Use of a gpr91 activator in the manufacture of a medicament

By activating succinate and α-ketoglutarate of the GPR91 receptor, the AMPK signaling pathway is activated, promoting NAD+ synthesis, thus resolving myocardial metabolic disorders in HFpEF, significantly improving cardiac function and energy status, and providing new therapeutic targets and methods.

CN120837472BActive Publication Date: 2026-03-03CAPITAL UNIVERSITY OF MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-29
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

Existing treatments for heart failure with preserved ejection fraction (HFpEF) have limited efficacy and are not sustained. There is a lack of effective targets and interventions, especially for improving myocardial metabolic disorders and energy supply impairments.

Method used

By using GPR91 activators, such as succinic acid and α-ketoglutarate, the GPR91 receptor is activated, which promotes NAD+ synthesis through the AMPK signaling pathway, improves HFpEF cardiac function, and increases NAD+ levels by supplementing with the NAD+ precursor nicotinamide.

Benefits of technology

It significantly improves cardiac diastolic function in patients with high heart rate and pulmonary artery effusion (HFpEF), enhances myocardial energy status, alleviates myocardial energy disorders and diastolic dysfunction, and provides new metabolic intervention targets and treatment options.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120837472B_ABST
    Figure CN120837472B_ABST
Patent Text Reader

Abstract

The application relates to the field of metabolic reprogramming and prevention and treatment of heart failure, and discloses application of a GPR91 activator. The GPR91 activator can be used for preparing a medicine for preventing and / or treating heart failure with preserved ejection fraction. The application firstly proposes that the GPR91 activator can improve NAD + level by activating AMPK, thereby improving heart failure with preserved ejection fraction, and proposes that the GPR91 activator is applied to preparation of a medicine for heart failure with preserved ejection fraction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of metabolic reprogramming and prevention of heart failure, specifically to the application of GPR91 activators in drug preparation. Background Technology

[0002] Cardiovascular disease remains the leading cause of death worldwide, with heart failure (HF) being the end stage of many heart diseases, severely threatening human health and the burden on public healthcare systems. Based on left ventricular ejection fraction (LVEF), heart failure can be classified into three categories: heart failure with reduced ejection fraction (HFrEF, LVEF < 40%), heart failure with mildly reduced ejection fraction (HFmrEF, LVEF 41–49%), and heart failure with preserved ejection fraction (HFpEF, LVEF ≥ 50%). HFpEF is a highly heterogeneous clinical syndrome, characterized by difficulty in clinical identification, limited treatment options, and poor intervention outcomes, differing significantly from HFrEF in pathogenesis and drug response. Currently, there is no systemic treatment strategy for HFpEF. Conventional interventions such as diuretics, mineral corticosteroid antagonists (MRAs), and lifestyle modifications can improve symptoms to some extent, but have not effectively reversed its pathological progression.

[0003] Recent studies have shown that the core pathological features of heart failure with functional pulmonary embolism (HFpEF) transcend simple myocardial diastolic dysfunction and are increasingly being regarded as a systemic disease driven by "systemic metabolic disorders." Of particular note is that metabolic remodeling of cardiomyocytes and impaired energy supply are gradually becoming key pathological links in the occurrence and progression of HFpEF. HFpEF patients often exhibit decreased myocardial mitochondrial oxidative function, shifted energy substrate utilization (such as reduced glucose uptake and inefficient fatty acid oxidation), and weakened total energy supply capacity, leading to myocardial energy imbalance and further impairing its ability to adapt to stress loads. Therefore, exploring interventions targeting "myocardial metabolic reprogramming" has become a new direction in HFpEF treatment research.

[0004] Succinate, a key intermediate in the tricarboxylic acid cycle, has recently been defined as a "metabolite signaling molecule" with signaling functions. Under pathological conditions such as hypoxia, metabolic stress, and tissue damage, succinate levels in the body significantly increase, thereby activating its specific receptor GPR91 to participate in the regulation of various pathological processes. GPR91 is a G protein-coupled receptor widely distributed in tissues such as the heart, kidneys, liver, and retina. In recent years, it has been found to be closely related to myocardial remodeling, blood pressure regulation, inflammation activation, and metabolic abnormalities, playing a significant pathophysiological role in the cardiovascular system.

[0005] On the other hand, AMPK, as a core sensor of intracellular energy status, regulates multiple metabolic pathways, including glucose metabolism, fatty acid oxidation, and mitochondrial function. Maintaining its activated state is considered a key mechanism for cardiomyocytes to adapt to energy load and reverse metabolic disorders. Previous studies have shown that AMPK activation is accompanied by NAD+ activation. + The level of NAD+ is increased, and NAD+ itself, as an important coenzyme, also participates in many functions such as regulating cellular redox balance, DNA repair, and mitochondrial biosynthesis.

[0006] Currently, no studies have clearly shown that GPR91 can directly regulate the AMPK pathway to improve HFpEF. Therefore, actively studying the pathological mechanisms and identifying therapeutic targets for HFpEF is crucial for the effective treatment of HFpEF. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of existing treatments for HFpEF, such as limited efficacy and lack of sustained therapeutic effect.

[0008] To achieve the above objectives, a first aspect of the present invention provides the use of a GPR91 activator in the preparation of a medicament for the prevention and / or treatment of heart failure with preserved ejection fraction. A second aspect of the present invention provides the use of a GPR91 activator in the preparation of a medicament for inducing AMPK phosphorylation. A third aspect of the present invention provides the use of a GPR91 activator in the preparation of a medicament for increasing NAD+ levels. A fourth aspect of the present invention provides the use of a GPR91 activator in the preparation of a medicament for improving myocardial energy disorders and / or myocardial diastolic dysfunction.

[0009] Through the above technical solution, the present invention has at least the following advantages compared with the prior art: (1) The present invention clarifies for the first time that GPR91 activator activates the AMPK signaling pathway through GPR91 receptor, thereby promoting NAD. + Synthesis, thereby improving HFpEF cardiac function, provides a new target for HFpEF metabolic intervention. The GPR91 activator is preferably an endogenous metabolite, more preferably at least one of succinic acid and α-ketoglutarate. (2) The present invention found that supplementing NAD in the case of GPR91 deficiency + The precursor nicotinamide (NAM) can significantly enhance NAD. + NAD+ levels and improves cardiac function, therefore + Precursor substances can also be used to prepare drugs for the prevention and / or treatment of HFpEF as a feasible alternative to downstream end-product strategies. (3) Preferably, the present invention has discovered that the succinic acid-GPR91-AMPK signaling pathway can enhance NAD. +To improve HFpEF levels, the application of GPR91 activators such as succinic acid in the prevention and / or treatment of HfpEF has been proposed. For example, succinic acid can be used to prepare drugs for the prevention and / or treatment of HfpEF, thereby achieving the effect of metabolic intervention in HFpEF. Attached Figure Description

[0010] Figure 1 The figure shows the effect of succinic acid supplementation on WT HFpEF model mice in improving cardiac diastolic dysfunction. Figure 2 This is an electrophoresis image of a GPR91 mouse with cardiomyocyte-specific knockout, identified by PCR. Figure 3 This is a graph showing the effect of succinic acid supplementation on diastolic dysfunction in a cardiomyocyte-specific knockout GPR91 HFpEF model. Figure 4 This is a figure showing the effect of significant downregulation of the AMPK signaling pathway in succinate-supplemented mice with a cardiomyocyte-specific knockout GPR91HFpEF model. Figure 5 This figure shows the effect of significant downregulation of NAD+ and glucose and lipid metabolism-related pathways in succinate-supplemented mice with a cardiomyocyte-specific knockout GPR91HFpEF model. Figure 6 This is a graph showing the effect of succinic acid stimulation on significantly enhancing the upregulation of downstream target genes of AMPK in cardiomyocytes of control mice. Figure 7 This is a diagram showing the effect of succinic acid on AMPK activation by GPR91 in cardiomyocytes; Figure 8 The effect of succinic acid treatment on succinic acid content and NAD in mouse heart tissue. + Graph showing the effects of metabolic levels; Figure 9 This is a graph showing the effect of succinate stimulation on AMPK phosphorylation in primary cardiomyocytes. Figure 10 The figure shows the effect of supplementing NAD+ precursor NAM on reversing cardiac dysfunction in HFpEF GPR91 systemic knockout mice. Figure 11 This is a graph showing the effect of succinic acid-GPR91 on AMPK activation through the Gq signaling pathway; Figure 12 This is a schematic diagram showing how succinic acid-GPR91 activates AMPK through the Gq signaling pathway, thereby increasing NAD+ production and improving HFpEF. Detailed Implementation

[0011] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0012] As previously stated, a first aspect of this invention provides the use of GPR91 activators in the preparation of medicaments for the prevention and / or treatment of heart failure with preserved ejection fraction. Experiments involving the administration of succinic acid to wild-type HFpEF mice showed that succinic acid effectively improved diastolic function in these mice. Further experiments involving the administration of succinic acid to GPR91 knockout HFpEF model mice and cardiomyocyte-specific knockout HFpEF model mice showed that the therapeutic effect of succinic acid in improving diastolic function in HFpEF mice disappeared, indicating that the protective effect of succinic acid depends on GPR91 on cardiomyocytes.

[0013] As previously described, a second aspect of this invention provides the use of GPR91 activators in the preparation of drugs that induce AMPK phosphorylation. In vitro experiments using primary cardiomyocytes showed that succinate stimulation significantly enhanced AMPK phosphorylation levels in wild-type mouse cardiomyocytes.

[0014] As previously stated, a third aspect of this invention provides the use of GPR91 activators in the preparation of drugs that enhance NAD+ levels. This invention involves administering succinic acid to GPR91-specifically knocked-out HFpEF mice and control HFpEF model mice. Results show that succinic acid supplementation significantly increases NAD+ levels in cardiac tissue in control mice. + The content and redox ratio of succinic acid were measured, while the effect of succinic acid disappeared in GPR91 knockout mice, suggesting that succinic acid promotes NAD+ production in cardiac tissue through GPR91 knockout in cardiomyocytes.

[0015] As previously described, a fourth aspect of this invention provides the use of GPR91 activators in the preparation of medicaments for improving myocardial energy disorders and / or myocardial diastolic dysfunction. RNA sequencing analysis of this invention shows that GPR91 deficiency in cardiomyocytes significantly inhibits glucose and lipid metabolism and NAD+. + Synthesis and AMPK signaling pathway, indicating that GPR91 activator regulates NAD through AMPK. + Synthesis, glucose and lipid metabolism, and myocardial energy metabolism.

