Use of CREPT in treatment and / or diagnosis of acute myelogenous leukemia

Abstract

The present disclosure provides the use of CREPT in the treatment and / or diagnosis of acute myelogenous leukemia. The present disclosure provides uses of a reagent targeting a CREPT gene or an expression product thereof in preparation of drugs for prevention and / or treatment of acute myelogenous leukemia. The disclosure proves that a reagent targeting the CREPT gene or the expression product thereof can be used for preventing and / or treating the acute myelogenous leukemia, can improve the treatment effect of a drug for treating the acute myelogenous leukemia, and is combined with the drug for treating the acute myelogenous leukemia; meanwhile, a reagent for determining the expression level of the CREPT gene or the expression product of the CREPT gene can be used for diagnosing whether a subject suffers from acute myelogenous leukemia or not and judging the prognosis condition of the subject suffering from acute myelogenous leukemia.

Description

TECHNICAL FIELD

[0001] The present disclosure belongs to the field of biological medicine, and particularly relates to the use of CREPT in the treatment and / or diagnosis of acute myeloid leukemia. BACKGROUND

[0002] Acute myeloid leukemia (AML) is characterized by the abnormal clonal proliferation and cell infiltration of primitive immature cells in bone marrow, blood and other hematopoietic tissues, which can occur in all age groups, mainly in the elderly (over 60 years old). The clinical manifestations of acute myeloid leukemia are usually attributed to the rapid onset of bone marrow failure symptoms, and without medical intervention, it can be fatal within weeks or months. At present, the cure rate of acute myeloid leukemia patients under 60 years old is only 35-40%, and the cure rate of patients over 60 years old is only 5-15%.

[0003] The general treatment strategy for AML patients is mainly molecular strategies targeting gene mutations and rearrangements, including kinase inhibitors, cell pathway inhibitors and epigenetic modulators, etc. However, the effect of such cytotoxic therapy is closely related to the health status of the patient himself, such as the median survival time of elderly patients who cannot accept chemotherapy or cannot bear the side effects of chemotherapy is only 5 to 10 months. Since the late 1970s, several signal molecules and agents, including retinoic acid (RA), cyclic adenosine monophosphate (cAMP), sodium butyrate and cytokines, have been shown to induce terminal differentiation of acute myeloid leukemia, embryonal carcinoma or neuroblastoma in vitro. These observations have opened up the concept of differentiation therapy, i.e. the terminal differentiation of cancer cells may bring about ideal clinical benefits.

[0004] Although the method of AML differentiation therapy can achieve positive clinical response, due to the occurrence and development of acute myeloid leukemia involving complex signal pathways or mechanisms, it is still a scientific problem and clinical challenge to be solved urgently to research new differentiation therapy targets based on the molecular mechanism of its pathogenesis. Reference 1 (D Lu et al., CREPT accelerates tumorigenesis by regulating the transcription of cell-cycle related genes. Cancer Cell. 21:92-104, 2012) discloses that compared with paracancerous tissue, cell cycle-related and expression-elevated protein in tumor (CREPT) is highly expressed in various solid tumor tissues including lung cancer, breast cancer, prostate cancer, etc. And so far, there is no research report that the purpose of treating acute myeloid leukemia can be achieved by regulating CREPT. SUMMARY

[0005] Problems to be solved by the invention

[0006] The purpose of the present disclosure is to provide the use of CREPT in the prevention and / or treatment, diagnosis and / or prognosis of acute myeloid leukemia, and the enhancement of drug sensitivity, to provide a new strategy for the prevention, treatment, diagnosis, prognosis and drug resistance of acute myeloid leukemia.

[0007] Solution to the problem

[0008] In a first aspect of the present disclosure, the use of any of (i) to (v) below is provided:

[0009] (i) the use of an agent targeting a CREPT gene or its expression product in the preparation of a medicament for preventing and / or treating acute myeloid leukemia;

[0010] (ii) the use of an agent targeting a CREPT gene or its expression product in the preparation of an agent for improving the preventive and / or therapeutic effect of a medicament for preventing and / or treating acute myeloid leukemia;

[0011] (iii) the use of an agent targeting a CREPT gene or its expression product in combination with other agents for preventing and / or treating acute myeloid leukemia in the preparation of a medicament for preventing and / or treating acute myeloid leukemia;

[0012] (iv) the use of a CREPT gene or its expression product as a target in the preparation of a drug screening device, wherein the screening refers to screening a medicament for preventing and / or treating acute myeloid leukemia;

[0013] (v) use of the reagent for determining the expression level of the CREPT gene or its expression product in the preparation of a reagent / kit for diagnosing acute myeloid leukemia and / or for judging the prognosis of acute myeloid leukemia.

[0014] In some embodiments, the expression product of the CREPT gene is selected from the group consisting of: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof.

[0015] In some embodiments, the acute myeloid leukemia is acute myeloid leukemia in a subject; preferably, the subject comprises a mammal; more preferably, the subject is a human.

[0016] In some embodiments, the reagent targeting the CREPT gene or its expression product is selected from the group consisting of: nucleic acid, polypeptide, ribonucleoprotein complex, or small molecule drug; preferably, the polypeptide is selected from the group consisting of antibody or antigen-binding fragment thereof; preferably, the nucleic acid is selected from the group consisting of DNA, RNA, DNA / RNA;

[0017] Preferably, the ribonucleoprotein complex is selected from the group consisting of CRISPR / cas system; more preferably, the reagent targeting the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotide, siRNA, dsRNA, ribozyme, esiRNA, shRNA, CRISPR / cas system, small molecule drug; further preferably, the reagent targeting the CREPT gene or its expression product comprises shRNA, the sequence of which is shown in SEQ ID No: 1 or SEQ ID No: 2.

[0018] In some embodiments, the drug used for improving the preventive and / or therapeutic effect of the drug for preventing and / or treating acute myeloid leukemia and / or the drug for preventing and / or treating acute myeloid leukemia used in combination with the reagent targeting the CREPT gene or its expression product is selected from the group consisting of conventional chemotherapy drugs such as all-trans retinoic acid, cytarabine (Ara-C), venetoclax, decitabine, etc.; preferably, the improvement of the preventive and / or therapeutic effect of the drug for preventing and / or treating acute myeloid leukemia refers to the improvement of the sensitivity of the subject to the drug.

[0019] In some embodiments, the screening device comprises a detection reagent for determining the level or activity of the CREPT gene or its expression product, preferably selected from the group consisting of primer, probe, antibody or antigen-binding fragment thereof specific to the CREPT gene or its expression product.

[0020] In some embodiments, the expression level of the CREPT gene or its expression product is determined in a sample to be tested, which is from a subject; preferably, the sample to be tested comprises blood; more preferably, the sample to be tested comprises peripheral blood.

[0021] In some embodiments, when the expression level of the CREPT is determined at the gene level, the reagent for determining the expression level of the CREPT gene comprises one or more of primers and probes; or, when the expression level of the CREPT is determined at the protein level, the reagent for determining the expression level of the expression product of the CREPT gene comprises an antibody.

[0022] The second aspect of the present disclosure provides a reagent targeting the CREPT gene or its expression product, which is capable of modulating the level or activity of the CREPT gene or its expression product, wherein: the expression product of the CREPT gene is selected from the group consisting of: cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof; the reagent targeting the CREPT gene or its expression product is selected from the group consisting of: nucleic acid, polypeptide, ribonucleoprotein complex, or small molecule drug; preferably, the polypeptide is selected from the group consisting of antibody or antigen-binding fragment thereof; preferably, the nucleic acid is selected from the group consisting of DNA, RNA, DNA / RNA; preferably, the ribonucleoprotein complex is selected from the group consisting of CRISPR / cas system; more preferably, the reagent targeting the CREPT gene or its expression product is selected from the group consisting of: antisense oligonucleotide, siRNA, dsRNA, ribozyme, esiRNA, shRNA, CRISPR / cas system, small molecule drug; further preferably, the reagent targeting the CREPT gene or its expression product comprises shRNA, the sequence of which is shown in SEQ ID No: 1 or SEQ ID No: 2.

