Application of sodium oxamate in preparation of medicine for resisting iridovirus

Abstract

The invention provides an application of sodium oxamate in the preparation of a medicine for resisting iridovirus. Sodium oxamate has an anti-iridovirus effect, can reduce the degree of iridovirus-induced cytopathy, and can reduce the transcriptional level and protein level of viral genes, and sodium oxamate is mild to cells, does not generate toxic or side effects to the cells, and has an extremely important significance in prevention or control of iridovirus.

Description

Technical Field

[0001] This invention belongs to the field of aquaculture technology. More specifically, it relates to the application of sodium oxalate in the preparation of a drug for treating iridovirus. Background Technology

[0002] Largemouth bass (Micropterus salmoides, Largemouth bass), commonly known as California bass, has rapidly become an important freshwater aquaculture species in my country since its introduction in 1983 due to its strong adaptability to the environment, rapid growth, tender flesh, and high nutritional value. However, frequent diseases in largemouth bass aquaculture have severely hampered the industry's development. Among these, largemouth bass ranavirus (LMBV) is one of the most serious viral pathogens. LMBV belongs to the genus Ranavirus of the family Iridoviridae. It spreads rapidly in largemouth bass farming, with a mortality rate as high as 60%, seriously jeopardizing the healthy development of the largemouth bass aquaculture industry.

[0003] LMBV is a double-stranded DNA virus with typical characteristics of iridoviruses. It has an icosahedral structure, with virus particles ranging from 130-150 nm in diameter and possessing an inner spherical core. It typically exists in enveloped or naked form. The major capsid protein (MCP) is the main component of the LMBV envelope and is also the primary virulence protein that elicits the host's immune response. Under an electron microscope, the virus particle exhibits a hexagonal nucleocapsid, scattered within the cytoplasm or arranged in a lattice pattern. The genome size is approximately 100 kb, encoding about 90 potential open reading frames (ORFs). Although the transmission mechanism of LMBV is not yet fully understood, it is undeniable that LMBV has become one of the major viral pathogens affecting largemouth bass in my country. Therefore, there is an urgent need to find drugs for the prevention or treatment of iridoviruses, providing new strategies for disease control in aquatic animals, which is of great significance to the development of largemouth bass aquaculture. Summary of the Invention

[0004] Currently, there are no effective drugs for preventing and treating iridovirus in largemouth bass. To solve this technical problem, this invention provides the application of sodium oxalate in the preparation of drugs for treating iridovirus.

[0005] The first objective of this invention is to provide the use of sodium oxalate in the preparation of a medicament for use against iridovirus.

[0006] Preferably, the iridovirus is a fish iridovirus. More specifically, the fish iridovirus is a largemouth bass iridovirus.

[0007] Preferably, the sodium oxalate is formulated into a pharmaceutical preparation with pharmaceutically acceptable excipients. Further, the pharmaceutical preparation includes oral and injectable formulations, wherein the oral formulations include tablets, capsules, powders, granules, pills, and solutions.

[0008] According to a second aspect of the invention, a medicament for treating iridovirus is provided, the medicament containing an effective amount of sodium oxalate as an active ingredient. Preferably, the iridovirus is a fish iridovirus, more particularly a largemouth bass iridovirus.

[0009] Preferably, the drug comprises at least one pharmaceutically acceptable excipient, such as a carrier, excipient, or solvent, and is formulated into various available dosage forms.

[0010] Beneficial effects:

[0011] Through experimental research, the inventors discovered that sodium oxalate has anti-iridovirus effects, can reduce the degree of iridovirus-induced cytopathic effects, and reduce the transcription and protein levels of viral genes. Moreover, sodium oxalate is mild on cells and does not produce toxic side effects, making it extremely important for the prevention and control of iridovirus. Attached Figure Description

[0012] Figure 1 This is a diagram illustrating the cellular metabolism pattern during sodium oxalate treatment of cells in this invention.

[0013] Figure 2 The image shows the viability test results of FHM cells treated with different concentrations of sodium oxalate in Example 2.

[0014] Figure 3 The figure shows the effect of different sodium oxalate concentrations on the growth and morphology of FHM cells in Example 2.