[0016] This invention discloses a method by which GPR91 activator can significantly improve diastolic function in HFpEF models constructed through a high-fat diet combined with N-nitro-L-arginine methyl ester induction. Specifically, this method discloses a scheme that uses GPR91 activator to improve diastolic function in combined HFpEF models, including a stress overload combined with metabolic disorder model and an aged mouse combined with metabolic disorder model. The "stress overload combined with metabolic disorder model" refers to the use of N-nitro-L-arginine methyl ester to induce hypertension combined with a high-fat diet to induce diabetes / insulin resistance. The "aged mouse combined with metabolic disorder model" refers to using naturally aged mice (e.g., 18–24 months old) as a base, and then administering a high-fat diet or insulin resistance induction to simulate HFpEF caused by aging combined with metabolic disorders.

[0017] Preferably, the GPR91 activator is an endogenous metabolite that activates GPR91. Preferably, the endogenous metabolite includes at least one of succinic acid and α-ketoglutarate.

[0018] Preferably, the dosage of the drug for preventing and / or treating heart failure with preserved ejection fraction, the dosage of the drug for inducing AMPK phosphorylation, the dosage of the drug for increasing NAD+ levels, and the dosage of the drug for improving myocardial energy disorders and / or myocardial diastolic dysfunction are each independently not less than 1.5 (w / v)%.

[0019] Preferably, the dosages of the drug for preventing and / or treating heart failure with preserved ejection fraction, the drug for inducing AMPK phosphorylation, the drug for increasing NAD+ levels, and the drug for improving myocardial energy disorders and / or myocardial diastolic dysfunction are each independently 0.5 (w / v)%-2.5 (w / v)%.

[0020] In this invention, (w / v)% refers to the ratio of mass to volume, with mass measured in grams and volume in milliliters. There are no particular restrictions on the route of administration of the above-mentioned drugs in this invention; methods known in the art can be used, such as oral administration, topical application, inhalation, intravenous injection, intravenous drip, subcutaneous injection, etc.

[0021] According to a specific embodiment of the present invention, NAD + Precursor substances can improve NAD+ production disorders, myocardial energy disorders, and diastolic dysfunction. According to a preferred embodiment of the present invention, NAD+... + The precursors include at least one of nicotinamide mononucleotide and nicotinamide nucleoside.

[0022] Preferably, the drug for preventing and / or treating heart failure with preserved ejection fraction, the drug for inducing AMPK phosphorylation, the drug for increasing NAD+ levels, and the drug for improving myocardial energy disorders and / or myocardial diastolic dysfunction each independently further contain a pharmaceutically acceptable carrier.

[0023] Preferably, the carrier comprises at least one of a diluent, disintegrant, binder, preservative, isotonic agent, lubricant, stabilizer, or surfactant. In one embodiment of the invention, a pharmaceutically acceptable carrier comprises a diluent. Non-limiting examples of diluents include, but are not limited to, sodium hydroxide, water-soluble oil, propylene glycol, glycerin, hydroxyethyl cellulose, and water, and mixtures thereof. In one embodiment of the invention, a pharmaceutically acceptable carrier comprises a disintegrant. Non-limiting examples of disintegrants include, but are not limited to, starch, sodium carboxymethyl starch, hydroxypropyl starch, low-substituted hydroxypropyl cellulose, croscarmellose sodium, alginate, and mixtures thereof.

[0024] In one embodiment of the invention, a pharmaceutically acceptable carrier comprises the adhesive used. Non-limiting examples of adhesives used include, but are not limited to, polyvinylpyrrolidone, hydroxypropyl cellulose, hydroxypropyl methylcellulose, starch paste, gelatin, sodium alginate, and mixtures thereof.

[0025] In one embodiment of the invention, a pharmaceutically acceptable carrier includes a preservative. Non-limiting examples of preservatives include, but are not limited to, benzyl chloride, benzoic acid, benzyl alcohol, bromonitropropylene glycol, butyl 4-hydroxybenzoate, chlorobutanol, chlorocresol, chlorhexidine, chlorophenylglycerol ether, o-cresol, m-cresol, p-cresol, ethyl 4-hydroxybenzoate, imidureus, methyl 4-hydroxybenzoate, phenol, 2-phenoxyethanol, 2-phenylethanol, propyl 4-hydroxybenzoate, sodium dehydroacetate, thimerosal, and mixtures thereof.

[0026] In one embodiment of the invention, a pharmaceutically acceptable carrier comprises an isotonic agent. Non-limiting examples of isotonic agents include, but are not limited to, amino acids (such as glycine, histidine, arginine, lysine, isoleucine, aspartic acid, tryptophan, and threonine), sugar alcohols (such as glycerol, 1,2-propanediol, propylene glycol), 1,3-propanediol, and 1,3-butanediol), polyethylene glycol (e.g., PEG400), and mixtures thereof. Another example of an isotonic agent includes sugars. Non-limiting examples of sugars can be monosaccharides, disaccharides, or polysaccharides, or water-soluble dextran, including, for example, fructose, glucose, mannose, sorbitol, xylose, maltose, lactose, sucrose, trehalose, dextran, amylopectin, dextrin, cyclodextrin, α- and β-HPCD, soluble starch, hydroxyethyl starch, and sodium carboxymethyl cellulose. Another example of an isotonic agent is a sugar alcohol, wherein the term "sugar alcohol" is defined as a C(4-8) hydrocarbon having at least one -OH group. Non-limiting examples of sugar alcohols include mannitol, sorbitol, inositol, galactitol, hexahexol, xylitol, and arabinitol. Pharmaceuticals comprising each of the isotonic agents listed in this paragraph constitute alternative embodiments of the invention.

[0027] In one embodiment of the invention, a pharmaceutically acceptable carrier includes a lubricant. Examples of lubricants include, but are not limited to, magnesium stearate, glyceryl docosanoate, calcium stearate, zinc stearate, stearic acid, silica, talc, polyethylene glycol, mineral oil, carnauba wax, palmitic acid, sodium stearoyl fumarate, sodium lauryl sulfate, glyceryl palmitate, myristic acid, and hydrogenated vegetable oils and fats, as well as other known lubricants, and / or mixtures of two or more thereof. In one embodiment, if present, the lubricant for granulation of the feedstock is magnesium stearate.

[0028] In one embodiment of the invention, a pharmaceutically acceptable carrier includes a stabilizer. Non-limiting examples of stabilizers include hydrophilic polymers, liposomes with hydroxyl or carboxyl groups on their surface, bovine serum albumin nanospheres, human serum albumin nanospheres, and mixtures thereof.

[0029] In one embodiment of the invention, the pharmaceutically acceptable carrier comprises one or more surfactants, preferably one surfactant, at least one surfactant, or two different surfactants. The term surfactant refers to any molecule or ion consisting of a water-soluble portion (hydrophilic) and a lipophilic portion. For example, surfactants are selected from anionic surfactants, cationic surfactants, nonionic surfactants, and / or zwitterionic surfactants.

[0030] The present invention will be described in detail below through examples. In the following examples, unless otherwise specified, all raw materials used are commercially available products; room temperature refers to 25℃±2℃. In this invention, 1.5% (w / v) succinic acid means adding 1.5g of succinic acid per 100mL of drinking water.

[0031] Regular feed was purchased from Beijing Huafukang Biotechnology Co., Ltd., catalog number 1022. High-fat feed (fat accounting for 60% of total calories) was purchased from Research Diets, catalog number D12492. The preparation method for 1×TBST was as follows: take 10× blocking-washing buffer, dilute it tenfold, and prepare 1×TBST. The preparation method for 5% BSA blocking buffer was as follows: dissolve 5g of BSA powder in 100mL of 1×TBST. PVDF membranes were purchased from Millipore, catalog number IPVH00010. The preparation method for transfer buffer was as follows: add 50mL of 20× rapid transfer buffer and 100mL of anhydrous ethanol to 850mL of distilled water. The preparation method for 0.04% collagenase II digestion solution was as follows: dissolve 40mg of type II collagenase in 100mL of PBS. Human cardiomyocyte cell line AC16 was purchased from ATCC, catalog number AC16-CRL-3568. Information on the experimental reagents and instruments used in this invention is shown in Tables 1 and 2.

[0032] Table 1

[0033]

[0034] Table 2

[0035] Instrument Name Production Company model High-resolution small animal ultrasound imaging system FUJIFILM Vevo2100 Electrophoresis apparatus power supply Beijing Hongtao Jiyue Technology Development Co., Ltd. HT-300 Transfer electrophoresis tank Beijing Hongtao Jiyue Technology Development Co., Ltd. HT-ZY03 Transfer tank Beijing Hongtao Jiyue Technology Development Co., Ltd. HT-mini04 Bioanalyzer Agilent Technologies Agilent 2100 Transmission electron microscopy (TEM) Hitachi HT7700 Non-invasive blood pressure measurement system Visitech Systems BP-2000 Blood glucose meter Fish leap 710 Real-time quantitative PCR system Bio-Rad CFX96 Touch WB luminometer Vilber Fusion FX ELISA reader Bio Tek Elx 800 Fluorescence inverted microscope Nikon Ti2-U Digital pathology slide scanner 3D Histech PANNORAMIC SCAN II

[0036] Example 1

[0037] This embodiment illustrates the application of succinic acid intervention to WT HFpEF model mice. The "Two-Hit" strategy, which involves inducing the HFpEF mouse model through a high-fat diet combined with L-NAME intervention, is widely used to construct HFpEF animal models that conform to clinical characteristics. Based on the established HFpEF animal model, succinic acid intervention was performed on the mice by adding succinic acid to their drinking water. The specific steps are as follows:

[0038] 1) Experimental animals: Forty 8-week-old male C57BL / 6J mice, weighing approximately 20g-22g, were purchased from Cyagen Biosciences Co., Ltd. and were grouped after one week of acclimatization.

[0039] 2) Experimental intervention: The mice were randomly divided into the following four groups:

[0040] RC group: C57BL / 6J mice were fed a normal diet and water for 12 weeks. RC+SUC group: C57BL / 6J mice were fed a normal diet and water supplemented with 1.5% (w / v) succinic acid for 12 weeks. HFpEF group: Also known as the HFpEF model group (experimental group), C57BL / 6J mice were fed a high-fat diet (fat accounting for 60% of total calories) and L-NAME was added to their drinking water at a final concentration of 0.5 g / L for 12 weeks. HFpEF+SUC group: C57BL / 6J mice were fed a high-fat diet (fat accounting for 60% of total calories) and L-NAME and 1.5% (w / v) succinic acid were added to their drinking water at a final concentration of 0.5 g / L for 12 weeks. Note: During the experiment, the drinking water was changed every 2 days to ensure a stable dosage.

[0041] 3) Experimental observation and indicator evaluation

[0042] Figure 1 (A) in the diagram is the experimental flowchart. Mouse body weight was recorded weekly during the above intervention process, and the results are as follows: Figure 1 As shown in B. From Figure 1 As can be seen in (B), the weight gain of mice in the HFpEF model group induced by "Two-Hit" was significantly slowed down after supplementation with succinic acid.