[0023] The third aspect of the present disclosure provides a pharmaceutical composition for preventing and / or treating acute myeloid leukemia, comprising: the reagent targeting the CREPT gene or its expression product according to the second aspect of the present disclosure; and, optionally, a pharmaceutically acceptable carrier.

[0024] The fourth aspect of the present disclosure provides a kit for diagnosing acute myeloid leukemia and / or judging the prognosis of acute myeloid leukemia, comprising a reagent for determining the expression level of the CREPT gene or its expression product.

[0025] The fifth aspect of the present disclosure provides a system for diagnosing acute myeloid leukemia and / or judging the prognosis of acute myeloid leukemia, wherein the system comprises a detection device, a computing device, and an output device.

[0026] The detection device includes an injector and a detector, wherein the injector is used to collect a sample from a subject, and the detector is used to detect the expression level of CREPT in the sample;

[0027] The computing device includes a memory and a processor, wherein the memory stores a computer program, and the processor is configured to execute the computer program stored in the memory to implement the following determination:

[0028] When diagnosing acute myeloid leukemia, if the expression level of the CREPT gene or its expression product in the sample is significantly higher than the expression level of the CREPT gene or its expression product in a sample from a subject not suffering from acute myeloid leukemia, the subject corresponding to the sample is determined to have acute myeloid leukemia;

[0029] When judging the prognosis of acute myeloid leukemia, when the expression level of the CREPT gene or its expression product in the sample is high, it is judged that the acute myeloid leukemia prognosis of the subject corresponding to the sample is poor; when the expression level of the CREPT gene or its expression product in the sample is low, it is judged that the acute myeloid leukemia prognosis of the subject corresponding to the sample is good; or,

[0030] The expression levels of the CREPTT gene or its expression product in samples collected from the same subject before and after treatment are compared to determine the prognosis of acute myeloid leukemia in the subject corresponding to the sample.

[0031] Effects of the invention

[0032] The present disclosure demonstrates that reagents targeting the CREPT gene or its expression products can be used to prevent and / or treat acute myeloid leukemia, and can improve the therapeutic effect of drugs for treating acute myeloid leukemia, and can be used in combination with drugs for treating acute myeloid leukemia; at the same time, reagents that determine the expression level of the CREPT gene or its expression products can be used to diagnose whether a subject has acute myeloid leukemia and to determine the prognosis of a subject with acute myeloid leukemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1A Comparison of Wright-Giemsa staining results of bone marrow smears and peripheral blood images from patients with acute myeloid leukemia and healthy donors.

[0034] Figure 1B Statistical results of CREPT protein expression levels in peripheral blood mononuclear cells of acute myeloid leukemia patients and healthy donors.

[0035] Figure 1CThe results of the expression levels of the CREPT protein in the peripheral blood mononuclear cells of the acute myeloid leukemia patients and healthy donors. The lanes of the healthy donors from left to right correspond to the healthy donor numbers 001-009 in Table 1; the lanes of the acute myeloid leukemia patients from left to right correspond to the acute myeloid leukemia patient numbers 010-023 in Table 1.

[0036] Figure 2A Comparison of the results of Wright-Giemsa staining of bone marrow smears of the same acute myeloid leukemia patient before initial treatment and after remission of treatment; Figure 2A Figure 4 shows the bone marrow smears of three representatives of the five AML patients in Example 2.

[0037] Figure 2B Statistical results of the expression levels of the CREPT protein in the peripheral blood mononuclear cells of the same acute myeloid leukemia patient before initial treatment and after remission of treatment.

[0038] Figure 2C The expression levels of the CREPT protein in the peripheral blood mononuclear cells of the same acute myeloid leukemia patient before initial treatment and after remission of treatment.

[0039] Figure 2D The relationship between the expression levels of CREPT and the overall survival of patients.

[0040] Figure 3A The effect of CREPT knockdown on the degree of differentiation of HL60 cells.

[0041] Figure 3B The effect of CREPT knockdown on the degree of differentiation of MOLM13 cells.

[0042] Figure 4A The effect of CREPT knockdown on the differentiation of HL60 cells induced by retinoic acid drugs.

[0043] Figure 4B Statistical results of the effect of CREPT knockdown on the differentiation of HL60 cells induced by retinoic acid drugs.

[0044] Figure 5A Analysis of the proportion of tumor cells in the peripheral blood of a human tumor cell xenograft mouse model.

[0045] Figure 5B Statistical results of the analysis of the proportion of tumor cells in the peripheral blood of a human tumor cell xenograft mouse model.

[0046] Figure 5C Results of the morphological analysis of the spleen of a human tumor cell xenograft mouse model.

[0047] Figure 5D Results of the histological analysis of the spleen of a human tumor cell xenograft mouse model. DETAILED DESCRIPTION

[0048] Hereinafter, the content of the present disclosure will be described in detail. The description of the technical features described below is based on representative embodiments, specific examples of the present disclosure, but the present disclosure is not limited to these embodiments, specific examples. Note that:

[0049] In the present specification, a numerical range indicated by "numerical value A to numerical value B" means a range including the end point numerical values A and B.

[0050] In the present specification, "substantially" or "essentially" means within 5%, preferably 3%, and more preferably 1% of the standard deviation from a theoretical model or theoretical data.

[0051] In the present specification, the meaning of "may" includes both the meaning of performing a certain process and the meaning of not performing a certain process.

[0052] In the present specification, "optional" or "optionally" means that the event or circumstance described next can or can not occur, and the description includes the case where the event occurs and the case where the event does not occur.

[0053] In the present specification, "some specific / preferred embodiments", "other specific / preferred embodiments", "embodiments", and the like refer to the specific elements (e.g., features, structures, properties, and / or characteristics) described in relation to the embodiments are included in at least one of the embodiments described herein, and can or can not be present in other embodiments. In addition, it should be understood that the described elements can be combined in various embodiments in any suitable manner.

[0054] The terms "comprising" and "having" and any variations thereof in the present disclosure are intended to cover non-exclusive inclusion. For example, a process, method, device, product, or apparatus including a series of steps is not limited to the listed steps or modules, but can optionally include steps not listed, or can optionally include other steps inherent to the process, method, product, or apparatus.

[0055] "Multiple" mentioned in the present disclosure means two or more. "And / or", which describes the association relationship of the associated objects, means that there can be three relationships, for example, A and / or B can mean: A exists alone, A and B exist together, and B exists alone. The character " / " generally means that the associated objects before and after are in an "or" relationship.

[0056] In the present specification, the term "tumor" or "cancer" refers to any medical condition characterized by neoplastic or malignant cell growth, proliferation, or metastasis, including solid cancers and non-solid cancers such as leukemia.

[0057] In the present specification, the term “subject” refers to a human (i.e., a male or female of any age, e.g., a pediatric subject (e.g., an infant, child, or adolescent) or an adult subject (e.g., a young adult, middle-aged adult, or elderly adult)) or a non-human animal. In certain embodiments, the non-human animal is a mammal (e.g., a primate (e.g., a cynomolgus monkey or a rhesus monkey), a commercially relevant mammal (e.g., a cow, pig, horse, sheep, goat, cat, or dog), or a bird. The non-human animal can be a male or female at any stage of development. The non-human animal can be a transgenic animal or a genetically engineered animal.

[0058] The term “administering” refers to implanting, absorbing, ingesting, injecting, inhaling, or otherwise introducing a drug or agent into or onto a subject.

[0059] In the present specification, the term “treating” refers to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease. In some embodiments, treatment can be administered after one or more signs or symptoms of the disease have developed or have been observed. In other embodiments, treatment can be administered in the absence of signs or symptoms of the disease. For example, treatment can be administered to a susceptible subject pre-symptomatically (e.g., pursuant to a documented history of symptoms). Treatment can also be continued after symptoms have resolved, for example, to delay and / or prevent recurrence of the disease or disorder.

[0060] In the present specification, the term “preventing” refers to prophylactic treatment of a subject who presently does not and has not in the past had a disease but who is at risk of developing the disease or who has in the past had the disease and who presently does not have the disease but is at risk for recurrence of the disease. In certain embodiments, the subject is at a higher risk of developing the disease or at a higher risk of recurrence of the disease than the average member of a population of subjects.