[0015] Figure 4 This is a graph showing the results of viral infection and CPE process in FHM cells after treatment with sodium oxalate (20 μM) in Example 3.

[0016] Figure 5 This is a graph showing the results of the transcriptional level detection of viral genes in FHM cells after treatment with sodium oxalate (20 μM) in Example 3.

[0017] Figure 6 The image shows the results of MCP protein level and viral titer detection in FHM cells after treatment with sodium oxalate (20 μM) in Example 3; where A: MCP protein expression level; B: viral titer. Detailed Implementation

[0018] The technical features of the technical solution provided by the present invention will be further clearly and completely described below with reference to specific embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0019] The fathead minnow cell line (FHM) was preserved by the Aquatic Animal Medicine Laboratory of South China Agricultural University (Zhang X, Wang L, Liu J, et al. Generation and identification of novel DNA aptamers with antiviral activities against largemouthbass virus (LMBV)[J]. Aquaculture, 2022, 547:737478.), and the applicant guarantees to make it available to the public within 20 years from the date of application.

[0020] Largemouth bass virus (LMBV) was isolated and preserved by the Aquatic Animal Medicine Laboratory of South China Agricultural University. The isolation method was based on Grizzle et al., 2002 and Qin et al., 2024 (Grizzle JM, Altinok I, Fraser WA, et al. First isolation of largemouth bass virus[J]. Diseases of Aquatic Organisms, 2002, 50(3):233; Qin Y, Liu H, Mao S, et al. Isolation, identification, and monoclonal antibody development of largemouthbass virus[J]. Frontiers in Marine Science, 2024, 10.). The applicant guarantees that it will be made available to the public within 20 years from the date of application.

[0021] Example 1: Preparation of LMBV

[0022] Fathead minnow cell line (FHM) was cultured at 28°C in Leibovitz L-15 (Gibco, 41300-039) medium containing 10% fetal bovine serum. The FHM cells were passaged to a 25 cm⁻¹ culture medium the day before the experiment.2 The cells were cultured in culture flasks. When the cells adhered and were in the logarithmic growth phase, LMBV was added to the culture system at a multiplicity of infection (MOI) of 0.1, and then the flasks were incubated. When the vast majority of cells showed obvious CPE (cytopathic effect), the culture flasks were placed at -80°C and subjected to three freeze-thaw cycles to allow complete release of the LMBV virus. The culture medium was then aliquoted and stored at -80°C to obtain LMBV.

[0023] Example 2: Drug toxicity test of sodium oxalate

[0024] One day prior to the experiment, 100 μL of LMBV-sensitive FHM cells were seeded into 96-well cell culture plates containing Leibovitz L-15 (Gibco, 41300-039) medium with 10% fetal bovine serum, with 1 × 10⁶ cells seeded per well. 5 Once the cells have completely adhered and filled a 96-well plate, sodium oxalate is added to Leibovitz L-15 medium containing 10% fetal bovine serum and diluted to different concentrations (0, 10, 20, 40, 60, 80 μM). Then, the original medium in the culture plate is replaced with the above-mentioned medium containing different concentrations of sodium oxalate. After culturing for 24 hours, 1) the medium is discarded and replaced with medium containing 10 μL CCK-8 solution per well. The culture plate is then incubated at 28°C for another 1–4 hours. The absorbance of the culture medium at a wavelength of 450 nm is measured using a multi-mode microplate reader to detect the cell viability of FHM cells; 2) cell morphology is observed.

[0025] Cell viability calculation formula: [(As-Ab) / (Ac-Ab)]*100%

[0026] As: Absorbance of the experimental wells (containing cells incubated with the test drug, culture medium, and CCK-8).

[0027] Ac: Absorbance of control wells (containing untreated cells, culture medium, and CCK-8)

[0028] Ab: Absorbance of blank wells (containing no cells, culture medium, test drug, or CCK-8)

[0029] Depend on Figure 2 The results showed that the cell viability of FHM cells cultured in Leibovitz L-15 medium containing different concentrations of sodium oxalate was not significantly different from that of the untreated group (0 μM) after 24 hours of treatment with sodium oxalate at concentrations of 10, 20, 40, 60, and 80 μM. This indicates that sodium oxalate at concentrations of 10–80 μM does not have a toxic effect on cells.