[0043] Example 2: Effects of succinic acid intervention on cardiac systolic and diastolic function in WT HFpEF model mice

[0044] At week 12 of group feeding, echocardiograms were obtained from mice in the RC, RC+SUC, HFpEF, and HFpEF+SUC groups using a high-resolution small animal ultrasound imaging system to assess cardiac function. Left ventricular end-diastolic diameter (LVEDd), early diastolic to atrial systolic velocity ratio (E / A), E-wave to e'-wave velocity ratio (E / e'), and global longitudinal strain (GLS) were measured to comprehensively reflect left ventricular diastolic function and overall cardiac function status. EF (ejection fraction) testing confirmed the model as an ejection function-preserving heart failure phenotype. The specific steps are as follows:

[0045] 1) Mice were anesthetized with isoflurane at an inhalation concentration of 1.5 (v / v)% and fixed to a heating platform to maintain a constant body temperature;

[0046] 2) Connect the high-frequency ultrasound equipment for small animals to a high-frequency probe with a frequency of 35MHz;

[0047] 3) Collect the following standard ultrasonic sections and obtain the corresponding parameters:

[0048] Paraasternal Long Axis View (PLAX): Used to assess indicators such as LVEDd, LVESD, EF, FS, IVS, and LVPW, reflecting left ventricular structure and systolic function; Paraasternal Short Axis View (PSAX): Assessing ventricular systolic coordination and local wall motion abnormalities; Apical Four Chamber View (A4C): Used to obtain E / A ratio, E / e' ratio, and GLS, assessing diastolic function and overall cardiac function; M-mode ultrasound: Obtains high temporal resolution images based on the PLAX view, used for precise measurement of LVEDd, LVESD, EF, and FS; Tissue Doppler imaging (TDI): Often acquired based on the A4C view, used to measure parameters reflecting left ventricular diastolic velocity, such as the e' wave.

[0049] 4) Collect the above indicators in the measurement window, and take the average value for each animal after measuring 3 cardiac cycles for analysis.

[0050] 5) Experimental Results

[0051] Typical images of mouse echocardiography are shown below. Figure 1 As shown in (C); E / A test results are as follows Figure 1 As shown in (D). The E / E' detection results are as follows. Figure 1 As shown in (E). A typical diagram of left ventricular longitudinal systolic function is shown below. Figure 1 As shown in (F). The Tei index detection results are as follows. Figure 1 As shown in (G). The statistical chart of GLS% detection results is as follows. Figure 1 As shown in (H). The EF% test results are as follows. Figure 1 As shown in (I). From Figure 1 (C)- Figure 1 (E) and Figure 1 (I) It can be seen that, compared with the HFpEF model group without succinic acid supplementation, the E / A ratio and E / E' ratio of the HFpEF+SUC group mice were significantly decreased, indicating that the left ventricular diastolic dysfunction was alleviated, while the EF (ejection fraction) value did not change significantly, further indicating that this model is a typical heart failure with preserved ejection fraction (HFpEF). Furthermore, the changes in myocardial strain parameters in HFpEF mice can be confirmed by Vevo Strain speckle tracking analysis. Figure 1 (F)- Figure 1As shown in (H), succinic acid supplementation significantly reduced the myocardial work index and improved cardiac compliance in HFpEF model mice. In summary, compared with unsuccinic acid-supplemented WT HFpEF model mice, succinic acid supplementation significantly reduced the E / A and E / e' ratios, while the EF value remained unchanged. This suggests that this model is a heart failure model with preserved ejection fraction, and succinic acid supplementation can effectively alleviate left ventricular diastolic dysfunction caused by HFpEF.

[0052] Example 3: Effects of succinic acid intervention on motor function in WT HFpEF model mice

[0053] At week 11 of group feeding, the motor abilities of mice in the RC, RC+SUC, HFpEF, and HFpEF+SUC groups were assessed using a rotarod test. The specific steps were as follows: After two days of acclimatization training, the mice were placed on a rotarod and moved at a speed of 5 rpm / min for 5 seconds, then at 10 rpm / min for 5 seconds, and finally accelerated to 20 rpm / min until they fell or the experiment ended. The time the mouse remained on the rotarod was recorded (in seconds). The entire experiment lasted 10 minutes. Three similar measurements were recorded for each mouse, and the average was taken as the final motor data for that mouse.

[0054] Exercise time such as Figure 1 As shown in (J). Figure 1 (J) shows that compared with the RC group mice, the HFpEF model group mice had decreased motor ability; compared with the HFpEF model group mice, the HFpEF+SUC group mice had significantly prolonged motor time.

[0055] Example 4: Measurement of heart weight and tibia length

[0056] After 12 weeks of group feeding, mice in the RC, RC+SUC, HFpEF, and HFpEF+SUC groups were anesthetized and underwent open-chest surgery after adequate anesthesia. Following cardiac perfusion, major organs such as the heart, liver, and kidneys were rapidly collected for subsequent histological examination and molecular biological analysis. Typical gross images of the mouse heart are shown below. Figure 1 As shown in (K), Figure 1 The (K) values ​​in the study showed increased heart volume in HFpEF mice. Succinic acid supplementation significantly inhibited this increase, restoring the heart morphology to near-normal levels. The heart weight / tibia length ratio results are shown below. Figure 1 As shown in (L). Figure 1 The (L) value indicates an elevated heart weight / tibia length ratio. Supplementation with succinic acid can significantly inhibit the increase in the heart weight / tibia length ratio, restoring heart shape and weight to near-normal levels.

[0057] Example 5: Observation of Cardiac Pathology

[0058] This embodiment evaluates the effect of succinic acid intervention on cardiac structural remodeling in HFpEF mice through histopathological staining experiments. After 12 weeks of group feeding, cardiac tissue samples were collected from mice in the RC group, RC+SUC group, HFpEF group, and HFpEF+SUC group, respectively, and HE staining, Masson staining, WGA staining, and Oil Red O staining were performed to evaluate the degree of myocardial hypertrophy and fibrosis.

[0059] 1) Preparation of paraffin sections for heart samples

[0060] 1. Remove animal heart tissue, remove impurities, and immediately fix in 4% neutral buffered formalin for 24 hours. Then, sequentially immerse the fixed heart tissue in 70% (v / v) ethanol, 80% (v / v) ethanol, 90% (v / v) ethanol, 95% (v / v) ethanol, and 100% (v / v) ethanol for 1 hour each time; finally, immerse the heart tissue in 100% (v / v) ethanol for 1 hour.

[0061] 2. Xylene clearing: Immerse the heart tissue in xylene for 15 minutes, then immerse the heart tissue in xylene again for 15 minutes;

[0062] 3. Paraffin embedding: After immersing the heart tissue in paraffin and fixing it at 61°C for 1 hour, the heart tissue was immersed in paraffin again and fixed at 61°C for 1 hour, and then the paraffin was allowed to cool and solidify.

[0063] 4. The heart tissue was sectioned using a rotary sectioner to a thickness of 5 μm. The sections were then placed on polylysine glass slides and dried at 60°C for 2 hours.

[0064] 2) HE staining

[0065] 1. Dewaxing: Immerse the sections twice in xylene for 10 minutes each time; 2. Hydration: Immerse the sections sequentially in 100% (v / v) ethanol, 95% (v / v) ethanol, 90% (v / v) ethanol, 80% (v / v) ethanol, and 70% (v / v) ethanol for 2 minutes each; wash with distilled water for 2 minutes; 3. Staining: Stain the sections with hematoxylin (included in the H&E staining kit) for 10 minutes; rinse with running tap water for 10 minutes to allow the blue color to return; stain the sections with 1% eosin (H&E staining). (The staining kit includes instructions) Stain for 5 min; 4. Dehydration: Immerse the sections in 70% (v / v) ethanol, 80% (v / v) ethanol, 95% (v / v) ethanol, and 100% (v / v) ethanol for 1 min each time; then immerse the sections in 100% (v / v) ethanol twice, 1 min each time; 5. Immerse the sections in xylene twice, 5 min each time; 6. Add a drop of neutral resin to the center of the slide and mount it with a coverslip; 7. Scan and image the slides using a digital pathology slide scanner and save as a high-resolution digital image.

[0066] 2) Masson staining

[0067] Masson staining of paraffin sections of heart samples was performed using a Masson staining kit. The specific steps are as follows:

[0068] 1. Immerse the sections twice in xylene for 10 min each time; 2. Hydration: Immerse the sections sequentially in 100% (v / v) ethanol, 95% (v / v) ethanol, 90% (v / v) ethanol, 80% (v / v) ethanol, and 70% (v / v) ethanol for 2 min each; wash with distilled water for 2 min; 3. Stain the sections with Weigert iron hematoxylin staining solution (mix equal volumes of Weigert staining solution A and staining solution B from the Masson staining kit) for 10 min; 4. Immerse the sections in acidic ethanol differentiation solution for 1 min, then wash with distilled water for 30 sec; 5. Re-blue the sections with Masson blueing solution and wash with water; 6. Wash the sections with distilled water for 1 min; 7. Stain the sections with Ponceau S and fuchsin. 8. Stain with staining solution for 10 min; 9. Wash the section with weak acid working solution (the volume ratio of distilled water to weak acid solution is 2:1) for 1 min; 10. Wash the section with phosphomolybdic acid solution for 2 min; 11. Wash the section with weak acid working solution for 1 min; 12. Immerse the section directly in aniline blue staining solution for 2 min; 13. Wash the section with weak acid working solution for 1 min; 14. Immerse the section in 95% (v / v) ethanol for 10 s; 15. Immerse the section in anhydrous ethanol 3 times, each time for 10 s; 16. Immerse the section in xylene 3 times, each time for 5 min; 17. Add a drop of neutral resin to the center of the slide and seal with a coverslip; 18. Scan the slide using a digital pathology slide scanner and save it as a high-resolution digital image.

[0069] 3) WGA staining

[0070] 1. Tissue section preparation: Place 5μm thick paraffin-embedded tissue sections in a slide dryer and bake at 60℃ for 60 minutes to ensure full adhesion to the glass slide; 2. Dewaxing and hydration: Immerse the sections twice in xylene for 10 minutes each time; then immerse the sections sequentially in 100% (v / v) ethanol, 95% (v / v) ethanol, 85% (v / v) ethanol, and 75% (v / v) ethanol for 5 minutes each, and then rinse in distilled water for 3 minutes to complete hydration; 3. Blocking non-specific binding sites: Incubate with 5% (w / v) bovine serum albumin at room temperature for 30 minutes to block non-specific binding sites in the tissue; 4. Fluorescent labeling with WGA: Apply wheat germ lectin (WGA) solution to the surface of the sections and incubate at room temperature in the dark for 60 minutes; 5. Washing: Gently wash the sections three times with PBS buffer for 5 minutes each time to remove unbound WGA.