[0061] In the present specification, the term “diagnosing” includes detection or identification of a disease state or condition in a subject, determining the likelihood that a subject will develop a given disease or condition, determining the likelihood that a subject with a disease or condition will respond to treatment, determining the prognosis (or likely progression or regression) of a subject with a disease or condition, and determining the effect of treatment on a subject with a disease or condition.

[0062] In the present specification, the term "prognosis" refers to the prediction of the likelihood of benefit from treatment, such as cancer treatment. In some aspects, prognosis generally involves determining the prospect of recovery as predicted from the usual course or characteristics of the disease or case. In other aspects, prognosis includes both judging the specific consequences of a disease (such as recovery, certain symptoms, signs, complications) and providing a time line (such as predicting the likelihood of a certain outcome within a certain time period). When considered from the perspective of the course of disease evolution, prognosis includes, for example, remission rate, relapse rate, morbidity rate. When considered from the perspective of the ultimate state of the disease, prognosis includes, for example, cure rate, survival rate, mortality rate. When considered from the perspective of prognosis time, prognosis includes, for example, short-term mortality rate, long-term mortality rate (see Liu Zhenhua, ed. Tumor Prognosis).

[0063] In the present specification, the term "sample" refers to any substance that can contain a target molecule of interest for analysis, including biological samples. As used herein, a "biological sample" refers to any sample obtained from a living or viral (or prion) source or other macromolecular and biomolecular source, and includes any cell type or tissue of a subject from which nucleic acids, proteins, and / or other macromolecules can be obtained. A biological sample can be a sample obtained directly from a biological source or a sample that has been processed. For example, an isolated nucleic acid that has been amplified constitutes a biological sample. Biological samples include, but are not limited to, body fluids (e.g., blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, sweat, semen, fecal matter, sputum, tears, mucus, amniotic fluid, and the like), exudates, bone marrow samples, ascites, pelvic washings, pleural fluid, spinal fluid, lymphatic fluid, ocular fluid, extracts of nasal, throat, or genital swabs, cell suspensions of digested tissue, or extracts of fecal matter, as well as tissue and organ samples from humans, animals (e.g., non-human mammals), and plants, and processed samples derived therefrom.

[0064] In the present specification, "effective amount" refers to an amount that is sufficient to elicit a desired biological response. The effective amount can vary depending on such factors as the desired biological endpoint, pharmacokinetics, the condition being treated, the mode of administration, and the age and health of the subject. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is a prophylactically effective amount. In certain embodiments, the effective amount is the amount of a single dose. In certain embodiments, the effective amount is the combined amount of multiple doses.

[0065] In the present specification, "therapeutically effective amount" is an amount that is sufficient to provide a therapeutic benefit in the treatment of a disorder or to delay or minimize one or more symptoms associated with a disorder. A therapeutically effective amount refers to the amount of a therapeutic agent, alone or in combination with other therapies, that provides a therapeutic benefit in the treatment of a disorder. The term "therapeutically effective amount" can encompass an amount that improves overall therapy; e.g., reduces or avoids symptoms, signs, or causes of a disorder; and / or enhances the therapeutic efficacy of another therapeutic agent.

[0066] In the present specification, a "prophylactically effective amount" is an amount sufficient to prevent a disorder or one or more symptoms associated with a disorder or to prevent recurrence thereof. A prophylactically effective amount refers to an amount of a therapeutic agent, alone or in combination with other agents, which provides a prophylactic benefit in a disorder. The term "prophylactically effective amount" can include an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.

[0067] In the present specification, the term "gene" refers to a nucleic acid segment that provides a template for the production of a gene product. In certain embodiments, a gene segment includes regulatory sequences preceding and following a coding sequence.

[0068] In the present specification, the terms "nucleic acid" or "nucleic acid sequence," "nucleic acid molecule," "nucleic acid segment," or "polynucleotide" are used interchangeably. A polynucleotide molecule is a biopolymer composed of nucleotide monomers covalently bonded in a chain. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are examples of polynucleotides with different biological functions. DNA consists of two polynucleotide strands, each in a helix. In nature, RNA often occurs in single-stranded form, folded on itself. Exemplary types of RNA include double-stranded RNA (dsRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), messenger RNA (mRNA), antisense RNA, transfer RNA (tRNA), small nuclear RNA (snRNA), and ribosomal RNA (rRNA).

[0069] In the present specification, the terms "polypeptide," "peptide," and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer can be linear or branched, it can comprise modified amino acids, and it can be interrupted by non-amino acids. The term also encompasses an amino acid polymer that has been modified (e.g., by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0070] In the present specification, an "expression vector" refers to a vector that includes a recombinant polynucleotide that includes an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector includes the cis-acting components sufficient for use in expression; other components for expression can be provided by a host cell or in an in vitro expression system. Expression vectors include all of those well known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses into which a recombinant polynucleotide is introduced (e.g., lentivirus, retrovirus, adenovirus, and adeno-associated virus).

[0071] In the present specification, the term "pharmaceutically acceptable" (or "pharmacologically acceptable") refers to molecular entities and compositions that, where appropriate, are nontoxic to animals or humans at the dosages and concentrations employed, do not elicit adverse reactions, allergic reactions or other untoward effects. The term "pharmaceutically acceptable carrier" as used herein encompasses any and all solvents, dispersion media, coatings, antibacterial agents, isotonic and absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, and the like that can be used with a pharmaceutically acceptable substance as a medium.

[0072] The technical solutions of the present disclosure are described in detail as follows.

[0073] The present disclosure provides any one of the following (i) to (v) uses:

[0074] (i) use of an agent targeting a CREPT gene or an expression product thereof in the manufacture of a medicament for preventing and / or treating acute myeloid leukemia;

[0075] (ii) use of an agent targeting a CREPT gene or an expression product thereof in the manufacture of an agent for improving the preventive and / or therapeutic effect of a medicament for preventing and / or treating acute myeloid leukemia;

[0076] (iii) use of an agent targeting a CREPT gene or an expression product thereof in combination with another medicament for preventing and / or treating acute myeloid leukemia in the manufacture of a medicament for preventing and / or treating acute myeloid leukemia;

[0077] (iv) use of a CREPT gene or an expression product thereof as a target in the manufacture of a drug screening device, wherein the screening is for a medicament for preventing and / or treating acute myeloid leukemia;

[0078] (v) use of an agent for determining the expression level of a CREPT gene or an expression product thereof in the manufacture of an agent / kit for diagnosing acute myeloid leukemia and / or for judging the prognosis of acute myeloid leukemia.

[0079] In some embodiments, the expression product of a CREPT gene refers to various forms of molecules of the CREPT gene at various stages, such as, but not limited to, molecules produced during amplification, replication, transcription, splicing, processing, translation, modification, such as cDNA, mRNA, precursor protein, mature protein, and fragments thereof.

[0080] In some embodiments, the CREPT is the one disclosed in Reference 1, which is incorporated herein by reference in its entirety. In some specific embodiments, the sequence of the CREPT gene is recited in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), with the identification number: Gene ID: 58490. In some specific embodiments, the sequence of the expression product of the CREPT gene (e.g., the mature CREPT protein) is recited in the database NCBI (https: / / www.ncbi.nlm.nih.gov / ), with the identification number: NP_067038.1.

[0081] The present disclosure is not particularly limited to a subtype of acute myeloid leukemia (AML), and for example, can be acute myeloid leukemia of M0 to M7 type. Specifically, according to the French-American-British (FAB) classification of 1976, AML has 8 subtypes, which are referred to as M0 to M7, depending on the type of cells from which the leukemia develops (Bennett et al., 1976, “Proposals for the classification of the acute leukemias. French-American-British (FAB) co-operative group”. Br. J. Haematol., 33(4): 451-8).

[0082] <CREPT for preventing and / or treating acute myeloid leukemia>

[0083] According to some embodiments of the present disclosure, the use of the CREPT gene or its expression product as a preventive and / or therapeutic target is provided. Specifically, the use of the CREPT gene or its expression product in the preparation of a medicament for preventing and / or treating acute myeloid leukemia is provided. Specifically, the use of the CREPT gene or its expression product as a target in the preparation of a medicament for preventing and / or treating acute myeloid leukemia is provided.