[0030] Depend on Figure 3 It can be seen that the cell morphology of FHM cells treated with different concentrations of sodium oxalate (10, 20, 40, 60 μM) did not change, indicating that 10–60 μM sodium oxalate had no effect on the morphology of FHM cells.

[0031] Example 3: Antiviral activity experiment of sodium oxalate

[0032] 1. Experimental steps:

[0033] 1.1 Observation of cytopathic effects

[0034] FHM cells were transferred to 24-well plates for culture, with 1 × 10⁶ cells seeded per well. 6 Once the cells had grown to a monolayer and adhered to the plate, the original culture medium (Leibovitz L-15 medium containing 10% fetal bovine serum) was discarded. Leibovitz L-15 medium containing 10% fetal bovine serum with different concentrations of sodium oxalate (0, 10, 20, 40, 60 μM) was added to the 24-well plate. After incubation for 2 hours, LMBV (prepared in Example 1) was added to the 24-well plate according to the multiplicity of infection (MOI) of 1. At the same time, an equal volume of culture medium was used as a control group. After culturing for another 24 hours, the viral cytopathic effect was observed using an optical microscope.

[0035] 1.2 RNA extraction and reverse transcription

[0036] Total RNA was extracted from different groups of cells (after culturing for another 24 hours as described in step 1.1), and then reverse transcribed according to the reverse transcription system shown in Table 1 and the reverse transcription procedure shown in Table 2.

[0037] 1.2.1 RNA Extraction

[0038] Total RNA was extracted from cells using the Cell Total RNA Isolation Kit (purchased from Nanjing Novizan Biotechnology Co., Ltd., product number RC112). The specific steps are as follows:

[0039] (1) Add 250 μL of Buffer cRL1 to the collected cell sample to lyse the cells;

[0040] (2) Transfer the lysed cell mixture to a DNA-Cleaning Column, centrifuge at 12,000 rpm (=13,400×g) for 2 min, remove the DNA-Cleaning Column, and retain the supernatant in the collection tube;

[0041] (3) Add 1.6 times the volume of Buffer cRL2 to the supernatant obtained in step (2) and mix gently;

[0042] (4) Transfer all the mixture to the RNA-only column (place the purification column in the collection tube), centrifuge at 12,000 rpm (=13,400×g) for 1 min, and discard the waste liquid in the collection tube;

[0043] (5) Add 500 μL of Buffer RW1 to the above purification column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid;

[0044] (6) Add 700 μL of Buffer RW2 to the above purification column, centrifuge at 12,000 rpm for 1 min, and discard the waste liquid;

[0045] (7) Repeat step (6) above;

[0046] (8) Centrifuge the collection tube containing the purification column at 12,000 rpm for 2 min.

[0047] (9) Transfer the purification column to a new EP tube, add 30-50 μL of RNase-Free ddH2O preheated at 65°C to the center of the membrane of the purification column, and let it stand at room temperature for 2 min;

[0048] (10) Centrifuge the EP tube containing the purification column at 12,000 rpm for 1 min and collect the RNA solution;

[0049] (11) Take 4 μL of RNA sample for agarose gel electrophoresis detection, and take 1 μL of sample for concentration determination;

[0050] (12) Finally, the remaining RNA was pre-denatured at 65°C for 5 min and then placed on ice;

[0051] (13) Use Use the qPCR RT Kit reverse transcriptase to mix the system into PCR tubes (Table 1), set the PCR reverse transcription program (Table 2), and store at -20℃.