[0071] 6. Mounting: Mount the slide using a DAPI-containing anti-fluorescence quenching mounting medium, attach a coverslip, and gently press to remove air bubbles; 7. Observe the slide under a fluorescence inverted microscope and acquire images.

[0072] 4) Oil Red O staining

[0073] Immediately after harvesting heart tissue, it was fixed with 4% paraformaldehyde for 1 hour, followed by dehydration with 30% sucrose solution until the tissue settled and then frozen in OCT embedding medium. Sections with a thickness of 8 μm were cut using a cryostat. After equilibration at room temperature, the sections were pretreated with 75% (v / v) ethanol for 3 minutes to maintain lipid solubility. Oil Red O staining solution was prepared with deionized water at a volume ratio of 2:3 and filtered using filter paper. The sections were immersed in freshly prepared and filtered Oil Red O staining solution for 15 minutes. After staining, the sections were rapidly rinsed with 75% (v / v) ethanol to remove non-specific staining, and then gently rinsed with physiological saline. Finally, the cell nuclei were counterstained with hematoxylin for 1 minute, rinsed with running water, and mounted with neutral resin. The sections were then observed using a fluorescence inverted microscope.

[0074] 5) Results Analysis

[0075] Figure 1 (M) shows the results of HE staining, Masson staining, WGA staining, and Oil Red O staining. Figure 1 (N) in the figure shows the statistical results of fibrosis and the statistical results of cross-sectional area of ​​WGA-stained cells. From Figure 1 As can be seen from (M), HE staining results showed a significant increase in the cross-sectional area of ​​the myocardium in the HFpEF model mice; WGA staining and Oil Red O staining results showed increased cardiomyocyte hypertrophy and lipid deposition, respectively. These pathological changes were significantly alleviated after succinic acid supplementation. From Figure 1 As can be seen from (N), fibrosis was significant in the HFpEF group mice, and it was significantly alleviated after succinic acid supplementation.

[0076] Example 6: Expression levels of genes related to myocardial hypertrophy and myocardial fibrosis

[0077] To verify the molecular-level intervention mechanism, heart tissue samples were collected from mice after 12 weeks of group feeding. The expression levels of ANF, BNP, MYH7, COLI, COLIII, and α-SMA genes in the RC, RC+SUC, HFpEF, and HFpEF+SUC groups were detected by real-time quantitative PCR.

[0078] 1) Experimental Procedure

[0079] Total RNA was extracted from heart tissue using the TRIZO1 method. After assessing RNA purity and integrity, 1 μg of RNA was reverse transcribed into cDNA using a reverse transcription kit. Subsequently, PCR amplification was performed using the SYBR Green method in a real-time quantitative PCR instrument to detect the expression of genes such as ANF, BNP, MYH7, COLI, COLIII, and α-SMA. 18S rRNA was used as an internal control. The specific steps are as follows:

[0080] 1) Removal of residual genomic DNA: The removal system was prepared in RNase-free centrifuge tubes, gently mixed by pipetting, and incubated at 42°C for 2 min. The removal system is shown in Table 3.

[0081] Table 3

[0082] Components Usage <![CDATA[RNase-free H2O]]> To 15μL 5×gDNA digester mix (included in the reverse transcription kit) 3μL Total RNA 1000ng

[0083] 2) Preparation of reverse transcription reaction system (20 μL system): Using the reaction solution after removing the system, add the following according to the system shown in Table 4. The reverse transcription reaction is performed using the plus (included in the reverse transcription kit). The reaction conditions for reverse transcription are 25℃ for 5 min; 55℃ for 15 min; and 85℃ for 5 min.

[0084] Table 4

[0085]

[0086] 3) qPCR detection: The qPCR reaction system is shown in Table 5; the qPCR reaction conditions are shown in Table 6; and the primers used are shown in Table 7.

[0087] Table 5

[0088]

[0089] Table 6

[0090] first step temperature time 42℃ 2min Step 2 25℃ 5min 55℃ 15min 85℃ 5min

[0091] Table 7

[0092]

[0093] Finally, the relative expression level was calculated using the ΔΔCt method, and the results were normalized with the RC group as the control.

[0094] 2) Data Analysis

[0095] The mRNA expression levels of the above genes are as follows: Figure 1As shown in (O), the expression levels of ANF, BNP and MYH7 genes related to myocardial hypertrophy were significantly upregulated in HFpEF model mice, and succinic acid supplementation could effectively inhibit the increase in the expression levels of the above genes; the expression levels of COLI, COLIII and α-SMA genes related to myocardial fibrosis were significantly upregulated in HFpEF model mice, and succinic acid supplementation could effectively inhibit the increase in the expression levels of the above genes.

[0096] Example 7: Succinate intervention in a cardiomyocyte-specific knockout GPR91 HFpEF model

[0097] To investigate whether the effect of succinate in improving HFpEF depends on the GPR91 receptor in cardiomyocytes, this study constructed cardiomyocyte-specific GPR91 gene knockout mice using the Cre-loxP system. HFpEF models were then established in these mice and control mice using the "Two-Hit" method. Succinate was administered via drinking water for 1.5% of the solution for 12 weeks. Multiple functional and histological examinations were performed after the intervention. The animal model construction process is as follows:

[0098] 1) Animal model construction

[0099] Male Myh6-Cre mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd., strain number T004713, and female Gpr91^flox / flox mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd., strain number T052144. Myh6-Cre mice and Gpr91^flox / flox mice were mated to obtain cardiomyocyte-specific knockout GPR91 mice.

[0100] 2) Identification of the genotype of GPR91 mice specifically knocked out of cardiomyocytes

[0101] Tail tip tissue from GPR91 knockout mice was collected using cardiomyocytes. The tail tissue was lysed with proteinase K, and DNA was purified by ethanol precipitation. PCR amplification was performed using specific primers designed by the company for the GPR91 gene knockout fragment (primers T052144-F2 (G91F) and T052144-R2 (G91F)) and specific primers for Cre recombinase (primers T004713-F1A and T004713-R1A). The PCR amplification system consisted of 12.5 μL of 2×Rapid Taq Master Mix; 9.5 μL of ddH2O; 1 μL of upstream primer; 1 μL of downstream primer; and 1 μL of template DNA. The primers used for PCR amplification are shown in Table 8. PCR products were detected by agarose gel electrophoresis, and mouse genotypes were determined based on band size. Positive and negative controls were included in all experiments to ensure accurate results. A positive control uses template DNA known to contain the target gene for amplification to verify the effectiveness of the PCR reaction system and primers, ensuring the appearance of the target band. A negative control uses a template-free reaction system (or a sample without the target DNA template) for PCR amplification to detect false positives caused by contamination. The PCR identification results of the GPR91 gene knockout fragment are as follows: Figure 2 (A) in the middle. Figure 2 In section (A), 1-19 represent the genotype verification of Gpr91^flox / flox mice. WT represents wild-type control mice, used as negative controls to exclude heterozygotes and ensure Gpr91^flox / flox is homozygous; "+" represents Gpr91^flox / flox positive mice, used as positive controls. M is the DNA molecular weight standard marker. The Cre recombinase PCR identification results are as follows... Figure 2 As shown in (B) in the diagram. Figure 2 In (B), 1-19 represent the experimental mouse genotypes of cardiomyocyte-specific GPR91 knockout (Myh6-Cre Gpr91^flox / flox) verified above, WT represents wild-type control mice as negative controls to ensure the absence of wild-type alleles, Myh6-Cre Gpr91^flox / flox mice are all homozygous, + represents Myh6-Cre mice as positive controls, and M represents DNA molecular weight marker. Figure 2 (A) in and in Figure 2The identification results in (B) showed that the mouse samples with GPR91 knockout in cardiomyocytes exhibited both a Cre-specific band (band size 329 bp) and a Gpr91^fl / fl band (band size 437 bp), while the control mice only showed the GPR91^fl / fl band and no Cre band. Therefore, it was confirmed that GPR91 was specifically knocked out in myocardial tissue, and the littermate control mice were GPR91^flox / flox.

[0102] Table 8

[0103] Primer number Primer name Primer sequence (5'-3') SEQ ID NO.13 T004713-F1A ATCAGAAAGGAGAATGTGGATGCTG SEQ ID NO.14 T004713-R1A ATGTTCACATTGGTCCAGCCACC SEQ ID NO.15 T052144-F2(G91F) AGAAGGGCTTGTCAGACTTGTCAG SEQ ID NO.16 T052144-R2(G91F) GTGAATCTAGTCAGAGACATTGCAGC

[0104] After successfully constructing cardiomyocyte-specific GPR91 knockout mice, they were subjected to a "Two-Hit" modeling strategy and succinate intervention. Figure 3 (A) in the diagram is a schematic diagram of the experimental procedure.

[0105] 3) Succinate intervention in the cardiomyocyte-specific knockout GPR91 HFpEF model

[0106] Cardiac cell-specific knockout GPR91 mice were subjected to a "Two-Hit" modeling strategy starting at 8 weeks of age. This involved feeding them a high-fat diet (60% fat energy) and adding L-NAME to their drinking water at a final concentration of 0.5 g / L for 12 weeks to induce the HFpEF phenotype. From day 1 of the HFpEF modeling experiment, 1.5% (w / v) succinic acid was added to the drinking water (1.5 g succinic acid per 100 mL of water, completely dissolved) for the mice to drink freely. This intervention continued until mouse data collection was completed. To ensure drug stability, the drinking water was changed every two days.

[0107] 5) Experimental Grouping

[0108] Mice were randomly divided into the following groups (n=8 per group):

[0109] The control HFpEF group, also known as the HFpEF GPR91fl / fl group, was a group of GPR91flox / flox mice fed a high-fat diet (fat accounting for 60% of total calories) and L-NAME was added to their drinking water at a final concentration of 0.5 g / L, thus establishing the HFpEF model mouse based on the GPR91flox / flox mice.

[0110] The control group HFpEF + succinic acid group, also known as the HFpEF + SUC GPR91fl / fl group, was fed a high-fat diet (fat accounted for 60% of the total calories) and had L-NAME and succinic acid at a final concentration of 0.5 g / L added to their drinking water. This was to provide succinic acid intervention to the HFpEF model mice established based on GPR91flox / flox mice.