[0084] According to some embodiments of the present disclosure, there are also provided uses of an agent targeting a CREPT gene or an expression product thereof in the manufacture of a medicament for preventing and / or treating acute myeloid leukemia. In some embodiments, the agent targeting a CREPT gene or an expression product thereof is capable of recognizing and binding to a CREPT gene or an expression product thereof. In some embodiments, the agent targeting a CREPT gene or an expression product thereof is capable of modulating the level or activity of a CREPT gene or an expression product thereof. In some specific embodiments, the agent targeting a CREPT gene or an expression product thereof is capable of reducing the level or activity of a CREPT gene or an expression product thereof. In some specific embodiments, the agent targeting a CREPT gene or an expression product thereof is capable of silencing a CREPT gene or an expression product thereof.

[0085] In some embodiments, the agent targeting a CREPT gene or an expression product thereof is selected from, but not limited to, a nucleic acid, a polypeptide, a ribonucleoprotein complex (RNP), or a small molecule drug. In some embodiments, the nucleic acid is selected from DNA, RNA, DNA / RNA; the polypeptide is selected from an antibody or an antigen-binding fragment thereof; and the RNP is selected from a CRISPR / cas system. In some specific embodiments, the agent targeting a CREPT gene or an expression product thereof is selected from an antisense oligonucleotide, an siRNA, a dsRNA, a ribozyme, an endoribonuclease III-prepared small interfering RNA (esiRNA), a short hairpin RNA (shRNA), a CRISPR / cas system, or a small molecule drug.

[0086] In some specific embodiments, the agent targeting a CREPT gene or an expression product thereof comprises a shRNA, the sequence of which is shown in SEQ ID No: 1 or SEQ ID No: 2.

[0087] In some specific embodiments, the agent targeting a CREPT gene or an expression product thereof comprises a small molecule drug, which can reduce or silence the level or activity of a CREPT gene or an expression product thereof.

[0088] In the present disclosure, the term "small molecule" refers to a low molecular weight compound, which can be artificially synthesized or obtained from a natural source, and has a molecular weight of less than 2000 Daltons (Da), less than 1500 Da, less than 1000 Da, less than 900 Da, less than 800 Da, less than 700 Da, less than 600 Da, or less than 500 Da.

[0089] In some embodiments, the small molecule drug can be an organic compound, an inorganic compound, or a combination of organic and / or inorganic compounds. In some specific embodiments, the small molecule drug is a chemically manufactured active substance or compound. Typically, these compounds are synthesized in a classical manner, by chemical reactions between different organic and / or inorganic compounds.

[0090] In some embodiments, the small molecule drug can exert its activity in the form in which it is administered, or the small molecule drug can be a prodrug. Thus, "small molecule drug" encompasses both the active form and the prodrug.

[0091] The term "prodrug" refers to a compound or substance that is converted into a therapeutically active agent under physiological conditions. In some embodiments, a prodrug is a compound or substance that, upon administration, is metabolized into a pharmaceutically active form within the body of a subject (e.g., by enzymatic activity within the body of the subject).

[0092] The term "small molecule drug" also encompasses pharmaceutically acceptable salts thereof. The term "pharmaceutically acceptable salt" refers to any salt form of a small molecule drug that is safe and effective for administration to a target subject, and that has the desired biological, pharmaceutical, and / or therapeutic activity. Pharmaceutically acceptable salts include salts of acidic or basic groups. Pharmaceutically acceptable acid addition salts can include, but are not limited to, hydrochlorides, hydrobromides, hydroiodides, nitrates, sulfates, bisulfates, phosphates, acid phosphates, isonicotinates, acetates, lactates, salicylates, citrates, tartrates, pantothenates, bitartrates, ascorbates, succinates, maleates, gentisines, fumarates, gluconates, glucarates, saccharates, formates, benzoates, glutamates, methanesulfonates, ethanesulfonates, benzenesulfonates, p-toluenesulfonates, and pamoates (i.e., l,l'-methylene-bis-(2-hydroxy-3-naphthoate)) salts. Suitable base salts can include, but are not limited to, aluminum, calcium, lithium, magnesium, potassium, sodium, zinc, and diethanolamine salts.

[0093] In some specific embodiments, the reference to the CREPT gene or expression product thereof as a prophylactic and / or therapeutic target means that the CREPT gene or expression product thereof is targeted (e.g., by RNA interference) so as to modulate (e.g., decrease) the level or activity of the CREPT gene or expression product thereof within the acute myeloid leukemia cell.

[0094] <Agents targeting the CREPT gene or expression product thereof>

[0095] According to some embodiments of the present disclosure, a reagent targeting the CREPT gene or its expression product is provided, which is capable of recognizing and binding to the CREPT gene or its expression product. According to some embodiments, a reagent targeting the CREPT gene or its expression product is provided, which is capable of modulating the level or activity of the CREPT gene or its expression product. In specific embodiments, the reagent targeting the CREPT gene or its expression product is selected from, but not limited to, a nucleic acid, a polypeptide, an RNP, or a small molecule drug. In some embodiments, the nucleic acid is selected from DNA, RNA, DNA / RNA; the polypeptide is selected from an antibody or an antigen-binding fragment thereof; the RNP is selected from a CRISPR / cas system. In specific embodiments, the reagent targeting the CREPT gene or its expression product is selected from an antisense oligonucleotide, an siRNA, a dsRNA, a ribozyme, an esiRNA prepared by ribonuclease III, a short hairpin RNA (shRNA), a CRISPR / cas system, or a small molecule drug. In specific embodiments, the double-stranded RNA, ribozyme, esiRNA, shRNA, or sgRNA in the CRISPR / cas system contains the information sequence of the CREPT gene. In a specific embodiment, the double-stranded RNA is a small interfering RNA (siRNA) or a short hairpin RNA (shRNA).

[0096] The siRNA comprises a sense strand and an antisense strand; wherein the sense strand and the antisense strand are complementary to each other, together forming a RNA duplex; and the antisense strand is capable of hybridizing or complementing to a target sequence in the CREPT gene or its expression product. In another specific embodiment, the siRNA is capable of specifically binding to a target sequence in the CREPT gene or its expression product.

[0097] In another specific embodiment, the shRNA is expressed by a vector, for example, a DNA fragment transcribable to the shRNA is cloned into a viral expression vector to be expressed. The shRNA comprises a sense strand fragment and an antisense strand fragment, and a stem loop structure connecting the sense strand fragment and the antisense strand fragment, the sequence of the sense strand fragment and the antisense strand fragment are complementary to each other, and the sequence of the antisense strand is complementary to or hybridizes to the sequence of the transcription product of the target sequence in the CREPT gene. The shRNA can be cleaved into siRNA, which in turn specifically modulates the level or activity of the CREPT gene or its expression product.

[0098] Those skilled in the art will understand that, when targeting the CREPT gene as a target, effective siRNA or shRNA can be designed and prepared according to the principles of interference RNA design known in the art.

[0099] It is understood by those skilled in the art that when targeting the CREPT gene or its expression product as a target, small molecule drugs targeting the CREPT gene or its expression product can be predicted according to tools known in the art, such as bioinformatics prediction tools, etc., and the predicted small molecule drugs can be screened to obtain effective small molecule drugs. The small molecule drugs can be used as components of the agents targeting the CREPT gene or its expression product, but are not limited thereto.

[0100] <expression vector>

[0101] According to some embodiments of the present disclosure, an expression vector for modulating the level or activity of the CREPT gene or its expression product is provided, which encodes the above-mentioned agents targeting the CREPT gene or its expression product, such as siRNA or shRNA. The expression vector further optionally comprises a detectable marker, such as but not limited to green fluorescent protein. The expression vector is selected from the group consisting of: a dsRNA vector, a lentiviral vector; for example, a lentiviral expression vector.

[0102] <pharmaceutical composition>

[0103] According to some embodiments of the present disclosure, a pharmaceutical composition for preventing and / or treating acute myeloid leukemia is provided, which comprises the above-mentioned agents targeting the CREPT gene or its expression product; and optionally a pharmaceutically acceptable carrier.