[0052] 1.2.2 Reverse transcription

[0053] The extracted total RNA from cells was reverse transcribed into cDNA using the ReverTra Ace qPCR RT Kit (purchased from Shanghai Xinrui Biotechnology Co., Ltd., product number FSQ-101B). The specific steps of the reverse transcription reaction are as follows:

[0054] (1) Take 1 μg of RNA sample, denature it in a 65℃ water bath for 5 min, and place it on ice;

[0055] (2) Prepare the reaction system: 2 μL of 5×reactionbuffer, 0.5 μL of reverse enzyme mix, 0.5 μL of primermix, and Nuclease-Free H2O to bring the total volume to 10 μL;

[0056] (3) The PCR instrument was used to react at 37℃ for 15 min, then at 98℃ for 5 min, and then stored at -80℃ after cooling.

[0057] Table 1 Reverse Transcription System

[0058]

[0059] Table 2 Reverse transcription procedures

[0060]

[0061] 1.3 Quantitative Real-Time PCR

[0062] Next, the transcriptional levels of viral genes in different groups of cells were detected using quantitative real-time PCR. The experimental procedures for quantitative real-time PCR were as follows: the reaction system was prepared using 2×SYBR GreenReal-time PCR Mix (Table 3), with the β-Actin gene as an internal control. The real-time quantitative PCR reaction was performed on a QuantStudio TM5 real-time quantitative PCR instrument according to the reaction program (Table 4), and the results were analyzed using the software included with the quantitative real-time PCR instrument. The primers for the internal control and the viral gene were as follows:

[0063] MsF-β-actin-RT-F (SEQ ID NO.1): CCACCACAGCCGAGAGGGAA;

[0064] MsF-β-actin-RT-R (SEQ ID NO. 2): TCATGGTGGATGGGGCCAGG;

[0065] LMBV-MCP-RT-F (SEQ ID NO.3): CTCGCCACTTATGACAGCCTTGAC;

[0066] LMBV-MCP-RT-R (SEQ ID NO.4): AACCCACGGGATAATGCTCTTTGAC;

[0067] LMBV-MMP-RT-F (SEQ ID NO.5): GCGTATTTCGCACCCTCTG;

[0068] LMBV-MMP-RT-R(SEQ ID NO.6):TAAGCGTCGCCCTTGTCTG;

[0069] LMBV-DNMT-RT-F (SEQ ID NO.7): AATGTTTGGGTTTGAGGTAG;

[0070] LMBV-DNMT-RT-R (SEQ ID NO. 8): TCTTTAGCAGGCTGAGGG.

[0071] Table 3. Quantitative Fluorescence System

[0072]

[0073] Table 4. Quantitative Fluorescence Procedure

[0074]

[0075] 1.4 Western blot

[0076] Western blot was used to detect the protein levels of viral genes in different groups of cells. The specific steps of the Western blot experiment are as follows:

[0077] (1) Sample preparation: Collect cell samples (step 1.1) into centrifuge tubes, lyse cells using Pierce IP lysis buffer 40 μL, add 10 μL of 5× protein loading buffer, boil in boiling water for 5 min to denature proteins, centrifuge at 12000×g for 5 min, take the supernatant for electrophoresis, or store at -20℃ for later use.

[0078] (2) Preparation of separating and stacking gels: Using the SDS-PAGE gel preparation kit (KeyGen BioTECH), prepare 10% separating gel and 5% stacking gel according to the group ratios in the instructions.

[0079] (3) Sample loading: Correctly load the SDS-PAGE gel into the electrophoresis tank, add 1×SDS-PAGE electrophoresis buffer, slowly pull out the comb on the pre-prepared protein gel, add an equal mass of the protein sample to be tested, and add a protein marker of appropriate size.

[0080] (4) Electrophoretic separation: the upper gel is electrophoresed at low voltage 60V for 25 minutes, and the lower gel is electrophoresed at high voltage 120V for 60 minutes.

[0081] (5) Transfer: Before use, the PVDF membrane (Millipore) needs to be activated in methanol for 30 seconds. After electrophoresis, remove the protein gel and then arrange it in the order of sponge-filter paper-protein gel-PVDF membrane-filter paper-sponge, distinguish the front and back sides and clamp it into the electrophoresis tank. Electrophoresis at a constant current of 100mA for 60 minutes to transfer the protein imprint in the protein gel to the PVDF membrane.