[0111] Cardiac cell-specific knockout GPR91HFpEF group: also known as HFpEF Myh6Cre GPR91fl / fl group, cardiac cell-specific GPR91 knockout mice were fed a high-fat diet (fat accounted for 60% of total calories), and L-NAME was added to the drinking water at a final concentration of 0.5 g / L, so that HFpEF model mice were established on the basis of cardiac cell-specific GPR91 knockout mice;

[0112] Cardiac cell-specific GPR91 knockout GPR91 HFpEF + succinic acid group: also known as HFpEF + SUC Myh6CreGPR91 fl / fl group. Cardiac cell-specific GPR91 knockout mice were fed a high-fat diet (fat accounted for 60% of total calories), and L-NAME and 1.5% (w / v) succinic acid were added to their drinking water. This was to provide succinic acid intervention to HFpEF model mice established based on cardiac cell-specific GPR91 knockout mice.

[0113] Example 8: Effects of succinic acid intervention on cardiac systolic and diastolic function in GPR91 HFpEF-type mice with cardiomyocyte-specific knockout.

[0114] At week 12 of intervention, echocardiography was performed on mice in the HFpEF GPR91fl / fl group, the HFpEF+SUC GPR91fl / fl group, the HFpEF Myh6Cre GPR91fl / fl group, and the HFpEF+SUC Myh6Cre GPR91fl / fl group to assess cardiac structure and function. The methods for obtaining indicators such as E / E', E / A, Tei index, GLS% and EF% were the same as in Example 2.

[0115] Figure 3 (B) shows the E / A test results and the E / E' test results. Figure 3 Image (C) shows a typical echocardiographic image of a mouse. From Figure 3 (B) and Figure 3As shown in (C), compared with the control HFpEF+succinic acid group mice, the E / A ratio and E / E' ratio of the cardiomyocyte-specific knockout GPR91HFpEF+succinic acid group mice remained elevated after succinic acid supplementation, without significant improvement, suggesting that succinic acid cannot play a role in improving left ventricular diastolic function. Figure 3 The results of GLS% detection are shown in (D). Figure 3 Image (E) shows the results of the Tei index detection. From... Figure 3 China (D) and Figure 3 As shown in Figure (E), succinic acid intervention failed to improve abnormal indicators such as increased cardiac compliance and myocardial work index in mice with a background of GPR91 deficiency in cardiomyocytes, indicating that succinic acid cannot play a role in improving diastolic function in the context of GPR91 deficiency in cardiomyocytes. Figure 3 The middle (F) diagram shows a typical longitudinal systolic function of the left ventricle, from... Figure 3 As shown in Figure (F), after specific knockout of GPR91 in cardiomyocytes, the overall longitudinal strain of the left ventricle in HFpEF mice was significantly reduced, and succinic acid supplementation could not improve the overall longitudinal strain of the mouse ventricle. Figure 3 (G) shows the EF% detection results. From Figure 3 As shown in (G), the EF value of HFpEF model mice with cardiomyocyte-specific GPR91 deficiency did not decrease significantly and still met the diagnostic characteristics of HFpEF.

[0116] The above results indicate that the beneficial effects of succinate on the HFpEF model depend on the presence of GPR91 in cardiomyocytes; under the condition of GPR91 deficiency, its cardioprotective effect is blocked, further verifying the function of GPR91 as a key receptor in the succinate signaling pathway.

[0117] Example 9: Effects of succinate intervention on motor function in GPR91 HFpEF model mice with cardiomyocyte-specific knockout

[0118] The motor abilities of mice in the HFpEF GPR91fl / fl, HFpEF+SUC GPR91fl / fl, HFpEFMyh6Cre GPR91fl / fl, and HFpEF+SUC Myh6Cre GPR91fl / fl groups were assessed using a rotarod test, following the same procedures as in Example 3. The exercise time was as follows... Figure 3 As shown in (H). From Figure 3As shown in Figure (H), the GPR91 knockout group of cardiomyocytes exhibited decreased exercise capacity, but succinic acid supplementation slightly improved their exercise capacity. Since the mice in this group also experienced a decrease in body weight after intervention, this improvement in exercise capacity may be related to body weight changes and cannot be directly confirmed to be related to the GPR91-mediated effect in the myocardium. This suggests that the improvement in exercise capacity by succinic acid may depend on the presence of GPR91 in other tissues.

[0119] Example 10: Measuring mouse heart weight and tibia length

[0120] The heart weight and tibia length of mice in the HFpEF GPR91fl / fl group, HFpEF+SUC GPR91fl / fl group, HFpEF Myh6CreGPR91fl / fl group, and HFpEF+SUC Myh6Cre GPR91fl / fl group were measured. The specific measurement steps were the same as in Example 4. Figure 3 Image (I) shows the gross morphology of the heart. From... Figure 3 As shown in (I), the heart volume of HFpEF mice with GPR91 knockout of cardiomyocytes increased, and no significant reversal was observed after succinic acid supplementation. Figure 3 (J) shows the heart weight / tibia length ratio results. From Figure 3 As shown in the study (J), the heart weight / tibia length ratio was increased in cardiomyocyte-specific GPR91 knockout HFpEF mice, and no significant reversal was observed after succinic acid supplementation.

[0121] Example 11 Histopathological Examination

[0122] At the end of the 12th week of intervention, heart tissue samples were collected from mice in the HFpEF GPR91fl / fl group, the HFpEF+SUC GPR91fl / fl group, the HFpEF Myh6Cre GPR91fl / fl group, and the HFpEF+SUC Myh6Cre GPR91fl / fl group, respectively, and subjected to HE staining, Masson staining, WGA staining, and Oil Red O staining. The staining steps were the same as in Example 5.

[0123] Figure 3 (K) in the figure shows the statistical results of the heart's cross-sectional area. Figure 3 (L) in the figure shows the statistical results of fibrosis. From Figure 2 As can be seen from (L), the control HFpEF group mice showed significant fibrosis, which was significantly alleviated after succinic acid supplementation. Figure 3 (M) shows the results of HE staining, Masson staining, WGA staining, and Oil Red O staining. Figure 3 (K)- Figure 3As shown in (M), HE staining revealed an increased cross-sectional area of ​​the heart in the HFpEF Myh6Cre GPR91fl / fl group of mice. Masson staining indicated an increased degree of myocardial fibrosis in the HFpEF Myh6Cre GPR91fl / fl group of mice. WGA staining showed hypertrophy of cardiomyocytes in the HFpEF Myh6Cre GPR91fl / fl group of mice. Oil Red O staining showed increased lipid deposition in the HFpEF Myh6Cre GPR91fl / fl group of mice. The above abnormal pathological phenotypes were not significantly alleviated after succinic acid supplementation, further indicating that the effect of succinic acid in improving myocardial remodeling in HFpEF depends on myocardial GPR91.

[0124] Example 12 Observation of the ultrastructure of myocardial mitochondria

[0125] To clarify whether succinate mediates mitochondrial protection through myocardial GPR91, the ultrastructure of cardiomyocytes in mice in the HFpEF GPR91fl / fl group, HFpEF+SUC GPR91fl / fl group, HFpEF Myh6CreGPR91fl / fl group, and HFpEF+SUC Myh6Cre GPR91fl / fl group was observed using transmission electron microscopy (TEM). The results are as follows: Figure 3 As shown in (N). From Figure 3 As shown in (N), the myocardial mitochondrial structure of the GPR91 knockout HFpEF model mice exhibited significant pathological damage, including mitochondrial swelling, disordered arrangement, vacuolar degeneration, and cristae breakage, and succinic acid supplementation failed to reverse these structural damages. This confirms that the protective effect of succinic acid on the myocardial mitochondrial structure in HFpEF depends on the expression and mediation of GPR91 in cardiomyocytes.

[0126] In summary, this invention, through the construction of an HFpEF mouse model, the specific knockout of the GPR91 gene in cardiomyocytes, combined with succinic acid intervention, and systematic observation of the ultrastructure of myocardial mitochondria using transmission electron microscopy, fully demonstrates that the mechanism of action of succinic acid in the prevention and treatment of HFpEF is a cardiomyocyte GPR91-dependent pathway. The absence of GPR91 in cardiomyocytes will significantly weaken the cardioprotective effect of succinic acid.

[0127] Example 13 RNA-seq analysis

[0128] This embodiment aims to screen for pathways / genes upregulated or activated under succinate intervention, and key pathways and molecules that undergo the opposite changes after GPR91 knockout in cardiomyocytes. This provides a theoretical basis and research direction for further in-depth exploration of the intervention mechanism of the succinate-GPR91 pathway in HFpEF. Single-cell RNA sequencing analysis was performed on heart tissues from mice in the HFpEF GPR91fl / fl, HFpEF+SUCGPR91fl / fl, HFpEF Myh6Cre GPR91fl / fl, and HFpEF+SUC Myh6Cre GPR91fl / fl groups. The specific steps are as follows:

[0129] a. Tissue collection and RNA extraction

[0130] Left ventricular myocardial tissue from mice was rapidly excised, quickly frozen in liquid nitrogen, and stored at -80°C. Total RNA was extracted using TRIzol reagent (see instruction manual). RNA concentration and purity were determined using a Nanodrop 2000, and RNA integrity was assessed using an Agilent 2100 bioanalyzer. RNA integrity (RIN) values ​​≥ 7.0 were required for subsequent library construction.

[0131] b. Library construction and sequencing

[0132] Library construction was performed using the TruSeq RNA Sample Prep Kit. mRNA was extracted, fragmented, and reverse transcribed to synthesize cDNA. After adapter ligation, the cDNA was amplified by PCR to obtain the library. After quality control, the library products were sequenced using the Illumina NovaSeq 6000 platform (paired-end 150bp).

[0133] c. Data processing and differential expression analysis

[0134] Sequencing data underwent adapter removal and low-quality read filtering using FASTP. High-quality reads were then aligned to the reference mouse genome (mm10) using HISAT2. FeatureCounts was used for quantification to obtain the expression levels of each gene (FPKM). Differential expression analysis was performed using DESeq2 software, with the following selection criteria:

[0135] |log2FC|≥1;FDR<0.05

[0136] d. Functional enrichment analysis

[0137] Gene Ontology (GO) functional annotation and KEGG pathway enrichment analysis were performed on differentially expressed genes (DEGs), and visualization was achieved using the R package. Furthermore, heatmaps and enrichment bubble charts were generated to display key pathways.