[0104] <CREPT for screening drugs for preventing and / or treating acute myeloid leukemia>

[0105] According to some embodiments of the present disclosure, the use of the CREPT gene or its expression product as a target in screening drugs for preventing and / or treating acute myeloid leukemia is provided. In some specific embodiments, the use of the CREPT gene or its expression product in the preparation of a screening device for drugs is provided, wherein the screening refers to screening drugs for preventing and / or treating acute myeloid leukemia. In some specific embodiments, the use of the CREPT gene or its expression product as a target for drug screening refers to: taking the CREPT gene as a target, screening candidates to find candidates that can modulate (e.g., inhibit, reduce) the level or activity of the CREPT gene or its expression product, i.e., drugs for preventing and / or treating acute myeloid leukemia.

[0106] In some specific embodiments, the screening device is in the form of a kit. In some specific embodiments, the screening device comprises detection reagents for determining the level or activity of the CREPT gene or its expression product, such as but not limited to primers, probes, antibodies or antigen-binding fragments thereof specific to the CREPT gene or its expression product.

[0107] <CREPT for improving prophylactic and / or therapeutic effects of drugs for acute myeloid leukemia and combination therapy>

[0108] According to some embodiments of the present disclosure, there is provided use of an agent targeting a CREPT gene or its expression product in the manufacture of a medicament for improving prophylactic and / or therapeutic effects of a drug for preventing and / or treating acute myeloid leukemia. According to other embodiments of the present disclosure, there is provided use of an agent targeting a CREPT gene or its expression product in combination with another drug for preventing and / or treating acute myeloid leukemia in the manufacture of a medicament for preventing and / or treating acute myeloid leukemia.

[0109] In the present disclosure, the drug for preventing and / or treating acute myeloid leukemia (which has improved prophylactic and / or therapeutic effects by an agent targeting a CREPT gene or its expression product, and which is used in combination with an agent targeting a CREPT gene or its expression product) is not particularly limited, and can be any known or unknown drug for preventing and / or treating acute myeloid leukemia. Exemplarily, the drug for preventing and / or treating acute myeloid leukemia can be one or more of all-trans-retinoic acid (ATRA), cytarabine (Ara-C), venetoclax, decitabine, etc. In some preferred embodiments, the drug for preventing and / or treating acute myeloid leukemia comprises all-trans-retinoic acid.

[0110] In some specific embodiments, improving therapeutic effects of the drug for preventing and / or treating acute myeloid leukemia can be improving sensitivity of a subject to the drug for preventing and / or treating acute myeloid leukemia, cytarabine (Ara-C), venetoclax, decitabine, etc.

[0111] It can be understood that the agent targeting a CREPT gene or its expression product, the expression vector, and the pharmaceutical composition provided by the present disclosure can be used in combination with a drug for treating acute myeloid leukemia for treating acute myeloid leukemia.

[0112] <Method for treating acute myeloid leukemia>

[0113] According to some embodiments of the present disclosure, there is provided a method for preventing and / or treating acute myeloid leukemia, which comprises a step of administering a prophylactically and / or therapeutically effective amount of an agent targeting a CREPT gene or its expression product. According to other embodiments of the present disclosure, there is provided an agent targeting a CREPT gene or its expression product for preventing and / or treating acute myeloid leukemia.

[0114] In some embodiments, a subject is provided with an agent targeting a CREPT gene or its expression product in a prophylactically and / or therapeutically effective amount. The prophylactically and / or therapeutically effective amount means that the agent is sufficient to modulate (e.g., decrease) the transcription or translation of a CREPT gene, or to modulate the expression or activity of a CREPT gene expression product. In some embodiments, the decrease means that the level or activity of a CREPT gene or its expression product is decreased by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or a range between any two of the above values, relative to a control without administration of the agent. The specific prophylactically and / or therapeutically effective amount should also take into account the route of administration, the health condition of the patient, and the like, which are within the skill of a skilled physician.

[0115] <Method for screening and / or identifying a prophylactic and / or therapeutic drug for acute myeloid leukemia>

[0116] According to some embodiments of the present disclosure, a method for screening and / or identifying a prophylactic and / or therapeutic drug for acute myeloid leukemia is provided, which comprises:

[0117] contacting a test substance with an acute myeloid leukemia cell;

[0118] detecting the expression level of a CREPT gene or its expression product in the acute myeloid leukemia cell after contacting with the test substance;

[0119] if the expression level of a CREPT gene or its expression product in the acute myeloid leukemia cell after contacting with the test substance is significantly decreased compared with the acute myeloid leukemia cell without contacting with the test substance, the test substance is determined as an effective prophylactic and / or therapeutic drug for acute myeloid leukemia.

[0120] In some embodiments, the acute myeloid leukemia cell can be an ex vivo acute myeloid leukemia cell obtained from an acute myeloid leukemia patient. In other embodiments, the acute myeloid leukemia cell can be an acute myeloid leukemia cell line.

[0121] <Use of CREPT in diagnosis and prognosis of acute myeloid leukemia>

[0122] According to some embodiments of the present disclosure, use of a reagent for determining the expression level of a CREPT gene or its expression product in the preparation of a reagent / kit for diagnosing or aiding in the diagnosis of acute myeloid leukemia is provided. According to other embodiments of the present disclosure, use of a reagent for determining the expression level of a CREPT gene or its expression product in the preparation of a reagent / kit for judging or aiding in the judgment of the prognosis of acute myeloid leukemia is provided.

[0123] It is understood that when determining the expression level of CREPT at the gene level, exemplary reagents that can be used include primer pairs and / or probes, etc. A skilled person can prepare specific primer pairs and / or probes according to the nucleotide sequence of CREPT. When determining the expression level of CREPT at the protein level, exemplary reagents that can be used can be anti-CREPT antibodies. Polyclonal antibodies or monoclonal antibodies, etc. can be used to implement the technical solutions of the present disclosure. A skilled person can also select other suitable reagents and methods to determine the expression level of CREPT based on the gene level or the protein level, and the present disclosure does not have special restrictions on such reagents or methods.

[0124] The terms "level", "expression level", "amount" and "expression amount" are used interchangeably herein when referring to CREPT that is determined or measured. The expression level or expression amount of CREPT at the gene level or the protein level includes the absolute amount, the relative amount or the concentration of the CREPT gene or protein, as well as any value or parameter related thereto. Such values or parameters include all specific physical or chemical property intensity signal values, such as intensity values, obtained by direct measurement. In addition, all values or parameters obtained by indirect measurement, such as the expression level determined from a biological readout system, are also included. It is understood that values related to the aforementioned amounts or parameters can also be obtained by all standard mathematical operations.

[0125] In some embodiments, the expression level of the CREPT gene or its expression product is determined in a sample to be tested. The sample to be tested is from a subject. In some embodiments, the subject includes a mammal. In some specific embodiments, the subject includes a human.

[0126] In some embodiments, the sample to be tested includes blood. In some preferred embodiments, the sample to be tested includes peripheral blood.

[0127] (diagnosis)

[0128] In some embodiments, the expression level of the CREPT gene or its expression product in the sample to be tested is significantly higher than the expression level of the CREPT gene or its expression product in a sample from a subject who does not have acute myeloid leukemia, indicating that the subject corresponding to the sample to be tested has acute myeloid leukemia.

[0129] In some specific embodiments, the expression level of the CREPT gene or its expression product in the sample to be tested is significantly higher than the expression level of the CREPT gene or its expression product in a sample from a healthy subject, indicating that the subject corresponding to the sample to be tested has acute myeloid leukemia.

[0130] In some more specific embodiments, the expression level of the CREPT gene or its expression product is significantly higher than the expression level of the CREPT gene or its expression product in a sample of a healthy subject by at least 2-fold, at least 3-fold, or at least 4-fold.

[0131] (prognosis)

[0132] In some embodiments, when judging or assisting in judging the prognosis of acute myeloid leukemia, the subject includes a subject who is suffering from or has suffered from acute myeloid leukemia.

[0133] In some specific embodiments, when the expression level of the CREPT gene or its expression product in a sample from the subject after treatment is significantly lower than the expression level of the CREPT gene or its expression product in a sample from the same subject before treatment, it indicates that the prognosis of the subject with acute myeloid leukemia is good.

[0134] In other specific embodiments, when the expression level of the CREPT gene or its expression product in a sample from the subject is high, it indicates that the prognosis of acute myeloid leukemia is poor; when the expression level of the CREPT gene or its expression product in a sample from the subject is low, it indicates that the prognosis of acute myeloid leukemia is good.