[0082] (6) Blocking: After the transfer is completed, the membrane is removed and placed in 5% skim milk prepared with PBST. The membrane is placed on a horizontal shaker and blocked at room temperature for 2 hours.

[0083] (7) Primary antibody incubation: The anti-MCP antibody was prepared and stored in our laboratory (ZL202210174632.4). The antibody was diluted (1:3000). After blocking, the PVDF membrane was washed with PBST 3 times for 5 min each time. Then the membrane was placed in the diluted antibody solution and incubated on a horizontal shaker at room temperature for 2 h or incubated overnight in a refrigerator at 4 ℃.

[0084] (8) Secondary antibody incubation: Wash the PVDF membrane 3 times with PBST for 5 min each time. After eluting off the excess primary antibody, put the membrane into HRP-labeled secondary antibody (rabbit secondary antibody, 1:5000) and incubate on a horizontal shaker at room temperature for 1 h.

[0085] (9) Color development: Wash the membrane 3 times with PBST, 5 min each time; use the enhanced HRP-DAB substrate color development kit (TIANGEN) and perform color development according to the instructions;

[0086] (10) Photographing and analysis: Take pictures using a chemiluminescence imaging system and perform grayscale analysis on the pictures using ImageJ software.

[0087] 1.5 Virus titer determination

[0088] Using TCID 50 The method for determining LMBV viral titer is as follows:

[0089] (1) FHM cells were seeded into 96-well plates, with 1 × 10⁶ cells seeded per well. 6 Each cell was incubated at 28°C for 18-24 hours.

[0090] (2) Perform 10-fold serial dilutions on the virus samples (10 -1 , ..., 10 -10 ), 100 μL per well, 8 replicates per gradient;

[0091] (3) Observe and record CPE daily for 7 days, and calculate TCID using the Reed-Muench method.50 (Reed LJ, Muench HA simple method of estimating fifty per cent endpoints12[J]. American Journal of Epidemiology, 1938, 27(3): 493-497.).

[0092] 2. Experimental Results:

[0093] Depend on Figure 4 It can be seen that treating FHM cells with 20 μM sodium oxalate significantly reduced the degree of LMBV-induced cytopathic effects, indicating that sodium oxalate has anti-LMBV efficacy.

[0094] Depend on Figure 5 It can be seen that after treating FHM cells with 20 μM sodium oxalate and infecting the cells with LMBV, the transcriptional expression levels of viral MCP, MMP and DNMT genes in the sodium oxalate treatment group were significantly reduced compared with the control group LMBV infection group, indicating that sodium oxalate can inhibit the transcriptional expression of viral genes in infected cells.

[0095] Depend on Figure 6 It was found that after treating FHM cells with 20 μM sodium oxalate and infecting them with LMBV, the expression level of viral MCP protein in the sodium oxalate-treated group was significantly reduced compared with the control group infected with LMBV. Figure 6 A), and significantly reduced viral yield ( Figure 6 B) indicates that sodium oxalate can inhibit the protein expression of viral genes and viral yield in infected cells.

[0096] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. Application of sodium oxalate in the preparation of drugs for treating iridovirus.

2. The application according to claim 1, characterized in that, The iridovirus mentioned is a fish iridovirus.

3. The application according to claim 2, characterized in that, The fish iridovirus mentioned is the largemouth bass iridovirus.

4. The application according to claim 1, characterized in that, The sodium oxalate is formulated into a pharmaceutical preparation with pharmaceutically acceptable excipients.

5. The application according to claim 4, characterized in that, The pharmaceutical preparations include oral preparations and injectable preparations.

6. The application according to claim 5, characterized in that, The oral preparations include tablets, capsules, powders, granules, pills, and solutions.

7. A drug for treating iridovirus, characterized in that, The drug contains an effective amount of sodium oxalate as an active ingredient.

8. The medicament according to claim 7, characterized in that, The iridovirus mentioned is a fish iridovirus.

9. The medicament according to claim 8, characterized in that, The fish iridovirus mentioned is the largemouth bass iridovirus.

10. The medicament according to claim 7, characterized in that, The drug includes pharmaceutically acceptable excipients and is formulated into various available dosage forms.

Images