[0138] e. Experimental Results

[0139] KEGG pathway enrichment analysis was performed on transcriptome data from mice in the control HFpEF+succinate group (upregulated pathways compared to the control HFpEF group) and mice in the cardiomyocyte-specific knockout GPR91 HFpEF+succinate group (downregulated pathways compared to the control HFpEF+succinate group). Results Figure 4 As shown. From Figure 4 It was found that there were significant differences in the responses of the two groups of mice after succinic acid intervention. After Venn diagram intersection analysis of the differentially expressed pathways, common pathways that were upregulated in the HFpEF+SUC GPR91fl / fl group and downregulated in the HFpEF+SUC Myh6Cre GPR91fl / fl group were identified. The results showed that the AMPK signaling pathway was the core intersection pathway. Supplementation with succinic acid in control HFpEF mice significantly activated the AMPK signaling pathway, which is closely related to glucose and lipid metabolism and energy metabolism. However, in HFpEF mice with cardiomyocyte-specific GPR91 deficiency, the activity of this pathway remained downregulated even after succinic acid supplementation. This suggests that the activation effect of succinic acid on the AMPK pathway depends on the presence of GPR91 in cardiomyocytes. That is, when cardiomyocyte GPR91 expression is normal, succinic acid can activate the AMPK pathway; while under cardiomyocyte-specific GPR91 knockout conditions, this pathway cannot be activated, which may be the mechanistic basis for succinic acid's improvement of diastolic dysfunction in HFpEF mice.

[0140] GO biological process enrichment analysis was performed on transcriptome data from mice in the control HFpEF+succinate group (upregulated pathways compared to the control HFpEF group) and mice in the cardiomyocyte-specific knockout GPR91+succinate group (downregulated pathways compared to the control HFpEF+succinate group). Results Figure 5 As shown. From Figure 5 It can be seen that NAD + Multiple GO pathways closely related to energy metabolism, including biosynthesis, fatty acid metabolism, and glucose transport, were enriched and downregulated in cardiomyocyte-specific GPR91 knockout HFpEF+succinate mice, suggesting a significant disruption of metabolic homeostasis. Venn diagram intersection analysis of transcriptome GO pathway enrichment results in the control HFpEF+succinate group and the cardiomyocyte-specific GPR91+succinate knockout group further confirmed the presence of NAD+. +The fact that both the metabolic pathway and the glycolipid metabolic pathway are core metabolic pathways that are affected further illustrates that GPR91 is an important molecular target for succinate-mediated metabolic reprogramming.

[0141] Gene expression clustering heatmap analysis results are as follows Figure 6 As shown in (A) in the diagram. From Figure 6 As shown in (A), the expression of genes related to downstream glucose and lipid metabolism pathways of AMPK was reduced in HFpEF model mice with cardiomyocyte-specific GPR91 deficiency, and it did not recover significantly after succinic acid supplementation; in contrast, the above genes were significantly upregulated in the control group after succinic acid supplementation.

[0142] Example 14 Real-time quantitative PCR

[0143] The expression levels of AMPK downstream target genes (Fabp2, Irs1, Adra1a, Pfkfb1, Igf1r, Acacb) in the heart tissues of mice in the HFpEF GPR91fl / fl, HFpEF+SUC GPR91fl / fl, HFpEF Myh6Cre GPR91fl / fl, and HFpEF+SUC Myh6Cre GPR91fl / fl groups were detected using real-time quantitative PCR. Total RNA was extracted using TRIZOL reagent, and cDNA was synthesized by reverse transcription using a reverse transcription kit. Real-time quantitative PCR was performed using... qPCR using SYBR Green Master Mix was performed on a real-time quantitative PCR system. The sample loading system and amplification procedure for real-time quantitative PCR were specified in the reagent instructions provided with the kit. The 18S gene was used as an endogenous control, and a 2-ΔΔCT method was employed for semi-quantitative analysis. Primers used are listed in Table 9.

[0144] Table 9

[0145]

[0146] The results of detecting the expression levels of downstream target genes of AMPK, such as Figure 6 As shown in (B) in the diagram. Figure 6 (B) further validated that the overall expression of genes related to downstream glucose and lipid metabolism pathways of AMPK was reduced in HFpEF model mice with cardiomyocyte-specific GPR91 deficiency, and this expression did not significantly recover after succinate supplementation; in contrast, the above genes were significantly upregulated in the control group after succinate supplementation. Consistent with the results of gene expression clustering heatmap analysis, this indicates that the regulation of metabolism-related genes by succinate depends on GPR91.

[0147] Example 15: Detection of AMPK and its phosphorylation level

[0148] The levels of AMPK and its phosphorylation in the heart tissues of mice in the HFpEF GPR91fl / fl, HFpEF+SUC GPR91fl / fl, HFpEF Myh6Cre GPR91fl / fl, and HFpEF+SUC Myh6Cre GPR91fl / fl groups were detected by Western blotting. The steps of the Western blotting method are as follows:

[0149] 1) Experimental Procedure

[0150] 1. Tissue sampling and protein extraction: Take an appropriate amount of heart tissue (about 10 mg) and add it to pre-cooled RIPA lysis buffer (containing 1× phosphatase inhibitor and PMSF at a final concentration of 1 mM). Hydrate thoroughly using a homogenizer. Then centrifuge at 12,000 rpm for 15 minutes and collect the supernatant as the total protein sample.

[0151] 2. Protein quantification and sample preparation: The protein concentration in the supernatant was determined using the BCA protein quantification kit. The assay method was performed according to the instructions provided with the kit. 20 μL of supernatant (40 μg of protein) was added to 80 μL of 5×SDS loading buffer, and the mixture was boiled in a metal bath at 95°C for 5 minutes before use.

[0152] 3. SDS-PAGE gel electrophoresis and transfer: Using a pipette, load the denatured protein sample (40 μg protein) into the wells of a 10% SDS-PAGE gel and perform electrophoresis at 80 V for 135 minutes in electrophoresis buffer. Soak a 0.45 μm PVDF membrane in methanol for 1 min. After SDS-PAGE gel electrophoresis, stack the membrane in the following order: foam-filter paper-PVDF-gel-filter paper-foam, gently remove air bubbles between the membrane and gel, clamp tightly, and place in the transfer tank. Fill the transfer tank with transfer buffer and transfer at 400 mA for 1 hour. After transfer, block with 5% BSA blocking buffer at room temperature for 1 hour.

[0153] 4. Primary antibody incubation

[0154] The three transferred PVDF membranes were incubated overnight at 4°C in AMPK antibody solution, p-AMPK antibody solution, and GAPDH antibody solution, respectively. The AMPK antibody solution was a solution with a volume ratio of AMPK antibody to 5% BSA blocking buffer of 1:1000; the p-AMPK antibody solution was a solution with a volume ratio of p-AMPK antibody to 5% BSA blocking buffer of 1:1000; and the GAPDH antibody solution was a solution with a volume ratio of GAPDH antibody to 5% BSA blocking buffer of 1:1000.

[0155] 5. Secondary antibody incubation and color development: The following day, wash the membrane three times with 1×TBST, 10 minutes each time; incubate with HRP-labeled secondary antibody (6.7 μL of HRP-labeled secondary antibody added to 20 mL of 5% BSA blocking buffer) for 1 hour. Wash the membrane three times with TBST, 10 minutes each time; after washing, use ECL chemiluminescence reagent for color development, and acquire images using a chemiluminescence analyzer.

[0156] 6. Data Analysis: ImageJ was used to measure the gray values ​​of AMPK and p-AMPK bands, the relative expression levels of p-AMPK / AMPK were calculated, and the values ​​were normalized to the internal reference.

[0157] 2) Experimental Results

[0158] Figure 7 (A) in the figure shows the colorimetric results of the Western blotting. Figure 7 (B) in the figure shows the statistical results of the Western Blot. Figure 7 (A) and Figure 7 As shown in (B), succinic acid can significantly enhance the phosphorylation level of AMPK in the heart tissue of mice in the control HFpEF group, while no such effect was observed in the HFpEF+SUC Myh6Cre GPR91fl / fl group, further verifying that succinic acid needs to mediate the activation of the AMPK signaling pathway through GPR91.

[0159] Example 16: Detection of succinate levels in cardiac tissue

[0160] The succinic acid levels in the heart tissues of mice in the HFpEF GPR91fl / fl, HFpEF+SUC Myh6Cre GPR91fl / fl, and HFpEF+SUC Myh6Cre GPR91fl / fl groups were detected by enzyme-linked immunosorbent assay (ELISA). The kit used in this example was a succinic acid colorimetric assay kit.

[0161] 1) Experimental Procedure

[0162] 1. Before testing, equilibrate the reagents in the kit to 25°C.

[0163] 2. Prepare each working solution, colorimetric solution, and standard according to the instructions.

[0164] 3. Homogenize the tissue sample at a ratio of 1:9 (tissue sample mass (g): double-distilled water volume (mL)) and centrifuge at 10000×g for 10 min at 4 degrees Celsius. Take 400 μL of the supernatant, add it to a 10 KD ultrafiltration tube, centrifuge at 12000×g for 15 min, and collect the filtrate from the outer tube for analysis.

[0165] 4. Operating steps:

[0166] ① Standard wells: Take 20 μL of standard solutions of different concentrations (2000 μg / ml, 1500 μg / ml, 1000 μg / ml, 750 μg / ml, 500 μg / ml, 250 μg / ml, 125 μg / ml, 25 μg / ml) and add them to the corresponding enzyme-labeled wells respectively;

[0167] Measurement wells: Take 20 μL of HFpEF+SUC GPR91fl / fl mouse heart tissue cell homogenate and 20 μL of HFpEF+SUC Myh6Cre GPR91fl / fl mouse heart tissue cell homogenate and add them to the corresponding enzyme label wells respectively.

[0168] Control wells: Add 20 μL of HFpEF GPR91fl / fl mouse heart tissue cell homogenate and 20 μL of HFpEF+Myh6Cre GPR91fl / fl mouse heart tissue cell homogenate to the corresponding enzyme-labeled wells respectively.

[0169] ② Add 30 μL of reagent five working solution to the standard well and the measurement well in step ①;

[0170] Add 30 μL of reagent one to the control well in step ①.

[0171] ③ Add 80 μL of the assay working solution to each well in step ②.

[0172] ④ Vibrate the plate for 5 seconds, then incubate at 37°C in the dark for 5 minutes.

[0173] ⑤ Add 120 μL of colorimetric working solution to each well in ④.

[0174] ⑥ Shake the plate for 5 seconds, incubate at 37°C in the dark for 20 minutes, and then use an ELISA reader to detect the OD value of each well at a wavelength of 555nm.

[0175] 2) Experimental Results

[0176] The results of succinic acid level testing are as follows Figure 8 As shown in (A) in the diagram. From Figure 8 As shown in (A), the cardiomyocyte-specific deletion of GPR91 does not affect the accumulation of exogenous succinic acid in cardiac tissue. After succinic acid supplementation, a significant increase in cardiac succinic acid levels was detected in both groups of mice, indicating that GPR91 deficiency does not block the distribution of succinic acid in cardiac tissue. However, its signal transduction function is weakened, preventing its downstream effects from being realized.