[0135] In some more specific embodiments, the high expression and low expression of the CREPT gene or its expression product can be determined according to the correlation analysis of the RNA-seq data of all AML patients in the TCGA (The Cancer Genome Atlas) database with the overall survival of the patients, and all patients are divided into two groups according to the high and low expression levels of the CREPT in the tumor cells of the AML patients (the cut-off value of the CREPT high expression group is higher than 75%, and the cut-off value of the CREPT low expression group is lower than 25%).

[0136] In some more specific embodiments, the prognosis refers to the overall survival.

[0137] (diagnosis and / or prognosis system of acute myeloid leukemia)

[0138] According to some embodiments of the present disclosure, a system for diagnosing acute myeloid leukemia and / or judging the prognosis of acute myeloid leukemia is provided, wherein the system comprises a detection device, a calculation device and an output device;

[0139] The detection device comprises a sample collector for collecting a sample from a subject and a detector for detecting the expression level of the CREPT in the sample.

[0140] The computing device comprises a memory and a processor, the memory storing a computer program, and the processor is configured to execute the computer program stored in the memory to realize the following discrimination:

[0141] When diagnosing acute myeloid leukemia, if the expression level of the CREPT gene or its expression product in the sample is significantly higher than the expression level of the CREPT gene or its expression product in a sample from a subject without acute myeloid leukemia, it is determined that the subject corresponding to the sample has acute myeloid leukemia.

[0142] When judging the prognosis of acute myeloid leukemia, if the expression level of the CREPT gene or its expression product in the sample is high expression, it is determined that the prognosis of acute myeloid leukemia of the subject corresponding to the sample is poor; if the expression level of the CREPT gene or its expression product in the sample is low expression, it is determined that the prognosis of acute myeloid leukemia of the subject corresponding to the sample is good.

[0143] Alternatively, when judging the prognosis of acute myeloid leukemia, the expression levels of the CREPT gene or its expression product in samples collected before and after treatment from the same subject are compared to determine the prognosis of acute myeloid leukemia of the subject corresponding to the sample. Specifically, if the expression level of the CREPT gene or its expression product in the sample from the subject after treatment is significantly lower than the expression level of the CREPT gene or its expression product in the sample from the same subject before treatment, it indicates that the prognosis of acute myeloid leukemia of the subject is good.

[0144] In some specific embodiments, the output device is used to output the detection result of the detection device and / or the discrimination result of the computing device, and the output device comprises at least one of a display, a printer and an audio output device; and the computing device comprises at least one of a computer host, a central processing unit and a network server.

[0145] <Diagnosis and / or prognosis judgment kit for acute myeloid leukemia>

[0146] According to some embodiments of the present disclosure, a kit for diagnosing acute myeloid leukemia and / or judging the prognosis of acute myeloid leukemia is provided, which comprises a reagent for determining the expression level of the CREPT gene or its expression product.

[0147] <Method for diagnosing and / or judging the prognosis of acute myeloid leukemia>

[0148] According to some embodiments of the present disclosure, there are provided methods for diagnosing acute myeloid leukemia and / or judging the prognosis of acute myeloid leukemia, which comprise the step of determining the expression level of a CREPT gene or its expression product in a sample from a subject. According to other embodiments of the present disclosure, there are provided reagents for determining the expression level of a CREPT gene or its expression product, which are used for diagnosing acute myeloid leukemia and / or judging the prognosis of acute myeloid leukemia.

[0149] EMBODIMENT

[0150] The present disclosure is further illustrated by the following examples, but is not limited thereto. The following provides specific materials used in the embodiments of the present disclosure and their sources. However, it should be understood that these are merely exemplary and are not intended to limit the present disclosure, and materials of the same or similar type, model, quality, property or function as the following reagents and instruments can be used to implement the present disclosure. The experimental methods used in the following examples are conventional methods unless otherwise specified. The materials, reagents and the like used in the following examples can be obtained from commercial channels unless otherwise specified.

[0151] Example 1, High expression of CREPT in peripheral blood mononuclear cells of newly diagnosed patients with acute myeloid leukemia (AML)

[0152] In order to study the relationship between the expression level of CREPT and patients with acute myeloid leukemia, peripheral blood samples of AML (acute myeloid leukemia) patients and healthy donors were collected (the information of the subjects is shown in Table 1 below), and the expression level of CREPT protein in peripheral blood mononuclear cells was analyzed. The collection method of peripheral blood mononuclear cell samples of AML patients and healthy donors is as follows: first, the clinical diagnosis of newly diagnosed patients is performed, the bone marrow sample and peripheral blood sample of the patient are extracted, the biopsy smear is made, and Wright-Giemsa staining is performed, and the diagnosis of acute myeloid leukemia is made according to the proportion of blast cells in the bone marrow sample and peripheral blood sample of the patient (the proportion of blast cells in the bone marrow is used as the standard, and the proportion of blast cells in the peripheral blood is used as the auxiliary diagnosis reference. The diagnostic criteria for AML refer to the standard of Chinese Adult Acute Myeloid Leukemia Diagnosis and Treatment Guidelines 2021 Edition, and the proportion of blast cells in peripheral blood or bone marrow ≥ 20% is a necessary condition for the diagnosis of AML; Reference: Chinese Adult Acute Myeloid Leukemia (Non-Acute Promyelocytic Leukemia) Diagnosis and Treatment Guidelines (2021 Edition), Chin J Hematol, August 2021, Vol. 42, No. 8), such as Figure 1AThe peripheral blood sample of about 3 ml of the AML patient at initial diagnosis was collected, and the peripheral blood sample was subjected to density gradient centrifugation with lymphocyte separation medium Ficoll, and the peripheral blood mononuclear cells (PBMCs) after centrifugal stratification were collected, the cells were resuspended with PBS, and then centrifuged to discard the supernatant, and the cells were resuspended with 2xLoading Buffer, thoroughly mixed by blowing, and a cell lysate sample was prepared. The sample was heated at 100°C in a metal bath for 10 minutes, then centrifuged and mixed, and stored at -20°C for long-term storage. The expression level of CREPT in the clinical peripheral blood mononuclear cell sample was verified by Western Blot. The CREPT antibody used in the Western Blot and its preparation process and method are described in CN102559601A (Invention title: CREPT antibody for identifying tumor cells or tumor tissues; Application No. 201210009890.3, which is incorporated herein by reference). The peripheral blood mononuclear cell sample of the healthy donor was processed as above, serving as a control group. The results are shown in Figure 1B and Figure 1C The expression level of CREPT in the peripheral blood mononuclear cell sample of the AML patient at initial diagnosis was significantly higher than that of the healthy donor. Among them, the expression level of CREPT in the peripheral blood mononuclear cell sample of the AML patient at initial diagnosis was about 4 times or more than that of the healthy donor.

[0153] Table 1:

[0154]

[0155] Example 2, CREPT is lowly expressed in peripheral blood mononuclear cells of AML patients after treatment remission, and the expression level of CREPT is related to the prognosis of patients

[0156] To investigate the relationship between the expression level of CREPT and the remission of acute myeloid leukemia patients, another patient different from that in Example 1 was used in this example, and the peripheral blood samples of the same AML patient at initial diagnosis and after treatment remission were collected, and the expression level of CREPT protein in peripheral blood mononuclear cells was analyzed. The collection method of the peripheral blood samples of the same AML patient at initial diagnosis and after treatment remission is as follows: first, the patient's bone marrow sample was taken for clinical diagnosis at initial diagnosis and after treatment remission, and the bone marrow sample was made into a biopsy smear for Wright-Giemsa staining, and the proportion of blast cells in the bone marrow sample was used as the standard for diagnosing remission after treatment (the proportion of blast cells in the peripheral blood was used as a reference for auxiliary diagnosis. The diagnostic criteria for AML refer to the Chinese Adult Acute Myeloid Leukemia Diagnosis and Treatment Guidelines 2021 Edition, and the proportion of blast cells in peripheral blood or bone marrow ≥ 20% is a necessary condition for the diagnosis of AML. Reference: Chinese Adult Acute Myeloid Leukemia (Non-Acute Promyelocytic Leukemia) Diagnosis and Treatment Guidelines (2021 Edition), Chin J Hematol, August 2021, Vol. 42, No. 8), for example Figure 2A . About 3 ml of peripheral blood samples of the same AML patient at initial diagnosis and after treatment remission were collected, and the peripheral blood samples were subjected to density gradient centrifugation with Ficoll, and the peripheral blood mononuclear cells were collected and made into protein samples using the same method as in Example 1, and the expression level of CREPT in the peripheral blood mononuclear cell samples of the same AML patient at initial diagnosis and after treatment remission was verified by Western blotting (using the same method as in Example 1). The results are shown in Figures 2B-2C , the expression level of CREPT in the peripheral blood mononuclear cell samples of the same AML patient after treatment remission was significantly lower than that at initial diagnosis.

