnRH-I Q -T4+adjuvant has a stronger immunosuppressive effect.

[0095] Example 5: Testicular volume determination of experimental cats

[0096] Six healthy male rural cats aged 12 to 24 months were divided into two groups, with 3 cats in each group. One group was the injection group and the other was the control group. Q Immunization was performed with a mixture of -T4 virus-like particles and aluminum hydroxide adjuvant in a 1:1 volume ratio. 200 μg was injected subcutaneously behind the ear and neck. A second injection was given 28 days later at the same dose and route. A control group received no injection. All experimental animals were housed individually under the same conditions and observation.

[0097] After the first vaccination, measure the width and length of the testicles with a vernier caliper and a tape measure every 14 days, and calculate the testicular volume according to the following formula: Testicular volume = (width / 4) × (length / 2) × 4 / 3 × 3.14.

[0098] As shown in Figure 5, the testicular volume of the male cats in the injection group decreased, while the testicular volume of the male cats in the control group increased. This clearly shows that GnRH-I Q -The vaccine combining T4 and adjuvant has a significant inhibitory effect on the cat's testicles.

[0099] Example 6: Determination of pregnancy status of experimental cats

[0100] The injection group received a subcutaneous injection of 200 μg GnRH-I behind the ear and neck. Q -T4 + adjuvant, 28 days later, the second injection was administered by the same route, while the control group was not injected. All experimental cats were housed and observed under the same conditions, and all cats were housed individually.

[0101] Eight healthy male cats aged 12 to 24 months and 12 healthy female cats aged 12 to 14 months were cage-paired with the injected and control groups. Fourteen days after the second injection, three male cats from the injected and control groups were cage-paired with two healthy female cats, respectively; and four female cats from the injected and control groups were cage-paired with two healthy male cats, respectively. Male cats from each group were rotated to breed to minimize behavioral incompatibilities that could affect successful pairing.

[0102] After the cohabitation test begins, check whether the female cats in the experimental group and the male cats in the same cage are pregnant. After 30 days of observation, ultrasound is used to check for pregnancy.

[0103] As can be seen from Table 1, none of the female cats in the injection group and the paired female cats became pregnant, while the female cats in the control group and the paired female cats became pregnant, indicating that GnRH-I Q -T4+ adjuvant is very effective for castration of cats and is suitable for the development of castration vaccines.

[0104] Table 1 Pregnancy status of experimental animals

Claims

1. GnRH-VLP recombinant protein, characterized in that Including GnRH and T4 bacteriophage virus-like particle protein.

2. The recombinant protein according to claim 1, characterized in that The C-terminus of GnRH is tandemly linked to the N-terminus of the T4 bacteriophage virus-like particle protein; GnRH has an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2; The T4 bacteriophage virus-like particle protein is a Soc protein, which has an amino acid sequence as shown in SEQ ID NO:

5.

3. Biomaterial, characterized in that Include any of the following: 1), a nucleic acid encoding the recombinant protein according to claim 1 or 2; II), an expression unit containing the nucleic acid described in I); III), a recombinant vector containing the nucleic acid described in I) or the expression unit described in II); IV), a host cell transformed or transfected with the expression vector described in III); V) and IV) the culture products of the host cells.

4. The method for preparing the recombinant protein according to claim 1 or 2, characterized in that: The method comprises culturing the host cell described in claim 3 to obtain a culture product containing the recombinant protein described in claim 1; Or it comprises preparing GnRH-I protein and capsid protein of cowpea mosaic virus separately, and obtaining the recombinant protein of claim 1 or 2 through coupling.

5. Use of the recombinant protein according to claim 1 or 2, the biological material according to claim 3 or the product obtained by the preparation method according to claim 4 in the preparation of a subunit vaccine for animal castration.

6. A vaccine, characterized in that The invention comprises the recombinant protein according to claim 1 or 2 and an adjuvant.

7. The vaccine according to claim 6, characterized in that The adjuvant is aluminum hydroxide adjuvant.

8. The method for preparing the vaccine according to claim 6 or 7, characterized in that: The method comprises mixing the recombinant protein according to claim 1 or 2 with an adjuvant.

9. The preparation method according to claim 8, characterized in that: The volume ratio of the mixture is 1:

1.

10. A method for castration of an animal, characterized in that: Comprising administration of the vaccine of claim 6 or 7.

Images