[0177] Example 17 Detection of NAD + Levels and NAD + / NADH ratio change

[0178] NAD+ levels in the heart tissues of mice in the HFpEF GPR91fl / fl, HFpEF+SUC GPR91fl / fl, HFpEFMyh6Cre GPR91fl / fl, and HFpEF+SUC Myh6Cre GPR91fl / fl groups were detected by colorimetric assay. + Levels and NAD + Changes in the NAD+ / NADH ratio. The kit used in this example is an NAD+ / NADH detection kit.

[0179] 1) Experimental Procedure

[0180] 1. Sample Preparation: After washing the tissue with pre-chilled PBS on ice, weigh approximately 20 mg of the tissue sample, cut it into small pieces with scissors, place it in a homogenizer, add 400 μL of NAD / NADH extraction buffer (included in the NAD+ / NADH detection kit), and homogenize on ice. Then, centrifuge at 12000 g for 8 minutes at 4°C, and collect the supernatant as the sample to be tested.

[0181] 2. Preparation of the reagent kit:

[0182] a. Preparation of NADH standard: Pipette 655 μL of NADH preparation solution and thoroughly dissolve 5 mg of NADH provided by the NAD+ / NADH assay kit to obtain 10 mM NADH standard. Aliquot the 10 mM NADH standard and store at -80°C protected from light.

[0183] b. Setting up the NADH standard curve: Dilute 10 mM NADH standard with NAD / NADH extraction buffer to create a concentration gradient of 0 μM, 0.25 μM, 0.5 μM, 1 μM, 2 μM, 4 μM, 6 μM, 8 μM, and 10 μM. For assays, add 20 μL of the standard to each well of a 96-well plate, equivalent to 0, 5 pmol, 10 pmol, 20 pmol, 40 pmol, 80 pmol, 120 pmol, 160 pmol, and 200 pmol of NADH per well. Note: Because NADH is very unstable, it should be used as soon as possible after preparation.

[0184] c. Preparation of alcohol dehydrogenase working solution: Add 2 μL of alcohol dehydrogenase from the NAD+ / NADH assay kit to 88 μL of reaction buffer to obtain 90 μL of alcohol dehydrogenase working solution. Each standard or sample assay requires 90 μL of alcohol dehydrogenase working solution; prepare and use immediately.

[0185] 3. Sample determination:

[0186] a. NAD in the sample +Determination of total NADH levels: Pipette 20 μL of the sample to be tested into a 96-well plate. To reduce experimental error, it is recommended to set up duplicate wells for two samples.

[0187] b. NAD in the sample + Determination of NADH content or NAD+ / NADH ratio: Pipette 80 μL of the sample to be tested into a centrifuge tube and heat in a 60°C water bath for 30 minutes to decompose NAD+. + If insoluble matter is produced after heating, centrifuge at 10,000g for 5 minutes at 4°C, and aspirate 20μL of the supernatant as the test sample into a 96-well plate. To reduce experimental error, two replicate wells are set up for the test sample.

[0188] c. Refer to Table 10 to set up blank control wells, standard wells, and sample wells using a 96-well plate. Add the alcohol dehydrogenase working solution and mix thoroughly.

[0189] Table 10

[0190] Blank control Standard products sample Sample to be tested / 20μL 20μL <![CDATA[NAD + / NADH extract]]> 20μL / / Ethanol dehydrogenase working solution 90μL 90μL 90μL

[0191] d. Incubate at 37℃ in the dark for 10 minutes. The purpose of this incubation step is to convert NAD+ in the sample to NADH; handle gently when adding the alcohol dehydrogenase working solution to avoid generating air bubbles. If air bubbles accidentally appear, puncture them with a fine pipette tip or needle.

[0192] e. Add 10 μL of chromogenic solution to each well, mix well, and incubate at 37°C in the dark for 30 minutes. At this time, orange-yellow formazan will be formed. Measure the absorbance at 450 nm using a microplate reader.

[0193] 4. NAD in the sample + / NADH calculation

[0194] a. Calculate the average absorbance of each point in the standard group, and subtract the absorbance of the blank control group to get the absorbance of each standard.

[0195] b. Plot a standard curve with NADH concentration on the x-axis and absorbance on the y-axis.

[0196] c. Calculate the total NAD+ and NADH concentrations, or the NADH concentration, in the tissue sample based on the standard curve. Without heating to 60℃, the measured concentration is NAD+. + The concentration of NADH is measured by heating at 60°C; the concentration of NADH in the sample is then measured.

[0197] Note: NAD can be calculated based on the detected concentration and sample volume. + The total amount of NADH and NAD.

[0198] d. Calculate according to the following formula:

[0199] NAD + =NAD Total -NADH;NAD + / NADH=(NAD Total Calculate NAD in the sample using (-NADH) / NADH. + The amount and NAD + The ratio of NAD / NADH. At this point, NAD can be... + The total amount of NADH or their respective contents are expressed as the content per unit tissue weight.

[0200] 2) Experimental Results

[0201] NAD + The horizontal detection results are shown in the figure. Figure 8 As shown in (B) of NAD. + / NADH ratio as follows Figure 8 As shown in (C). From Figure 8 (B) and Figure 8 As shown in (C), succinic acid supplementation in HFpEFGPR91fl / fl mice significantly increased NAD3 levels in cardiac tissue. + The content and redox ratio of succinate were observed, but this change was not observed in the group with cardiomyocyte-specific GPR91 deficiency, indicating that succinate enhances NAD+ levels. + The level of succinate also depends on the presence of GPR91. These results indicate that cardiomyocyte-specific knockout of GPR91 significantly weakens the role of succinate in regulating NAD+. + The role of NAD in metabolism and myocardial energy metabolism + Disruption of homeostasis may be one of the key mechanisms by which it loses its ability to improve diastolic function.

[0202] In summary, to clarify the specific molecular mechanism by which succinate-dependent GPR91 in cardiomyocytes improves HFpEF, this invention provides an experimental protocol based on single-cell transcriptomics combined with molecular validation methods. This involves collecting HFpEF GPR91 cells... fl / fl Group mice, HFpEF+SUC GPR91 fl / fl Group of mice, HFpEF Myh6 Cre GPR91 fl / fl Group mice and HFpEF+SUC Myh6 Cre GPR91 fl / flSingle-cell RNA sequencing analysis was performed on heart tissue from mice, and combined with multi-omics techniques such as Western blot, qPCR, and ELISA, it was determined that succinate can activate GPR91 receptors in cardiomyocytes, thereby regulating the AMPK signaling pathway and enhancing glucose and lipid metabolism and NAD+. + Succinate plays a crucial role in improving the pathological state of HFpEF by promoting the production of GPR91 in cardiomyocytes and other key processes. The expression of GPR91 in cardiomyocytes plays a key mediating role in this process, and its deficiency significantly weakens the intervention effect of succinate on HFpEF.

[0203] Example 18: In vitro experiment with primary cardiomyocytes

[0204] 1) Animal source

[0205] Fifteen 2-day-old wild-type C57BL / 6J mice (referred to as WT in this embodiment) were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.; and 15 2-day-old GPR91KO mice, strain number T003408, were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.

[0206] 1) Cardiac cell isolation and culture

[0207] Two-day-old WT and two-day-old GPR91KO mice were disinfected with 75% alcohol, and their hearts were harvested. Thrombi and excess connective tissue were removed, and the heart tissue was minced. The procedure for isolating cardiomyocytes was as follows: the heart tissue was placed in 3 mL of 0.04% collagenase II digestion solution and incubated at 37°C for 8 minutes. Then, 3 mL of (v / v) 10% FBS was added to terminate digestion. The supernatant was collected and centrifuged to collect the cell pellet. This process was repeated 6 times. The cell pellet was resuspended using a pipette, and the seven cell collections were combined, with the cell density adjusted to 1×10⁻⁶. 6 After reaching a cell / mL concentration, the cell suspension was diluted 5-fold using DMEM high-glucose medium (containing 10 (v / v)% FBS, 1 (v / v)% penicillin-streptomycin solution and 1% (v / v) BrdU antibody) and seeded into culture plates pre-coated with laminin (LN) and incubated at 37°C.

[0208] 2) Experimental grouping and intervention

[0209] After 48 hours of culture, when the primary cardiomyocytes were stably adhered to the culture vessel, they were divided into the following four groups: Control group: WT mouse primary cardiomyocytes received no treatment; Control + succinate treatment group: WT mouse primary cardiomyocytes were stimulated with 400 μM succinate; GPR91 knockout group: GPR91KO mouse primary cardiomyocytes received no treatment; GPR91 knockout + succinate treatment group: GPR91KO mouse primary cardiomyocytes were stimulated with 400 μM succinate.

[0210] Three experimental wells were designed for each group, and the four groups of primary cardiomyocytes were placed in a 37-degree constant temperature incubator for culture.

[0211] 3) After succinic acid intervention for 5 min, the culture medium was quickly discarded on ice, and the cells were gently washed twice with pre-chilled PBS. Then, 100 μL of pre-chilled RIPA lysis buffer (containing 1× phosphatase inhibitor and 1 mM PMSF) was added, and the cells were lysed on ice for 5 min. Cell lysis products were thoroughly scraped off using a cell scraper and collected into centrifuge tubes. The tubes were centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatant was used as the total protein. The protein concentration in the supernatant was determined using a BCA protein quantification kit, following the instructions provided with the kit. 20 μL of the supernatant (20 μg of protein) was added to 80 μL of 5×SDS loading buffer, and the mixture was boiled in a 95°C metal bath for 5 min before use.

[0212] 4) Western blot detection of AMPK phosphorylation level

[0213] The SDS-PAGE gel electrophoresis and transfer steps, primary antibody incubation steps, and secondary antibody incubation and color development steps in Western blot are the same as in Example 15.

[0214] Figure 9 This is a graph showing the effect of succinic acid stimulation on significantly increasing AMPK phosphorylation levels in cardiomyocytes of control mice; from Figure 9 The results showed that, compared with the control group, the p-AMPK / AMPK ratio in cardiomyocytes of mice treated with succinate was significantly increased, indicating that AMPK activity was significantly enhanced in the control group treated with succinate. Compared with the GPR91 knockout group, the p-AMPK / AMPK ratio in cardiomyocytes of mice treated with GPR91 knockout and succinate was not significantly changed, further supporting the idea that succinate can activate metabolic regulatory pathways in cardiomyocytes. This effect was most significant in WT cardiomyocytes with normal GPR91 expression, suggesting that activation of the AMPK pathway depends on GPR91-mediated upstream signaling.