[0157] At the same time, in this example, the RNA-seq data of all AML patients in the TCGA (The Cancer Genome Atlas) database was analyzed for correlation with the overall survival of the patients, and all patients were divided into two groups according to the expression level of CREPT in the tumor cells of the AML patients (the cut-off value for the high expression of CREPT was higher than 75%, and the cut-off value for the low expression of CREPT was lower than 25%). The results are shown in Figure 2D , the overall survival of AML patients with high expression of CREPT in tumor cells was shorter, and the overall survival of AML patients with low expression of CREPT in tumor cells was longer.

[0158] Example 3, Knocking down CREPT promotes differentiation and maturation of acute myeloid leukemia cells

[0159] To explore the effect of CREPT on the differentiation and maturation of acute myeloid leukemia cells, the expression level of CREPT in acute myeloid leukemia cell lines HL60 (acute promyelocytic leukemia cell line (M3); donated by Chen Mo's laboratory, School of Medicine, Tsinghua University) and MOLM13 (acute monocytic leukemia cell line (M5): donated by Chen Mo's laboratory, School of Medicine, Tsinghua University) was stably knocked down by lentivirus infection. The construction process of HL60 and MOLM13 cells with stable knockdown of CREPT expression is as follows: first, coat the lentivirus, 24 hours before transfection, inoculate an appropriate amount of 293T cells (obtained from ATCC, number CRL-3216) so that the cell density is 60-80% at the time of transfection; 1 hour before transfection, replace with fresh complete medium; take a total of 5 μg of lentivirus packaging plasmid and target plasmid (pMD2G (addgene #12259): pSPAX2 (pSPAX2: addgene #12260): pLL3.7-shCREPT plasmid or empty vector plasmid (as a control) = 1:1:2) into 100 μL of 0.9% NaCl, and mix well by blowing; mix VigoFect (Vigorous Biochemical Technology (Beijing) Co., Ltd., Catalog No. T001) with 0.9% NaCl according to the proportion, and place at room temperature for 5 minutes; mix the plasmid with 0.9% NaCl according to the proportion, and add the diluted VigoFect dropwise, mix gently, and place at room temperature for 15 minutes; mix the mixture gently, add it dropwise to the cell culture medium, and shake the medium; place the culture dish in a 37°C, 5% CO2 incubator, and replace the fresh medium after 4-6 hours, and culture for 48 hours; collect the virus-containing supernatant 48 hours after transfection; filter the virus supernatant with a 0.45 μm filter, and store it in a 4°C refrigerator or a -80°C refrigerator. Count and plate HL60 and MOLM13 cells to a cell density of 5×10 5 6 / ml at the time of virus infection; add the virus supernatant according to the medium: virus liquid = 1:1 ratio; 24 hours after infection, centrifuge the cells and replace with fresh complete medium; collect the cells for flow cytometry analysis on the 5th, 7th and 9th days after infection.

[0160] The shRNA (ShCREPT) targeting the transcription product of the CREPT gene used in this example is as follows:

[0161] ShCREPT #1 (SEQ ID NO: 1):

[0162] GGACCTGAATTCACTAGAGATTCAAGAGATCTCTAGTGAATTCAGGTC

[0163] CTTTTTT

[0164] ShCREPT#2 (SEQ ID NO: 2):

[0165] GGCAAGAACGAAGTGTGTATTTCAAGAGAATACACACTTCGTTCTTGC

[0166] CTTTTTT

[0167] The HL60 and MOLM13 cells (in which the CREPT was stably knocked down after infection with the lentivirus) were Figure 3A and Figure 3B HL60 shCREPT#1, HL60 shCREPT#2 and MOLM13 shCREPT#1, MOLM13 shCREPT#2) and control AML cells (i.e., acute myeloid leukemia cells HL60 and MOLM13 infected with empty vector plasmid packaging virus; Figure 3A and Figure 3B The cells were centrifuged and collected (labeled as HL60 shctrl and MOLM13 shctrl, respectively) and then subjected to antibody staining and flow cytometry analysis. The cells were centrifuged and resuspended in antibody staining solution (PE anti-mouse / human CD11b Antibody from Biolegend, catalog number 101207; 1:200 dilution, referred to as PE-CD11b), stained for 20 minutes at 4°C in the dark, centrifuged and resuspended for analysis. The flow cytometry strategy is: first, the cells successfully infected with the lentivirus are determined through the green fluorescence channel (the lentivirus packaging plasmid is GFP-tagged, and the cells infected with the lentivirus will express GFP and emit bright green fluorescence), and then the expression level of the differentiation marker PE-CD11b of this group of cells is analyzed. A high expression level of PE-CD11b represents the differentiation and maturity of the cells. The results are as follows: Figure 3A and Figure 3B As shown, knocking down the expression level of CREPT in HL60 and MOLM13 cells can significantly promote the maturation of cells and induce primitive tumor cells with a low degree of differentiation to differentiate towards maturity, thereby achieving the therapeutic effect of alleviating the disease.

[0168] Example 4: Knockdown of CREPT enhances the sensitivity of acute myeloid leukemia cells to ATRA. In order to explore the effect of knockdown of CREPT on the therapeutic effect of all-trans retinoic acid (ATRA), a differentiation therapy drug for acute myeloid leukemia, the stable specific knockdown of CREPT HL60 cells constructed according to Example 3 were combined with ATRA treatment to verify the expression level of the cell differentiation marker CD11b. HL60 cells were cultured at 5×10 5The cells were plated at a density of 1 x 105 / ml, and 0.1 μM of ATRA drug solution (ATRA drug powder was purchased from Selleck, item number S1653, dissolved in DMSO to prepare a stock solution at a concentration of 10 mM for storage and use) was added to the medium. After 24 hours of treatment, the expression level of CD11b was analyzed by flow cytometry. The higher the expression level of PE-CD11b, the higher the degree of cell differentiation. Figures 4A-4B As shown in Table 1, compared with the control group (HL60 shctrl), the HL60 cells after CREPT knockdown (HL60 shCREPT#1 and HL60 shCREPT#2) showed higher sensitivity to ATRA drugs, and the degree of cell induction differentiation was higher.

[0169] Example 5, Knocking down CREPT inhibits the occurrence of acute myeloid leukemia

[0170] In this example, an animal in vivo experiment was performed. The stable specific CREPT knockdown HL60 cells (CREPT knockdown group, using the HL60 cells knocked down by ShCREPT#1 or ShCREPT#2 in Example 3) obtained in Example 3 and the control group HL60 cells in Example 3 were injected into the tail vein of 4-6 week old male NOD-Prkdc scid Il2rg em1 5 x 105cells of each cell were injected into the tail vein of 4-6 week old male NOD-Prkdc 5 Il2rg / Smoc immunodeficient mice (NSG mice) (obtained from Nanjing Biomedical Corporation). Each group of 6 mice. On day 14 and day 19 after cell injection, the mice were subjected to ophthalmic blood collection by capillary, and about 100 μl of blood was collected and transferred to an anticoagulant tube, inverted and mixed, then 1 ml of red blood cell lysis solution (purchased from Solabio) was added, and the red blood cells were lysed at room temperature for 2 minutes. After centrifugation, the supernatant was discarded, and the cells were resuspended in PBS to obtain a mouse peripheral blood white blood cell suspension. The mouse peripheral blood white blood cell sample was subjected to antibody staining (mCD45-BV605, purchased from Biolegend, item number 103139; hCD45-PE, purchased from Biolegend, item number 304007), and the flow cytometry analysis was performed after 4°C dark staining for 30 minutes. On day 19 after cell injection, the mice were sacrificed by CO2 asphyxiation, the mouse spleen was dissected and weighed, and the morphology was observed. The spleen tissue was then fixed with 4% paraformaldehyde and paraffin-embedded, and after sectioning, HE staining and anti-hCD45 (purchased from Abeam, item number ab781) immunohistochemical staining were performed for histological analysis of the mouse spleen. The results are shown in Table 2 and FIG. 6. Figures 5A-5BAs shown, after the control group HL60 cells (control group) were injected into the tail vein of NSG mice, the proportion of HL60 tumor cells in the peripheral blood of mice was detected on the 19th day of modeling, and the proportion of HL60 tumor cells (hCD45 positive cells) in the peripheral blood of mice reached about 40%, while the proportion of tumor cells in the peripheral blood of mice stably knocked down by specific CREPT (CREPT knockdown group, HL60 cells knocked down by ShCREPT#1) was significantly lower than that of the control group. On the 19th day of modeling, the mice were dissected, and the spleen was taken for morphological and histological observation, respectively, see Figure 5C and Figure 5D The volume of the spleen of the control group of the modeling mice was significantly larger than that of the CREPT knockdown group (CREPT knockdown group-1, corresponding to HL60 cells knocked down by ShCREPT#1; CREPT knockdown group-2, HL60 cells knocked down by ShCREPT#2), and the degree of tumor cell (hCD45 positive staining cells) infiltration in the spleen of the control group of the modeling mice was significantly greater than that of the CREPT knockdown group (CREPT knockdown group-1, CREPT knockdown group-2), and compared with the modeling mice, the spleen of the mice without injection of cells (wild type) had no tumor cell (hCD45 positive staining cell) infiltration. The above results show that specific knockdown of the expression level of CREPT can significantly inhibit the ability of HL60 cells to induce leukemia.

Claims

1. Use of any of (i)-(v) below: (i) use of an agent targeting a CREPT gene or an expression product thereof in the manufacture of a medicament for preventing and / or treating acute myeloid leukemia; (ii) use of an agent targeting a CREPT gene or an expression product thereof in the manufacture of an agent for improving the preventive and / or therapeutic effect of a medicament for preventing and / or treating acute myeloid leukemia; (iii) use of an agent targeting a CREPT gene or an expression product thereof in combination with another medicament for preventing and / or treating acute myeloid leukemia in the manufacture of a medicament for preventing and / or treating acute myeloid leukemia; (iv) use of a CREPT gene or an expression product thereof as a target in the manufacture of a screening device for screening a medicament for preventing and / or treating acute myeloid leukemia; (v) use of an agent for determining the expression level of a CREPT gene or an expression product thereof in the manufacture of a reagent / kit for diagnosing acute myeloid leukemia and / or for judging the prognosis of acute myeloid leukemia.

2. Use according to claim 1, wherein, The expression product of the CREPT gene is selected from the group consisting of cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof.

3. Use according to claim 1 or 2, wherein, The acute myeloid leukemia is acute myeloid leukemia in a subject; Preferably, the subject comprises a mammal; More preferably, the subject is a human.

4. Use according to any one of claims 1 to 3, wherein, The agent targeting a CREPT gene or an expression product thereof is selected from the group consisting of a nucleic acid, a polypeptide, a ribonucleoprotein complex, or a small molecule drug; Preferably, the polypeptide is selected from the group consisting of an antibody or an antigen-binding fragment thereof; Preferably, the nucleic acid is selected from the group consisting of DNA, RNA, DNA / RNA; Preferably, the ribonucleoprotein complex is selected from the group consisting of a CRISPR / cas system; More preferably, the agent targeting a CREPT gene or an expression product thereof is selected from the group consisting of an antisense oligonucleotide, siRNA, dsRNA, ribozyme, esiRNA, shRNA, CRISPR / cas system, and small molecule drug; Further preferably, the agent targeting a CREPT gene or an expression product thereof comprises shRNA, the sequence of which is shown in SEQ ID No: 1 or SEQ ID No:

2.

5. The use according to any one of claims 1 to 3, wherein, The medicament for improving the preventive and / or therapeutic effect of a medicament for preventing and / or treating acute myeloid leukemia and / or the medicament for preventing and / or treating acute myeloid leukemia used in combination with the agent targeting a CREPT gene or an expression product thereof is selected from the group consisting of all-trans retinoic acid (ATRA), cytarabine (Ara-C), venetoclax, decitabine, and other conventional chemotherapeutic drugs; Preferably, the preventive and / or therapeutic effect of the medicament for preventing and / or treating acute myeloid leukemia refers to the improvement of the sensitivity of the subject to the medicament.

6. The use according to any one of claims 1 to 3, wherein, The screening device comprises a detection reagent for determining the level or activity of a CREPT gene or an expression product thereof, preferably selected from the group consisting of primers, probes, antibodies, or antigen-binding fragments thereof specific to a CREPT gene or an expression product thereof.

7. Use according to any one of claims 1 to 3, wherein The expression level of a CREPT gene or an expression product thereof is determined in a sample to be tested, which is from a subject; Preferably, the sample to be tested comprises blood; More preferably, the sample to be tested comprises peripheral blood.

8. The use of any one of claims 1-3 and 7, wherein, when determining the expression level of the CREPT at the gene level, the reagent for determining the expression level of the CREPT gene comprises one or more of primers and probes; or, when determining the expression level of the CREPT at the protein level, the reagent for determining the expression level of the expression product of the CREPT gene comprises an antibody.

9. A reagent targeting the CREPT gene or its expression product, capable of modulating the level or activity of the CREPT gene or its expression product, wherein: the expression product of the CREPT gene is selected from the group consisting of cDNA, mRNA, CREPT precursor protein, mature CREPT protein, and fragments thereof; the reagent targeting the CREPT gene or its expression product is selected from the group consisting of nucleic acid, polypeptide, ribonucleoprotein complex, or small molecule drug; preferably, the polypeptide is selected from the group consisting of antibody or antigen-binding fragment thereof; preferably, the nucleic acid is selected from the group consisting of DNA, RNA, DNA / RNA; preferably, the ribonucleoprotein complex is selected from the group consisting of CRISPR / cas system; more preferably, the reagent targeting the CREPT gene or its expression product is selected from the group consisting of antisense oligonucleotide, siRNA, dsRNA, ribozyme, esiRNA, shRNA, CRISPR / cas system, small molecule drug; further preferably, the reagent targeting the CREPT gene or its expression product comprises shRNA, the sequence of which is shown in SEQ ID No: 1 or SEQ ID No:

2.

10. A pharmaceutical composition for preventing and / or treating acute myeloid leukemia, comprising: the reagent targeting the CREPT gene or its expression product of claim 9; and, optionally, a pharmaceutically acceptable carrier.

11. A kit for diagnosing acute myeloid leukemia and / or judging the prognosis of acute myeloid leukemia, comprising a reagent for determining the expression level of the CREPT gene or its expression product.

12. A system for diagnosing and / or judging prognosis of acute myeloid leukemia, wherein, The system comprises a detection device, a computing device, and an output device; The detection device comprises a sample injector for collecting a sample from a subject and a detector for detecting the expression level of the CREPT in the sample; The computing device comprises a memory and a processor, the memory storing a computer program, and the processor is configured to execute the computer program stored in the memory to achieve the following discrimination: when diagnosing acute myeloid leukemia, if the expression level of the CREPT gene or its expression product in the sample is significantly higher than the expression level of the CREPT gene or its expression product in the sample from a subject without acute myeloid leukemia, it is determined that the subject corresponding to the sample has acute myeloid leukemia; When judging the prognosis of acute myeloid leukemia, if the expression level of the CREPT gene or its expression product in the sample is high expression, it is determined that the subject corresponding to the sample has poor prognosis of acute myeloid leukemia; if the expression level of the CREPT gene or its expression product in the sample is low expression, it is determined that the subject corresponding to the sample has good prognosis of acute myeloid leukemia; or, The expression level of the CREPTT gene or its expression product in the sample collected before treatment and after treatment from the same subject is compared, and the prognosis of acute myeloid leukemia of the subject corresponding to the sample is determined.

Images