[0215] Example 19 NAM Reversal Experiment

[0216] Given that NAM is NAD + The direct precursor for synthesis, in this embodiment, is NAM as a succinate-dependent GPR91-mediated AMPK activation, thereby promoting NAD. + Terminal compensation of the synthetic pathway was used to evaluate the key role of this signaling axis in improving energy metabolism in the HFpEF model. After the intervention, the following groups of mice were tested to evaluate the reversal effect of NAM. The specific experimental procedure is shown below:

[0217] 1) Experimental animals and grouping: Eight wild-type C57BL / 6J mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd.; 30 GPR91 whole-body knockout mice (strain number T003408) were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. The GPR91 whole-body knockout mice were randomly divided into two groups as follows:

[0218] WT RC group: Wild-type C57BL / 6J mice were fed a normal diet as a normal control group for 12 consecutive weeks; GPR91 KO+HFpEF group: GPR91 knockout mice were fed a high-fat diet, and L-NAME was added to their drinking water at a final concentration of 0.5 g / L to induce the HFpEF model, and the intervention lasted for 12 consecutive weeks; GPR91 KO HFpEF+NAM group: GPR91 knockout mice were fed a high-fat diet, and L-NAME and NAM were added to their drinking water at a final concentration of 0.5 g / L and a final concentration of 40 mM to induce the HFpEF model, and NAM was added as an intervention, and the intervention lasted for 12 consecutive weeks.

[0219] Figure 10 (A) in the diagram is the experimental flowchart.

[0220] 2) Weight changes:

[0221] Mice in the control group, GPR91 KO+HFpEF group, and GPR91 KO+HFpEF+NAM group were weighed weekly, and the results are as follows: Figure 10 As shown in (B) in the diagram. From Figure 10 As can be seen in (B), the weight gain of mice in the "Two-Hit" induced HFpEF model group slowed down after supplementation with NAM.

[0222] 3) Cardiac function assessment

[0223] Echocardiography was used to detect parameters such as EF, E / A, E / e', and GLS in the mice in the above groups to evaluate the reversal effect of NAM.

[0224] At the end of the 12th week of intervention, echocardiography was performed on mice in the WT RC group, GPR91KO HFPEF group, and GPR91KO HFpEF+SUC group to assess cardiac structure and function. The methods for obtaining indicators such as E / E', E / A, Tei index, GLS% and EF% were the same as in Example 2.

[0225] Figure 10 (C) in the image is a typical image of mouse echocardiography. Figure 10 (D) and Figure 10 (E) in the figure shows the detection results of the E / A ratio and the E / E' ratio. From Figure 10 (C)- Figure 10 As can be seen from (E), compared with the GPR91KO+HFpEF group mice, the E / A and E / E' ratios of the GPR91KO HFpEF+NAM group mice were decreased, suggesting that NAM can improve left ventricular diastolic function to some extent. Figure 10 The middle (F) image shows a typical image of the longitudinal systolic function of the left ventricle. Figure 10 (G) in the figure shows the detection result of GLS%. Figure 10 (H) in the figure shows the detection results of the Tei index. From Figure 10 (G)- Figure 10 As can be seen from (H), after NAM intervention, the absolute value of GLS% in GPR91KO HFpEF mice increased and the Tei index decreased, indicating that myocardial longitudinal strain capacity and overall myocardial function were improved to a certain extent, and NAM has a partial metabolic compensation effect. Figure 10 (I) shows the EF% detection results. From Figure 10 As shown in (I), the EF value did not change significantly before and after NAM intervention, remaining within the diagnostic range for HFpEF. Furthermore, compared to the WT RC group mice, the overall cardiac function (including E / A, E / E', GLS%, Tei index, etc.) of the GPR91KO HFpEF group mice was significantly reduced, suggesting that GPR91 deficiency in cardiomyocytes itself can lead to diastolic dysfunction and decreased myocardial compliance. In conclusion, NAM, as a metabolic end-compensation strategy, can improve cardiac function in HFpEF mice with GPR91 deficiency to some extent, but it cannot completely replace the core role of GPR91 in succinate-mediated cardiac function protection.

[0226] Example 20

[0227] This embodiment illustrates the use of human cardiomyocyte cell line AC16 subjected to normal control (CON) and high glucose-high lipid (HG+PA) stimulation, followed by intervention with succinate (SUC) and a Gq inhibitor (Gqi), respectively, and analysis of changes in AMPK phosphorylation levels. In this embodiment, YM-254890 was selected as the Gq inhibitor, which can inhibit the regulatory effect of Gq protein on AMPK phosphorylation by blocking the Gq protein-mediated signaling pathway. The specific steps are as follows:

[0228] 1) Cell culture:

[0229] 1. Cell resuscitation: The human cardiomyocyte line AC16 was removed from liquid nitrogen and quickly thawed in a 37°C water bath. The cell suspension was transferred to 10 mL of preheated DMEM high-glucose medium (containing 10 (v / v)% fetal bovine serum and 1 (v / v)% penicillin-streptomycin solution) in a 10 cm dish, and the cells were placed in a constant temperature incubator (37°C, 5% CO2) for static culture.

[0230] 2. Cell passage: When the cell confluence reaches 75%-85%, perform passage: a. Discard the old culture medium, wash the cells once slowly with 1×PBS to remove residual serum; b. Add 1 mL of 0.25% trypsin, incubate at 37℃ for 2 minutes, and gently tap the edge of the culture dish to observe cell detachment; c. Add 2 mL of DMEM high-glucose medium (containing 10 (v / v)% fetal bovine serum) to stop digestion, and gently pipette to mix the cells; d. Transfer the cell suspension to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 minutes; e. Discard the supernatant, and resuspend the cells in fresh DMEM high-glucose medium (containing 10 (v / v)% fetal bovine serum).

[0231] 3. Seedling into six-well plates: After counting the cells, seed at a rate of 1×10⁻⁶. 5 Cells / well were seeded at a density of 1 μg / cm² pre-coated with laminin. 2 In a six-well plate, the final volume of DMEM high-glucose medium (containing 10 (v / v)% fetal bovine serum) in each well is 2 mL. The cells are cultured overnight to allow them to adhere to the plate, and then the next day, the cells are ready for treatment.

[0232] 2) Treatment and grouping: The cells were divided into the following groups:

[0233] Normal control group (CON): No irritants were added to the culture medium;

[0234] Normal control + succinic acid group (CON+SUC): After stimulation with succinic acid at a final concentration of 400 μM for 5 min, cell proteins were collected;

[0235] Normal control + Gq inhibitor group (CON+Gqi): Cell proteins were collected after 1 h of pretreatment with Gqi at a final concentration of 1 μM.

[0236] Normal control + Gq inhibitor + succinic acid group (CON + Gqi + SUC): After pretreatment with Gqi at a final concentration of 1 μM for 1 h, succinic acid at a final concentration of 400 μM was added for 5 min and cell proteins were collected.

[0237] High glucose and high fat stimulation group (HG+PA): High concentrations of glucose (final concentration 33mM) and palmitic acid (final concentration 200μM) were added to the culture medium and cultured for 48h to simulate metabolic stress.

[0238] High glucose and high fat stimulation + succinic acid group (HG+PA+SUC): High concentrations of glucose (final concentration 33mM) and palmitic acid (final concentration 200μM) were added to the culture medium and cultured for 48h to simulate metabolic stress. Cell proteins were collected after stimulation with 400μM succinic acid for 5min.

[0239] High glucose and high fat stimulation + Gq inhibitor group (HG+PA+Gqi): High concentrations of glucose (final concentration 33mM) and palmitic acid (final concentration 200μM) were added to the culture medium and cultured for 48h to simulate metabolic stress. Cell proteins were collected after 1h of Gqi pretreatment.

[0240] High glucose and high fat stimulation + Gq inhibitor + succinic acid group (HG+PA+Gqi+SUC): High concentrations of glucose (final concentration 33mM) and palmitic acid (final concentration 200μM) were added to the culture medium and cultured for 48h to simulate metabolic stress. After 1h of Gqi pretreatment, succinic acid with a final concentration of 400μM was added for 5min and cell proteins were collected.

[0241] 3) Protein extraction:

[0242] After treatment, the culture medium was quickly discarded on ice, and the cells were gently washed twice with pre-chilled PBS. Then, 100 μL of pre-chilled RIPA lysis buffer (1× phosphatase inhibitor and 1 mM PMSF) was added, and the cells were lysed on ice for 5 minutes. Cell lysis products were thoroughly scraped off using a cell scraper and collected into centrifuge tubes. The tubes were centrifuged at 12,000 rpm for 15 minutes at 4°C, and the supernatant was collected as total protein. The protein concentration in the supernatant was determined using a BCA protein quantification kit, following the instructions provided with the kit. 20 μL of the supernatant (20 μg of protein) was added to 80 μL of 5×SDS loading buffer, and the mixture was boiled in a 95°C metal bath for 5 minutes before use.

[0243] 4) Western blot analysis:

[0244] The expression levels of AMPK and its phosphorylated form (p-AMPK) were detected by Western blot, with GAPDH used as an internal control. The SDS-PAGE gel electrophoresis and membrane transfer steps, primary antibody incubation steps, and secondary antibody incubation and color development steps in the Western blot were the same as in Example 15.

[0245] 5) Data Analysis:

[0246] The relative expression levels of p-AMPK / AMPK in each group were determined using image analysis software. The differences between the groups were compared to evaluate the regulatory effects of succinic acid and Gq inhibitors on AMPK phosphorylation levels. Figure 11 This is a graph showing the effect of succinic acid-GPR91 on AMPK activation via Gq; from Figure 11 It was found that succinic acid treatment significantly increased AMPK phosphorylation levels in both the control and HG+PA treatment groups, and this activation effect was significantly weakened upon further addition of Gqi. These results indicate that succinic acid can activate the AMPK pathway through the GPR91-Gq signaling axis, thereby exerting its regulatory role.

[0247] Figure 12 This diagram illustrates how succinic acid-GPR91 improves HFpEF diastolic dysfunction by activating AMPK through the Gq signaling pathway, thereby promoting increased NAD+ production.

[0248] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. The use of GPR91 activator in the preparation of drugs for the prevention and / or treatment of heart failure with preserved ejection fraction, characterized in that, The GPR91 activator is an endogenous metabolite capable of activating GPR91; the endogenous metabolite is succinic acid.

2. The application according to claim 1, characterized in that, Application of GPR91 activator in the preparation of drugs that induce AMPK phosphorylation.

3. The application according to claim 1, characterized in that, Application of GPR91 activator in the preparation of drugs that enhance NAD+ levels.

4. The application according to claim 1, characterized in that, Application of GPR91 activators in the preparation of drugs to improve myocardial energy disorders and / or myocardial diastolic dysfunction.

5. The application according to any one of claims 1-4, characterized in that, The dosage of succinic acid in the drug is not less than 1.5 (w / v)%.

6. The application according to any one of claims 1-4, characterized in that, The drug also contains a pharmaceutically acceptable carrier.

7. The application according to claim 6, characterized in that, The carrier includes at least one of a diluent, disintegrant, adhesive, preservative, isotonic agent, lubricant, stabilizer, or surfactant.